AptBacterialDB

Target Organism : Streptococcus Pneumoniae

Total records found: 14

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_0918 281195142017High Efficiency Binding Aptamers for a Wide Range of Bacterial Sepsis AgentsAntibac1TCGCGCGAGTCGTCTG-GGGACAGGGAGTGCGCTGCTCCCC-CCGCATCGTCCTCCC55N/AssDNAEscherichia Coli (E. Coli) (ATCC 25922), Klebsiella Pneumoniae (ATCC 27853), Proteus Mirabilis (ATCC 00557), Pseudomonas Aeruginosa (ATCC 700603), Staphylococcus aureus (S. aureus) (ATCC 29213), Streptococcus Pneumoniae (ATCC 23855), and Enterococcus Faecium (ATCC 29212), and Proteus Vulgaris, Morganella Morganii, Citrobacter Freundii, and Acinetobacter BaumanniiPeptidoglycanDevelop generic probes as biological recognition elements in biosensors for sepsis diagnosis in the clinical setting.Antibac1 bound with higher efficiency to both gram-positive (S. aureus, S. penumoniae, L. monocytogenes) and gram-negative (A. baumannii, C. freudii, K. pneumoniae, P. aeruginosa, P. mirabilis).N/AReal-Time Quantitative Polymerase Chain Reaction (RT-qPCR)268.50 ± 54.34 nM (for A. baumannii); 51.74 ± 11.75 nM (for L. monocytogenes); 31.82 ± 4.38 nM (for E.coli); 170.10 ± 32.13 nM (for S.aureus) and 256.10 ± 47.89 nM (for K. pneumoniae)DiagnosticN/AN/AN/AN/AN/AN/AN/A
ABdb_0919 281195142017High Efficiency Binding Aptamers for a Wide Range of Bacterial Sepsis AgentsAntibac2TCGCGCGAGTCGTCTG-GGGGACTAGAGGACTTGTGCGGCC-CCGCATCGTCCTCCC55N/AssDNAEscherichia Coli (E. Coli) (ATCC 25922), Klebsiella Pneumoniae (ATCC 27853), Proteus Mirabilis (ATCC 00557), Pseudomonas Aeruginosa (ATCC 700603), Staphylococcus aureus (S. aureus) (ATCC 29213), Streptococcus Pneumoniae (ATCC 23855), and Enterococcus Faecium (ATCC 29212), and Proteus Vulgaris, Morganella Morganii, Citrobacter Freundii, and Acinetobacter BaumanniiPeptidoglycanDevelop generic probes as biological recognition elements in biosensors for sepsis diagnosis in the clinical setting.Antibac2 bound with higher efficiency to the gram-positive species S. aureus and E. faecium and to the gram-negative species (A. baumannii, C. freudii, K. pneumoniae, M. moraganii, P. aeruginosa, P. mirabilis, and E. coli).N/AReal-Time Quantitative Polymerase Chain Reaction (RT-qPCR)71.92 ± 9.74 nM (for A. baumannii); 54.19 ± 12.09 nM (for L. monocytogenes); 62.43 ± 11.97 nM (for E.coli); 194.90 ± 38.55 nM (for S.aureus) and 195.90 ± 42.91 nM (for K. pneumoniae)DiagnosticN/AN/AN/AN/AN/AN/AN/A
ABdb_1026 299640282018Selection of DNA aptamers to Streptococcus pneumonia and fabrication of graphene oxide based fluorescent assayLyd-3TGACGAGCCCAAGTTACCT-GCCCCCGAACCATACCACACGATGCCCCGTACCCCAGCCACC-AGAATCTCCGCTGCCTACA805'-TGACGAGCCCAAGTTACCT-N42-AGAATCTCCGCTGCCTACA-3' (Library 1) and 5'-AAGGGCTGGCTGGGATGGA-N42-TCACTTCACGGACCCCACT-3' (Library 2)ssDNAStreptococcus PneumoniaeWhole cellIdentify aptamers that bind to and develop a graphene oxide/aptamer-based label-free fluorescent assay to detect Streptococcus pneumoniae and inhibit biofilm formation.Show a detection limit of 15 cfu mL-1. Biofilm formation was reduced from 100% to 35.8% at a Lyd-3 concentration of 1 μM compared with the no-aptamer control.20Fluorescence Spectroscopy661.8 ± 111.3 nMDiagnostic/TherapeuticsWhole Cell-SELEXFAM LabeledN/AN/ABest CandidateN/AN/A
ABdb_1027 299640282018Selection of DNA aptamers to Streptococcus pneumonia and fabrication of graphene oxide based fluorescent assayLyd-1AAGGGCTGGCTGGGATGGA-CCCTCCCGAAACGAGCTGTCTCTTAACGGAAGCTAATCTGCC-TCACTCCACGGACCCCACT805'-TGACGAGCCCAAGTTACCT-N42-AGAATCTCCGCTGCCTACA-3' (Library 1) and 5'-AAGGGCTGGCTGGGATGGA-N42-TCACTTCACGGACCCCACT-3' (Library 2)ssDNAStreptococcus PneumoniaeWhole cellIdentify aptamers that bind to and develop a graphene oxide/aptamer-based label-free fluorescent assay to detect Streptococcus pneumoniae and inhibit biofilm formation.At 100 nM of Lyd-1, biofilm formation decreased to 90.8%.20Fluorescence Spectroscopy844.7 ± 123.6 nMDiagnostic/TherapeuticsWhole Cell-SELEXFAM LabeledN/AN/AN/AN/AN/A
ABdb_1028 299640282018Selection of DNA aptamers to Streptococcus pneumonia and fabrication of graphene oxide based fluorescent assayLyd-2TGACGAGCCCAAGTTACCT-CACCCGCCTGGCAAAAAACACCACGACATTTTTCTCACCCCC-AGAATCTCCGCTGCCTACA805'-TGACGAGCCCAAGTTACCT-N42-AGAATCTCCGCTGCCTACA-3' (Library 1) and 5'-AAGGGCTGGCTGGGATGGA-N42-TCACTTCACGGACCCCACT-3' (Library 2)ssDNAStreptococcus PneumoniaeWhole cellIdentify aptamers that bind to and develop a graphene oxide/aptamer-based label-free fluorescent assay to detect Streptococcus pneumoniae and inhibit biofilm formation.At 100 nM of Lyd-2, biofilm formation decreased to 92.6%.20Fluorescence Spectroscopy1984.8 ± 347.5 nMDiagnostic/TherapeuticsWhole Cell-SELEXFAM LabeledN/AN/AN/AN/AN/A
ABdb_1896 412051602025Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus PneumoniaS8CGTACGGTCGACGCTAGC-ACACCCCCCAGGATCATAAATTCTCTCGCTGTAGC-CACGTGGAGCTCGGATGC715'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3'ssDNAStreptococcus Pneumoniae R6Whole cellAptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT).N/A10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX)Flow CytometryN/ADetectionSELEX and Mod-SELEX5'-Biotinylated and 5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1897 412051602025Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus PneumoniaS10CGTACGGTCGACGCTAGC-ACCAGCCATAGTCACATCAAAACTAACTCACATTC-CACGTGGAGCTCGGATGC715'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3'ssDNAStreptococcus Pneumoniae R6Whole cellAptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT).N/A10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX)Flow CytometryN/ADetectionSELEX and Mod-SELEX5'-Biotinylated and 5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1898 412051602025Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus PneumoniaS12CGTACGGTCGACGCTAGC-CCCATACTCATCACCATTCACATCACTCACCTAGC-CACGTGGAGCTCGGATGC715'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3'ssDNAStreptococcus Pneumoniae R6Whole cellAptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT).N/A10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX)Flow CytometryN/ADetectionSELEX and Mod-SELEX5'-Biotinylated and 5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1899 412051602025Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus PneumoniaS1GGATCCGAGCTCCACGTG-GCTAGGTGAGTGATGTGAATGGTGATGAGTATGGG-GCTAGCGTCGACCGTACG715'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3'ssDNAStreptococcus Pneumoniae R6Whole cellAptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT).S1, the Ru-modified oligonucleotide, bound S. pneumoniae R6 with slightly lower affinity than S9.10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX)Flow Cytometry125 ± 91 nMDetectionSELEX and Mod-SELEXT=dURu(bpy)TP1, 5'-Biotinylated and 5'-FAM LabeledN/AN/ABest CandidateN/AN/A
ABdb_1900 412051602025Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus PneumoniaS9ACACCCCCCAGGATCATAAATTCTCTCGCTGTAGC355'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3'ssDNAStreptococcus Pneumoniae R6Whole cellAptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT).S9 bound better to the bacterial target than the modified sequence S1.10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX)Flow Cytometry118 ± 1 nMDetectionSELEX and Mod-SELEX5'-Biotinylated and 5'-FAM LabeledN/AN/ABest CandidateN/AN/A
ABdb_1901 412051602025Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus PneumoniaS11ACCAGCCATAGTCACATCAAAACTAACTCACATTC355'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3'ssDNAStreptococcus Pneumoniae R6Whole cellAptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT).S11 exhibited a lower propensity at binding to the bacterial target.10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX)Flow Cytometry541 ± 1 nMDetectionSELEX and Mod-SELEX5'-Biotinylated and 5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1902 412051602025Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus PneumoniaS13CCCATACTCATCACCATTCACATCACTCACCTAGC355'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3'ssDNAStreptococcus Pneumoniae R6Whole cellAptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT).N/A10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX)Flow CytometryN/ADetectionSELEX and Mod-SELEX5'-Biotinylated and 5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_2113 https://doi.org/10.1016/j.snb.2017.02.0982017Selection of aptamers to Neisseria meningitidis and Streptococcus pneumoniae surface specific proteins and affinity assay using thin film AlN resonatorsPA05N/AN/AN/AssDNAStreptococcus PneumoniaeSurface-specific Protein PavAGenerated SOMAmers against surface-specific proteins PavA and FHbp and developed a gravimetric aptasensor for the detection of S. pneumoniae and N. meningitidis.N/A8Enzyme-Linked Oligonucleotide Assay (ELONA)N/ADetectionSELEX5'-DIG (Digoxigenin) Labeled and 5-tryptaminocarbonyl-dU (TrpdU))N/AN/AN/AN/AN/A
ABdb_2114 https://doi.org/10.1016/j.snb.2017.02.0982017Selection of aptamers to Neisseria meningitidis and Streptococcus pneumoniae surface specific proteins and affinity assay using thin film AlN resonatorsPA08N/AN/AN/AssDNAStreptococcus PneumoniaeSurface-specific Protein PavAGenerated SOMAmers against surface-specific proteins PavA and FHbp and developed a gravimetric aptasensor for the detection of S. pneumoniae and N. meningitidis.The polyclonal population PA08 showed a frequency shift four times greater and a faster reaction rate than FH05 when measured on the gravimetric sensor.8Enzyme-Linked Oligonucleotide Assay (ELONA)N/ADetectionSELEX5'-DIG (Digoxigenin) Labeled and 5-tryptaminocarbonyl-dU (TrpdU))N/AN/ABest CandidateN/AN/A