Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 292
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0001 | 12799428 | 2003 | A DNA Spiegelmer to staphylococcal enterotoxin B | B12b10_65 | GACGTCTTCGAATCCCCATACTGTGGCATTGGCTCAGGACGGTCTGGAGGATGGGGCTTGACGTG | 65 | 5'-TCAGCTGGACGTCTTCGAAT-N60-TGTCAGGAGCTCGAATTCCC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (Full-length protein and short SEB peptides) | Identify aptamers against the L-configured peptide and the full-length SEB protein. | N/A | 12 | Surface Plasmon Resonance (SPR) | 200 ± 20 (against short SEB peptide) and 420 nM (Full length SEB protein) | Detection | Mirror-Image SELEX | L-DNA Spiegelmer | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0002 | 12799428 | 2003 | A DNA Spiegelmer to staphylococcal enterotoxin B | B12b10 | TCAGCTGGACGTCTTCGAAT-CCCCATACTGTGGCATTGGCTCAGGACGGTCTGGAGGATGGGGCTTGACGTCATCATCTG-TGTCAGGAGCTCGAATTCCC | 100 | 5'-TCAGCTGGACGTCTTCGAAT-N60-TGTCAGGAGCTCGAATTCCC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (Full-length protein and short SEB peptides) | Identify aptamers against the L-configured peptide and the full-length SEB protein. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | Mirror-Image SELEX | L-DNA Spiegelmer | N/A | N/A | N/A | N/A | N/A |
| ABdb_0003 | 12799428 | 2003 | A DNA Spiegelmer to staphylococcal enterotoxin B | B12a10 | TCAGCTGGACGTCTTCGAAT-TACCAAGGTGTACGAGCGGCATTGGCTTAGGATGGTCTAGGAGAACGCCTTGTTCACGGG-TGTCAGGAGCTCGAATTCCC | 100 | 5'-TCAGCTGGACGTCTTCGAAT-N60-TGTCAGGAGCTCGAATTCCC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (Full-length protein and short SEB peptides) | Identify aptamers against the L-configured peptide and the full-length SEB protein. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | Mirror-Image SELEX | L-DNA Spiegelmer | N/A | N/A | N/A | N/A | N/A |
| ABdb_0004 | 12799428 | 2003 | A DNA Spiegelmer to staphylococcal enterotoxin B | B12d10 | TCAGCTGGACGTCTTCGAAT-GGGCATTGGCTAGGACGGTCTAGCAGGAGAAGATGTTAAGTGTGCCTTAGTCAGAGAGTG-TGTCAGGAGCTCGAATTCCC | 100 | 5'-TCAGCTGGACGTCTTCGAAT-N60-TGTCAGGAGCTCGAATTCCC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (Full-length protein and short SEB peptides) | Identify aptamers against the L-configured peptide and the full-length SEB protein. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | Mirror-Image SELEX | L-DNA Spiegelmer | N/A | N/A | N/A | N/A | N/A |
| ABdb_0005 | 12799428 | 2003 | A DNA Spiegelmer to staphylococcal enterotoxin B | B12e7 | TCAGCTGGACGTCTTCGAAT-GGGTATAGTGTCTGGCATTGGCGAGGATGGTCTCAAACGCTAAACCCAATCTGTATAACA-TGTCAGGAGCTCGAATTCCC | 100 | 5'-TCAGCTGGACGTCTTCGAAT-N60-TGTCAGGAGCTCGAATTCCC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (Full-length protein and short SEB peptides) | Identify aptamers against the L-configured peptide and the full-length SEB protein. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | Mirror-Image SELEX | L-DNA Spiegelmer | N/A | N/A | N/A | N/A | N/A |
| ABdb_0006 | 12799428 | 2003 | A DNA Spiegelmer to staphylococcal enterotoxin B | A8c3 | TCAGCTGGACGTCTTCGAAT-CGTGGGCATCGGGCTGCATGAATGGCATTGGCGAGGAGGGTGTGTTTGTAGGCAGCACCT-TGTCAGGAGCTCGAATTCCC | 100 | 5'-TCAGCTGGACGTCTTCGAAT-N60-TGTCAGGAGCTCGAATTCCC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (Full-length protein and short SEB peptides) | Identify aptamers against the L-configured peptide and the full-length SEB protein. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | Mirror-Image SELEX | L-DNA Spiegelmer | N/A | N/A | N/A | N/A | N/A |
| ABdb_0007 | 12799428 | 2003 | A DNA Spiegelmer to staphylococcal enterotoxin B | AE11a5 | TCAGCTGGACGTCTTCGAAT-ACCCGTACAGTCCTATGTTGGCATCCTCACTTGTGGCATTGGCAAGGATGGTCTTCTAG-TGTCAGGAGCTCGAATTCCC | 99 | 5'-TCAGCTGGACGTCTTCGAAT-N60-TGTCAGGAGCTCGAATTCCC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (Full-length protein and short SEB peptides) | Identify aptamers against the L-configured peptide and the full-length SEB protein. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | Mirror-Image SELEX | L-DNA Spiegelmer | N/A | N/A | N/A | N/A | N/A |
| ABdb_0008 | 12799428 | 2003 | A DNA Spiegelmer to staphylococcal enterotoxin B | A8g1 | TCAGCTGGACGTCTTCGAAT-GCTCGACAGGGCACCACCGCCTCGGCATTGGCTAGGTTGGTCTCTTTGGCGGGGTTGCGC-TGTCAGGAGCTCGAATTCCC | 100 | 5'-TCAGCTGGACGTCTTCGAAT-N60-TGTCAGGAGCTCGAATTCCC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (Full-length protein and short SEB peptides) | Identify aptamers against the L-configured peptide and the full-length SEB protein. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | Mirror-Image SELEX | L-DNA Spiegelmer | N/A | N/A | N/A | N/A | N/A |
| ABdb_0049 | 19498077 | 2009 | Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus | SA20 | GCAATGGTACGGTACTTCC-GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Identify aptamers that bind to S. aureus strains, including 8325-4, 196, and 04018, and develop a probe to distinguish them from S. epidermidis, Streptococcus, and E. coli. | EC50 = 70.86 ± 39.22nM and with Multiple aptamers: 479.98 ± 209.94nM. | 5 | Flow Cytometry | N/A | Detection | Subtractive SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0050 | 19498077 | 2009 | Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus | SA23 | GCAATGGTACGGTACTTCC-GGGCTGGCCAGATCAGACCCCGGATGATCATCCTTGTGAGAACCA-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Recognition of different S. aureus strains and mixed aptamer probes distinguishes S. aureus strains, including 8325-4, 196 and 04018, from S. epidermidis, Streptococcus and E. coli. | EC50 = 61.50 ± 22.43nM and with Multiple aptamers: 479.98 ± 209.94nM. | 5 | Flow Cytometry | N/A | Detection | Subtractive SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0051 | 19498077 | 2009 | Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus | SA31 | GCAATGGTACGGTACTTCC-TCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGA-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Recognition of different S. aureus strains and mixed aptamer probes distinguishes S. aureus strains, including 8325-4, 196 and 04018, from S. epidermidis, Streptococcus and E. coli. | EC50=82.86 ± 33.20nM and with Multiple aptamers: 479.98 ± 209.94nM. | 5 | Flow Cytometry | N/A | Detection | Subtractive SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0052 | 19498077 | 2009 | Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus | SA34 | GCAATGGTACGGTACTTCC-CACAGTCACTCAGACGGCCGCTATTGTTGCCAGATTGCCTTTGGC-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Recognition of different S. aureus strains and mixed aptamer probes distinguishes S. aureus strains, including 8325-4, 196 and 04018, from S. epidermidis, Streptococcus and E. coli. | EC50 =72.42 ± 35.23nM and with Multiple aptamers: 479.98 ± 209.94nM. | 5 | Flow Cytometry | N/A | Detection | Subtractive SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0053 | 19498077 | 2009 | Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus | SA43 | GCAATGGTACGGTACTTCC-TCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGT-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Recognition of different S. aureus strains and mixed aptamer probes distinguishes S. aureus strains, including 8325-4, 196 and 04018, from S. epidermidis, Streptococcus and E. coli. | EC50 = 210.70 ± 135.91nM and with Multiple aptamers: 479.98 ± 209.94nM. | 5 | Flow Cytometry | N/A | Detection | Subtractive SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0132 | 22438927 | 2012 | A single-stranded DNA aptamer that selectively binds to Staphylococcus aureus enterotoxin B | APT(SEB1) | GGTATTGAGGGTCGCATC-CACTGGTCGTTGTTGTCTGTTGTCTGTTATGTTGTTTCGT-GATGGCTCTAACTCTCCTCT | 78 | 5'-GGTATTGAGGGTCGCATC-N40-GATGGCTCTAACTCTCCTCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to SEB and quantification of all of the SEs in S. aureus contaminated food. | Have an affinity and high selectivity for SEB. | 14 | N/A | N/A | Detection | SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0133 | 22438927 | 2012 | A single-stranded DNA aptamer that selectively binds to Staphylococcus aureus enterotoxin B | APT(SEB2) | GGTATTGAGGGTCGCATC-CCGTAGTGTGTTCTTATTCGTGTCTGTGTGTGTTCTGTCG-GATGGCTCTAACTCTCCTCT | 78 | 5'-GGTATTGAGGGTCGCATC-N40-GATGGCTCTAACTCTCCTCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to SEB and quantification of all of the SEs in S. aureus contaminated food. | N/A | 14 | N/A | N/A | Detection | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0139 | 22154169 | 2012 | Label-free detection of Staphylococcus aureus in skin using real-time potentiometric biosensors based on carbon nanotubes and aptamers | NH2-Aptamer | GCAATGGTACGGTACTTCCTCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGACAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | A single-walled carbon nanotube (SWCNT) functionalized with an aptamer-based biosensor to detect Staphylococcus aureus in real-time. | With covalent functionalization, the minimum concentration detected was 8 × 10(2) CFU/mL; with the non-covalent approach, it was 10(7) CFU/mL. | N/A | N/A | N/A | Detection | N/A | 3'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0140 | 22154169 | 2012 | Label-free detection of Staphylococcus aureus in skin using real-time potentiometric biosensors based on carbon nanotubes and aptamers | Pyr-Aptamer | GCAATGGTACGGTACTTCCGCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTATCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | A single-walled carbon nanotube (SWCNT) functionalized with an aptamer-based biosensor to detect Staphylococcus aureus in real-time. | With covalent functionalization, the minimum concentration detected was 8 × 10(2) CFU/mL; with the non-covalent approach, it was 10(7) CFU/mL. | N/A | N/A | N/A | Detection | N/A | 3'-C3-Pyr | N/A | N/A | N/A | N/A | N/A |
| ABdb_0142 | 22444566 | 2012 | Dual-color upconversion fluorescence and aptamer-functionalized magnetic nanoparticles-based bioassay for the simultaneous detection of Salmonella Typhimurium and Staphylococcus aureus | Aptamer2 | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed a luminescent bioassay for the simultaneous detection of S. Typhimurium and S. aureus using aptamer-conjugated MNPs and UCNPs (NaY0.78F4:Yb0.2, Tm0.02 UCNPs modified aptamer 1 and NaY0.28F4:Yb0.70, Er0.02 UCNPs modified aptamer 2). | Display linear range of 10(1)-10(5) cfu/mL with a limit of detection of 8 cfu/mL for S. aureus. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0236 | 23689505 | 2013 | Rapid single cell detection of Staphylococcus aureus by aptamer-conjugated gold nanoparticles | SA17 | TCCCTACGGCGCTAAC-CCCCCCAGTCCGTCCTCCCAGCCTCACACC-GCCACCGTGCTACAAC | 62 | 5'-TCCCTACGGCGCTAAC-N30-GCCACCGTGCTACAAC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC: 6538DR) | Whole cell | Identify aptamers that binds to and recognize strains of S.aureus using aptamer-conjugated gold nanoparticles. | LOD was 312 bacterial cells, and the lower limit of detection of the instrument was 63 ± 21 GNPs/μl for 100-nm particles and 508 ± 176 GNPs/μl for 60-nm particles. | 8 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 35 nM and 3.03 nM for SA17-GNPs | Biosensor | Whole Cell-SELEX | Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0237 | 23689505 | 2013 | Rapid single cell detection of Staphylococcus aureus by aptamer-conjugated gold nanoparticles | SA61 | TCCCTACGGCGCTAAC-CTCCCAACCGCTCCACCCTGCCTCCGCCTC-GCCACCGTGCTACAAC | 62 | 5'-TCCCTACGGCGCTAAC-N30-GCCACCGTGCTACAAC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC: 6538DR) | Whole cell | Identify aptamers that binds to and recognize strains of S.aureus using aptamer-conjugated gold nanoparticles. | LOD was 1250 bacterial cells, and the lower limit of detection of the instrument was 63 ± 21 GNPs/μl for 100-nm particles and 508 ± 176 GNPs/μl for 60-nm particles. | 8 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 129 nM and 9.9 nM for SA61-GNPs | Biosensor | Whole Cell-SELEX | Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0263 | https:doi.org10.1039C3AY41576G | 2013 | Selection, identification and application of a DNA aptamer against Staphylococcus aureus enterotoxin A | A1 | AGCAGCACAGAGGTCAGATG-AGGCGATTACGCTTCTTGTACTTCAATAACGACTCAACTC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and develop a fluorescent bioassay to detect SEA in the food sample. | N/A | 12 | Fluorescence Spectroscopy | 92.17 ± 16.75 nM | Biosensor | FluMag (NanoMag)-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0264 | https:doi.org10.1039C3AY41576G | 2013 | Selection, identification and application of a DNA aptamer against Staphylococcus aureus enterotoxin A | A15/40 | AGCAGCACAGAGGTCAGATG-TACTTATGCATTTCCTCCCACGATCTTATTTGAGAGTGAC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and develop a fluorescent bioassay to detect SEA in the food sample. | Limit of detection of 8.7±10(-3) μg/mL with linear range of 0.01-10 μg/mL SEA. | 12 | Fluorescence Spectroscopy | 48.57 ± 6.52 nM | Biosensor | FluMag (NanoMag)-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0265 | https:doi.org10.1039C3AY41576G | 2013 | Selection, identification and application of a DNA aptamer against Staphylococcus aureus enterotoxin A | A23.2 | AGCAGCACAGAGGTCAGATG-ATGATCGTAGTCATTTAAAATTTGAATACTATCAAAGTTA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and develop a fluorescent bioassay to detect SEA in the food sample. | N/A | 12 | Fluorescence Spectroscopy | 235.00 ± 79.05 nM | Biosensor | FluMag (NanoMag)-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0266 | https:doi.org10.1039C3AY41576G | 2013 | Selection, identification and application of a DNA aptamer against Staphylococcus aureus enterotoxin A | A3 | AGCAGCACAGAGGTCAGATG-TACGAGCGGTGGTTTTACCCTGCAATACTTTTGGCTGTTA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and develop a fluorescent bioassay to detect SEA in the food sample. | N/A | 12 | Fluorescence Spectroscopy | N/A | Biosensor | FluMag (NanoMag)-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0267 | https:doi.org10.1039C3AY41576G | 2013 | Selection, identification and application of a DNA aptamer against Staphylococcus aureus enterotoxin A | A25 | AGCAGCACAGAGGTCAGATG-ATAGATTTTTTTCATGATTCTTCATTTTTTTATTTGAAAC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and develop a fluorescent bioassay to detect SEA in the food sample. | N/A | 12 | Fluorescence Spectroscopy | N/A | Biosensor | FluMag (NanoMag)-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0268 | https:doi.org10.1039C3AY41576G | 2013 | Selection, identification and application of a DNA aptamer against Staphylococcus aureus enterotoxin A | A29 | AGCAGCACAGAGGTCAGATG-TATTATCTTACTACGTTGCATCCTACTTTTATAGTCCCCT-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and develop a fluorescent bioassay to detect SEA in the food sample. | N/A | 12 | Fluorescence Spectroscopy | N/A | Biosensor | FluMag (NanoMag)-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0269 | https:doi.org10.1039C3AY41576G | 2013 | Selection, identification and application of a DNA aptamer against Staphylococcus aureus enterotoxin A | A30 | AGCAGCACAGAGGTCAGATG-GGATCTTCCCTCAATGTTTATTGTATATCTGTACTCGTAA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and develop a fluorescent bioassay to detect SEA in the food sample. | N/A | 12 | Fluorescence Spectroscopy | N/A | Biosensor | FluMag (NanoMag)-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0270 | https:doi.org10.1039C3AY41576G | 2013 | Selection, identification and application of a DNA aptamer against Staphylococcus aureus enterotoxin A | A10 | AGCAGCACAGAGGTCAGATG-TCCAATTCAATTCATTTCTGAACTTAGTCGGCACTTTGAC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and develop a fluorescent bioassay to detect SEA in the food sample. | N/A | 12 | Fluorescence Spectroscopy | N/A | Biosensor | FluMag (NanoMag)-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0271 | https:doi.org10.1039C3AY41576G | 2013 | Selection, identification and application of a DNA aptamer against Staphylococcus aureus enterotoxin A | A4 | AGCAGCACAGAGGTCAGATG-CTCCAGCAGCCTCATAGATACGTCGTATCTATTGTTTCCA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and develop a fluorescent bioassay to detect SEA in the food sample. | N/A | 12 | Fluorescence Spectroscopy | N/A | Biosensor | FluMag (NanoMag)-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0272 | https:doi.org10.1039C3AY41576G | 2013 | Selection, identification and application of a DNA aptamer against Staphylococcus aureus enterotoxin A | A23.1 | AGCAGCACAGAGGTCAGATG-AAGGTCTTACATCAATTTATATATTTTTCCAATATCTGTC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and develop a fluorescent bioassay to detect SEA in the food sample. | N/A | 12 | Fluorescence Spectroscopy | N/A | Biosensor | FluMag (NanoMag)-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0275 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #2 | GGGAGAGCGGAAGCGUGCUGGGCC-GGGAGUUUUGAUACGGCUUCAUGCAGUAAUGUUUUUAU-CAUAACCCAGAGGUCGAUGGAUCCCC | 88 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | The level of binding of #2 RNA aptamer to S. aureus was 1.6-fold higher than that of the control aptamer. | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0276 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #10 | GGGAGAGCGGAAGCGUGCUGGGCC-GUUAAUACGGUGUCUUUUUCGGUCGUGUAUAAAACGGAAU-CAUAACCCAGAGGUCGAUGGAUCCCC | 90 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0277 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #14 | GGGAGAGCGGAAGCGUGCUGGGCC-UAGGACAGUUCGUCCUCAUUACAUCGCCGCCUAACACAUC-CAUAACCCAGAGGUCGAUGGAUCCCC | 90 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0278 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #16 | GGGAGAGCGGAAGCGUGCUGGGCC-UUAGAAGUAGCCUGCUACGCAUGGUCGACUCAAGAAUCG-CAUAACCCAGAGGUCGAUGGAUCCCC | 89 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0279 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #18 | GGGAGAGCGGAAGCGUGCUGGGCC-UCCGAACAGCGGAAGGUGGUUCGAAGUUGGGGCUUUGGA-CAUAACCCAGAGGUCGAUGGAUCCCC | 89 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0280 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #21 | GGGAGAGCGGAAGCGUGCUGGGCC-AGUCUGACACGUAGACAGUUCUAUUACUUACGUCGAGA-CAUAACCCAGAGGUCGAUGGAUCCCC | 88 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0281 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #23 | GGGAGAGCGGAAGCGUGCUGGGCC-ACAGUGUUCUAAUGCGACAAUGGAGUCUGUGGCAAAGUGU-CAUAACCCAGAGGUCGAUGGAUCCCC | 90 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0282 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #24 | GGGAGAGCGGAAGCGUGCUGGGCC-UCUCAGGCCGACAUUCUGAGAACGCGAGGCGUAUUGAAG-CAUAACCCAGAGGUCGAUGGAUCCCC | 89 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0283 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #26 | GGGAGAGCGGAAGCGUGCUGGGCC-UUCAAGUAGGGGCGGUUUACUAUCUGGAUCUUGUAGUUAU-CAUAACCCAGAGGUCGAUGGAUCCCC | 90 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0284 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #07 | GGGAGAGCGGAAGCGUGCUGGGCC-ACUUGGGGACGACGAGUAGAUAGUAAGGUGGAGACCUGGU-CAUAACCCAGAGGUCGAUGGAUCCCC | 90 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0285 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #06 | GGGAGAGCGGAAGCGUGCUGGGCC-UAUGACAUAAGGUGGGCUGGGAAGCUAGAGCAUGUAAGG-CAUAACCCAGAGGUCGAUGGAUCCCC | 89 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0286 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #05 | GGGAGAGCGGAAGCGUGCUGGGCC-GUGAAGAAAAAGGGGCGGAUUGGGUAGUAGGGAGGAGAUC-CAUAACCCAGAGGUCGAUGGAUCCCC | 90 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0287 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #04 | GGGAGAGCGGAAGCGUGCUGGGCC-AGGAUAGGGGAUGAAGAAAAAAAGAAGGGUGCCGUGGCGC-CAUAACCCAGAGGUCGAUGGAUCCCC | 90 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0288 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone G1 | GGGAGAGCGGAAGCGUGCUGGGCC-UCCGAACAGCGGAAGGUGGUUCGAAGUUGGGGCUUUGGA-CAUAACCCAGAGGUCGAUGGAUCCCC | 89 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0335 | 23872060 | 2013 | Carbon nanotube-based aptasensors for the rapid and ultrasensitive detection of bacteria | A3 | GCAATGGTACGGTACTTCCTCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGACAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CECT 4630) | Type IVB Pili structural proteins | Develop a potentiometric biosensor based on carbon nanotubes (transducer layer) and aptamers (sensing layer) for the detection of bacteria. | Display linear range from 8 × 10(2) CFU/mL–10(8) CFU/mL with LOD of 8 x10(2) CFU/mL and the signal was stable for at least one hour. | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0339 | 23929394 | 2013 | A PDMS/paper/glass hybrid microfluidic biochip integrated with aptamer-functionalized graphene oxide nano-biosensors for one-step multiplexed pathogen detection | S. aureus (FASA) | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed an aptamer-functionalized graphene oxide (GO) nano-biosensor for multiplexed pathogen detection. | Detection limits (LOD) of 800.0 cfu/mL (S. aureus) and linear ranges of 10(4)–10(6) cfu/mL. | N/A | N/A | 35 nM | Biosensor | N/A | 5'-Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0356 | 25185503 | 2014 | Selection of peptidoglycan-specific aptamers for bacterial cells identification | Antibac1 | TCGCGCGAGTCGTCTG-GGGACAGGGAGTGCGCTGCTCCCC-CCGCATCGTCCTCCC | 55 | 5'-TCGCGCGAGTCGTCTG-N24-CCGCATCGTCCTCCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) and Escherichia Coli (E. Coli) TOP10 | Peptidoglycan | Identify aptamers that bind to the peptidoglycan of bacterial cells. | High binding affinity for S. aureus, as the radioactivity of Antibac1 was 28 times higher than the negative control. | 5 | Saturation Binding Assay | 0.415 + 0.047 μM | Detection | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0357 | 25185503 | 2014 | Selection of peptidoglycan-specific aptamers for bacterial cells identification | Antibac2 | TCGCGCGAGTCGTCTG-GGGGACTAGAGGACTTGTGCGGCC-CCGCATCGTCCTCCC | 55 | 5'-TCGCGCGAGTCGTCTG-N24-CCGCATCGTCCTCCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) and Escherichia Coli (E. Coli) TOP10 | Peptidoglycan | Identify aptamers that bind to the peptidoglycan of bacterial cells. | High binding affinity for S. aureus, as the radioactivity of Antibac2 was 22 times higher than the negative control. | 5 | Saturation Binding Assay | 1.261 + 0.280 μM | Detection | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0414 | 24325983 | 2014 | Graphene-based potentiometric biosensor for the immediate detection of living bacteria | SA20 | GCAATGGTACGGTACTTCCGCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTATCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CECT 4630) | Whole cell | Developed a potentiometric aptasensor based on graphene oxide (GO-covalently conjugated aptamer) and reduced graphene oxide (RGO-non-covalently conjugated aptamer) to detect S. aureus. | Able to detect 1 CFU/mL in a few minutes. | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0415 | 24325983 | 2014 | Graphene-based potentiometric biosensor for the immediate detection of living bacteria | SA31 | GCAATGGTACGGTACTTCCTCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGACAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CECT 4630) | Whole cell | Developed a potentiometric aptasensor based on graphene oxide (GO-covalently conjugated aptamer) and reduced graphene oxide (RGO-non-covalently conjugated aptamer) to detect S. aureus. | Able to detect 1 CFU/mL in a few minutes. | N/A | N/A | N/A | Biosensor | N/A | 3'-C3-Pyr | N/A | N/A | N/A | N/A | N/A |
| ABdb_0416 | 24804556 | 2014 | Aptamer-fluorescent silica nanoparticles bioconjugates based dual-color flow cytometry for specific detection of Staphylococcus aureus | Aptamer | GCAATGGTACGGTACTTCCTCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGACAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Develop aptamer recognition and FSiNPs label-based dual-colour flow cytometry assay (Aptamer/FSiNPs-DCFCM) for the detection of S. aureus. | Detects as low as 1.5×10(2) and 7.6×10(2) cells/mL S. aureus in buffer and spiked milk, respectively. | N/A | N/A | N/A | Biosensor | N/A | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0430 | 24568625 | 2014 | Simultaneous aptasensor for multiplex pathogenic bacteria detection based on multicolor upconversion nanoparticles labels | Apt₁ | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed a multiplex method for the simultaneous detection of three pathogenic bacteria using multicolour upconversion nanoparticles (UCNPs) coupled with aptamers. | The linear range showed from 50-10(6) cfu/mL, and the limits of detection were 25 cfu/mL for S. aureus. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0457 | 24913871 | 2014 | A sensitive gold nanoparticle-based colorimetric aptasensor for Staphylococcus aureus | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed a gold nanoparticle-based colorimetric aptasensor for S. aureus using tyramine signal amplification (TSA) technology. | Exhibited a linear detection range from 10 to 10⁶ cfu/mL with a limit of detection (LOD) of 9 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0538 | 25624325 | 2015 | Neutralization of staphylococcal enterotoxin B by an aptamer antagonist | A11 | ATACCAGCTTATTCAATT-TAGGCGGTGGAGATAGTAAGTGCAATCTAGGCGGTGGAGATAGTAAGTGCAATCTATGCC-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-N60-AGATAGTAAGTGCAATCT3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and block SEB-mediated toxic shock (TSS) in vitro. | Inhibited SEB-mediated PBMC proliferation of 93% and TNF-α, IL-1β, IL-6, IL-2, and IFN-γ in culture supernatants were reduced by 77, 97, 64, 96, and 99%, respectively. 90% survival of mouse models of SEB-induced TSS. | 11 | Fluorescence Spectroscopy | 64 nM | Therapeutics/Immunmodulatory | SELEX | 5′-Polyethylene glycol (PEG) with 5'-Amidation (NH₂) and 3’-Inverted Thymidine (3'-idT) and 5'-Biotinylated or 5'-FITC Labeled | Showed no cytotoxic effects on PBMCs. | N/A | N/A | N/A | N/A |
| ABdb_0539 | 25624325 | 2015 | Neutralization of staphylococcal enterotoxin B by an aptamer antagonist | A2 | ATACCAGCTTATTCAATT-GATCGATCGATCAGTCAGTCGACCAACGCACGACACGCATCGCTCTATCTCGTCGAACAG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-N60-AGATAGTAAGTGCAATCT3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and block SEB-mediated toxic shock (TSS) in vitro. | A2 achieved 34% PBMC proliferation inhibition. | 11 | Fluorescence Spectroscopy | 26 nM | Therapeutics/Immunmodulatory | SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0540 | 25891472 | 2015 | Antibiotic loaded nanocapsules functionalized with aptamer gates for targeted destruction of pathogen | SA20hp | GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT | 45 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Aptamer-gated nanocapsules for the specific targeting of vancomycin to bacteria for the controlled release of vancomycin. | 15-fold increase of efficacy for vancomycin with MIC of 0.420 μg/mL. | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 5'-AlexaFluor 488 Labeled and 3'-(PEG)-AGGGCGC-BH1 | MICs of vancomycin-nanoparticles for S. epidermidis (control) were found to be 6.295 µg/mL. | N/A | N/A | N/A | N/A |
| ABdb_0541 | 25053102 | 2015 | Selection and characterization of DNA aptamers against Staphylococcus aureus enterotoxin C1 | C10 | AGCAGCACAGAGGTCAGATG-TATACTTCTAAAATTTGTTTGTATCTACGATGTTCTTCGT-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin C1 (SEC1) | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect SEC1 in milk samples. | Have a limit of detection of 6 ng/mL with a range of 0.01–10 μg/mL of SEC1. | 12 | Fluorescence Spectroscopy | 65.14 ± 11.64 nM | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0542 | 25053102 | 2015 | Selection and characterization of DNA aptamers against Staphylococcus aureus enterotoxin C2 | C36.2 | AGCAGCACAGAGGTCAGATG-TATCAGAATTAATGCTCTCGTAATTTTCGAATCGTCGTGT-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin C1 (SEC1) | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect SEC1 in milk samples. | N/A | 12 | Fluorescence Spectroscopy | 49.43 ± 11.76 nM | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0543 | 25053102 | 2015 | Selection and characterization of DNA aptamers against Staphylococcus aureus enterotoxin C3 | C34.1 | AGCAGCACAGAGGTCAGATG-CTTTCATTTTTATTCTTTTTGACTGTATTTTATGTACCAT-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin C1 (SEC1) | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect SEC1 in milk samples. | N/A | 12 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0544 | 25053102 | 2015 | Selection and characterization of DNA aptamers against Staphylococcus aureus enterotoxin C4 | C4 | AGCAGCACAGAGGTCAGATG-CTAACCTAATTCGACCGTGTATTCTTCTGCGTTATTTACC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin C1 (SEC1) | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect SEC1 in milk samples. | N/A | 12 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0545 | 25053102 | 2015 | Selection and characterization of DNA aptamers against Staphylococcus aureus enterotoxin C5 | C10 | AGCAGCACAGAGGTCAGATG-TATACTTCTAAAATTTGTTTGTATCTACGATGTTCTTCGT-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin C1 (SEC1) | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect SEC1 in milk samples. | N/A | 12 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0546 | 25053102 | 2015 | Selection and characterization of DNA aptamers against Staphylococcus aureus enterotoxin C6 | C9 | AGCAGCACAGAGGTCAGATG-TCCATTATCAGGTTCTTTATTCTGTTGTTCAACTTATTAA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin C1 (SEC1) | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect SEC1 in milk samples. | N/A | 12 | Fluorescence Spectroscopy | 154.9 ± 45.67 nM | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0547 | 25053102 | 2015 | Selection and characterization of DNA aptamers against Staphylococcus aureus enterotoxin C7 | C32.1 | AGCAGCACAGAGGTCAGATG-TTTTAGATTTAGCTCTTATTTGTTCGAGCAATCCCAAAGA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin C1 (SEC1) | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect SEC1 in milk samples. | N/A | 12 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0548 | 25053102 | 2015 | Selection and characterization of DNA aptamers against Staphylococcus aureus enterotoxin C8 | C2 | AGCAGCACAGAGGTCAGATG-GCCAACTCAATTTTTTGTTTTGTCTTTCCGATTGATCTTA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin C1 (SEC1) | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect SEC1 in milk samples. | N/A | 12 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0549 | 25053102 | 2015 | Selection and characterization of DNA aptamers against Staphylococcus aureus enterotoxin C9 | C6 | AGCAGCACAGAGGTCAGATG-CATATCGAATTTTCCTCGTGATTTTTCTTTCATTCTTAGA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin C1 (SEC1) | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect SEC1 in milk samples. | N/A | 12 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0550 | 25053102 | 2015 | Selection and characterization of DNA aptamers against Staphylococcus aureus enterotoxin C10 | C11 | AGCAGCACAGAGGTCAGATG-TAGTTAATGGATTTTTCTTCTTTATCTTCTTATTTCTTGA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin C1 (SEC1) | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect SEC1 in milk samples. | N/A | 12 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0551 | 25053102 | 2015 | Selection and characterization of DNA aptamers against Staphylococcus aureus enterotoxin C11 | C30 | AGCAGCACAGAGGTCAGATG-ATGTTTTCCCTTATCACTACTTTTATTTGTCTTTTTGCAC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin C1 (SEC1) | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect SEC1 in milk samples. | N/A | 12 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0552 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmA12 | UGUAAUUCUGCCAUUCUUUUUGGGGCGGAAUACAGGAUGU | 40 | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | fmA12-functionalized AgNPs resulted in specific S. aureus antimicrobial activity with only a 1.6 ± 1.0% survival of 12598 cells and 51.9 ± 2.0% survival of 10832 cells. | 8 | Surface Plasmon Resonance (SPR) and Bio-Layer Interferometry (BLI) | 95 nM (by SPR) and 67.1 ± 6.1 nM (by BLI) | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | 76% fmA12 survives in 10% mouse serum at 37°C over 24 h, and in 50% serum, 85.0% fmA12 survives after 5 h. | N/A | ~52 h for fmA12. | N/A |
| ABdb_0553 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmF07 | AUACGCUGCUCACUAAAGUCGGGAGUACUCCAAUGUUUUC | 40 | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | N/A | 8 | Bio-Layer Interferometry (BLI) | 38.9 ± 4.1 nM (by BLI) | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0554 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmE09 | AUCUAGCAAGCACUUGCAAACAUUCGAUAACGGGGAUUC | 39 | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | N/A | 8 | Bio-Layer Interferometry (BLI) | 418 ± 112 nM (by BLI) | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0555 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmG12 | UGCCAAUGUAACUCAACACUCUUCAUUGAGCUGUCGGGCA | 40 | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | N/A | 8 | Surface Plasmon Resonance (SPR) and Bio-Layer Interferometry (BLI) | 475 nM (by SPR) and 220 ± 24 nM (by BLI) | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0556 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmA12Δ3 | N/A | N/A | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | N/A | 8 | Bio-Layer Interferometry (BLI) | 69.7 ± 3.5 nM | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0557 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmA12Δ6 | N/A | N/A | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | N/A | 8 | Bio-Layer Interferometry (BLI) | 63.1 ± 7.3 μM | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0558 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmA12Δ9 | N/A | N/A | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | N/A | 8 | Bio-Layer Interferometry (BLI) | 69.1 ± 16.7 nM | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0566 | 25884791 | 2015 | Comparison of whole-cell SELEX methods for the identification of Staphylococcus aureus-specific DNA aptamers | A2 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-ACGGGCGTGGGAGGCAATGCCTTGCTTGTAGGCTTCCCCTGTGCGCG-GGTGGATCCATATTCCTACTCG | 107 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Staphylococcus aureus (S. aureus) (KCCM 12103) | Whole cell | Identify aptamers against bacterial surface molecules and live Staphylococcus aureus. | N/A | 16 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0567 | 25884791 | 2015 | Comparison of whole-cell SELEX methods for the identification of Staphylococcus aureus-specific DNA aptamers | A14 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-CACACCGCAGCAGTGGGAACGTTTCAGCCATGCAAGCATCACGCCCGT-GGTGGATCCATATTCCTACTCG | 108 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Staphylococcus aureus (S. aureus) (KCCM 12103) | Whole cell | Identify aptamers against bacterial surface molecules and live Staphylococcus aureus. | Showed specific binding to S. aureus. | 16 | Fluorescence Spectroscopy | 3.49 ± 1.43 nM | Detection | Whole Cell-SELEX | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0568 | 25884791 | 2015 | Comparison of whole-cell SELEX methods for the identification of Staphylococcus aureus-specific DNA aptamers | A15 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-CACGCGCAAACAGATTAACACTCCGCCTAAGTCTGCCGCACGC-GGTGGATCCATATTCCTACTCG | 103 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Staphylococcus aureus (S. aureus) (KCCM 12103) | Whole cell | Identify aptamers against bacterial surface molecules and live Staphylococcus aureus. | N/A | 16 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0569 | 25884791 | 2015 | Comparison of whole-cell SELEX methods for the identification of Staphylococcus aureus-specific DNA aptamers | A20 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GCGTGCAGCGGGGGCTGCGCGGTGGAGTGCTGTGGGCG-GGTGGATCCATATTCCTACTCG | 98 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Staphylococcus aureus (S. aureus) (KCCM 12103) | Whole cell | Identify aptamers against bacterial surface molecules and live Staphylococcus aureus. | N/A | 16 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0570 | 25884791 | 2015 | Comparison of whole-cell SELEX methods for the identification of Staphylococcus aureus-specific DNA aptamers | B3 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GCGTGCGGAGCCAGGATGGGAGGTCTGTAGGTCTGCGGGGCGTG-GGTGGATCCATATTCCTACTCG | 104 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Staphylococcus aureus (S. aureus) (KCCM 12103) | Whole cell | Identify aptamers against bacterial surface molecules and live Staphylococcus aureus. | Showed specific binding to S. aureus. | 16 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0571 | 25884791 | 2015 | Comparison of whole-cell SELEX methods for the identification of Staphylococcus aureus-specific DNA aptamers | B6 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GCGTGTCGGTGTCTGCCGGGGGATGTGGAGGCTGGGTGTTGCGCG-GGTGGATCCATATTCCTACTCG | 105 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Staphylococcus aureus (S. aureus) (KCCM 12103) | Whole cell | Identify aptamers against bacterial surface molecules and live Staphylococcus aureus. | Showed specific binding to S. aureus. | 16 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0572 | 25884791 | 2015 | Comparison of whole-cell SELEX methods for the identification of Staphylococcus aureus-specific DNA aptamers | B7 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GCGTGGGCGGGCTACCTGGCTAGTACGCCATGATGCCTGCACGCG-GGTGGATCCATATTCCTACTCG | 105 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Staphylococcus aureus (S. aureus) (KCCM 12103) | Whole cell | Identify aptamers against bacterial surface molecules and live Staphylococcus aureus. | N/A | 16 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0573 | 25884791 | 2015 | Comparison of whole-cell SELEX methods for the identification of Staphylococcus aureus-specific DNA aptamers | B15 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-CACGCGCAAACAGATTAACACTCCGCCTAAGTCTGCCGCACGC-GGTGGATCCATATTCCTACTCG | 103 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Staphylococcus aureus (S. aureus) (KCCM 12103) | Whole cell | Identify aptamers against bacterial surface molecules and live Staphylococcus aureus. | N/A | 16 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0574 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#2/8 | ATACCAGCTTATTCAATT-AGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCT-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | PA#2/8 competes with IgG or IgG-Fc for binding to Protein A. | 11 | Bead-based Binding Assay | 1.06 ±0.2 μM | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0575 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#4/22 | ATACCAGCTTATTCAATT-GCAGTACTGATGAGTGTAGCCGTATGATTATCGTTTGTGG-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0576 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#4/34 | ATACCAGCTTATTCAATT-CCCCAACGAGTCGATATGTAGCCCACACTCTGATTCGTCC-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0577 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#2/11 | ATACCAGCTTATTCAATT-GGAGACGACAAACTATTACGTACTACGGCATGCACTTGGT-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0578 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#2/3 | ATACCAGCTTATTCAATT-CGACAAGTGGGCATTACGATTCTAGCCCTGATTATGTTCC-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0579 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#2/6 | ATACCAGCTTATTCAATT-ACCGATCACTAGCCGACTAATTGGTTTCCGATCGCAGTCC-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0580 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#14/82 | ATACCAGCTTATTCAATT-CCACAACCGAACTCGTAAGACGTATGTAGCCGCCAACTGT-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0581 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#6/52 | ATACCAGCTTATTCAATT-ACGCATTGGAGCCCGAAACTGATTCATTGAGCCTACCTGT-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0582 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#2/14 | ATACCAGCTTATTCAATT-ACGACCGTAGACGACTTACACTGATGTTGCGCATTTCTGT-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0583 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#4/31 | ATACCAGCTTATTCAATT-CGATGACGACTGTAGCCGCAATACGCCCCTGTTACGTTGT-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0584 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#6/41 | ATACCAGCTTATTCAATT-GGACGCCGACTAACTTTACGTGGTTCTCCTACCGCCTAACC-ACAATCGTAATCAGTTAG | 77 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0585 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#6/43 | ATACCAGCTTATTCAATT-ACGAAATGTAGCCGATCCTGATTACTCTCTGTCAGCTTGG-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0626 | 25562742 | 2015 | Aptamer-conjugated silver nanoparticles for electrochemical dual-aptamer-based sandwich detection of staphylococcus aureus | Primary anti-S.aureus aptamer | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | Dual-aptamer-based sandwich immunosensor (Apt/S.aureus/apt-AgNP) for the detection of S. aureus. | Display a dynamic range from 10 to 1×10(6) cfu/mL with a low detection limit of 1.0 cfu/mL. | 2 | N/A | 35 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated (Biotin-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0627 | 25562742 | 2015 | Aptamer-conjugated silver nanoparticles for electrochemical dual-aptamer-based sandwich detection of staphylococcus aureus | Secondary anti-S.aureus aptamer | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | Dual-aptamer-based sandwich immunosensor (Apt/S.aureus/apt-AgNP) for the detection of S. aureus. | Display a dynamic range from 10 to 1×10(6) cfu/mL with a low detection limit of 1.0 cfu/mL. | 2 | N/A | 129 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0644 | 25633102 | 2015 | In vitro selection of single-stranded DNA molecular recognition elements against S. aureus alpha toxin and sensitive detection in human serum | R12.06 | TGTACCGTCTGAGCGATTCGTAC-GATTACTATAATTTCCTATCGTCCGACCGCCGTC-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Molecular recognition element (MRE) targeting alpha toxin | Identify aptamer against MRE and develop modified sandwich ELISA to detect alpha toxin in undiluted human serum samples. | Display a sensitive detection of 200 nM alpha toxin. | 12 | Surface Plasmon Resonance (SPR) | 93.7 ± 7.0 nM | Detection | SELEX | 5'-Amidation (NH₂-(CH2)6) or 5'-FAM Labeled | N/A | N/A | N/A | Average half-life of ssDNA MREs in serum is about one hour. | N/A |
| ABdb_0645 | 25633102 | 2015 | In vitro selection of single-stranded DNA molecular recognition elements against S. aureus alpha toxin and sensitive detection in human serum | R12.26 | TGTACCGTCTGAGCGATTCGTAC-CCTTGCCGATGCCTTTACGGTCTAGTTTGGATGT-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Molecular recognition element (MRE) targeting alpha toxin | Identify aptamer against MRE and develop modified sandwich ELISA to detect alpha toxin in undiluted human serum samples. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0646 | 25633102 | 2015 | In vitro selection of single-stranded DNA molecular recognition elements against S. aureus alpha toxin and sensitive detection in human serum | R12.01 | TGTACCGTCTGAGCGATTCGTAC-TCGGGCGATGATACTTAGCACGGTCTAGGTCAAA-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Molecular recognition element (MRE) targeting alpha toxin | Identify aptamer against MRE and develop modified sandwich ELISA to detect alpha toxin in undiluted human serum samples. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0647 | 25633102 | 2015 | In vitro selection of single-stranded DNA molecular recognition elements against S. aureus alpha toxin and sensitive detection in human serum | R12.20 | TGTACCGTCTGAGCGATTCGTAC-TAGCGGCAGAGTAGCACTCTATAGGTCGATGTTT-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Molecular recognition element (MRE) targeting alpha toxin | Identify aptamer against MRE and develop modified sandwich ELISA to detect alpha toxin in undiluted human serum samples. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0648 | 25633102 | 2015 | In vitro selection of single-stranded DNA molecular recognition elements against S. aureus alpha toxin and sensitive detection in human serum | R12.02 | TGTACCGTCTGAGCGATTCGTAC-CGTGTCCTATTTTCTTCTCTGTTAACTCTCGTC-AGCCAGTCAGTGTTAAGGAGTGC | 79 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Molecular recognition element (MRE) targeting alpha toxin | Identify aptamer against MRE and develop modified sandwich ELISA to detect alpha toxin in undiluted human serum samples. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0649 | 25633102 | 2015 | In vitro selection of single-stranded DNA molecular recognition elements against S. aureus alpha toxin and sensitive detection in human serum | R12.06 | TGTACCGTCTGAGCGATTCGTAC-GATTACTATAATTTCTTATCGTCCGACCGCCGTC-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Molecular recognition element (MRE) targeting alpha toxin | Identify aptamer against MRE and develop modified sandwich ELISA to detect alpha toxin in undiluted human serum samples. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0650 | 25633102 | 2015 | In vitro selection of single-stranded DNA molecular recognition elements against S. aureus alpha toxin and sensitive detection in human serum | R12.39 | TGTACCGTCTGAGCGATTCGTAC-TTTGATCTCGTGTGTCTAGTTGCGGCGGATTGTC-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Molecular recognition element (MRE) targeting alpha toxin | Identify aptamer against MRE and develop modified sandwich ELISA to detect alpha toxin in undiluted human serum samples. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0651 | 25633102 | 2015 | In vitro selection of single-stranded DNA molecular recognition elements against S. aureus alpha toxin and sensitive detection in human serum | R12.10 | TGTACCGTCTGAGCGATTCGTAC-GGTCAACCTCACCGACTGCCGACCGTTTAATTCG-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Molecular recognition element (MRE) targeting alpha toxin | Identify aptamer against MRE and develop modified sandwich ELISA to detect alpha toxin in undiluted human serum samples. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0652 | 25633102 | 2015 | In vitro selection of single-stranded DNA molecular recognition elements against S. aureus alpha toxin and sensitive detection in human serum | R12.43 | TGTACCGTCTGAGCGATTCGTAC-CGTCATTGCCTCGTAGTATTCTTATAGTCGGTAG-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Molecular recognition element (MRE) targeting alpha toxin | Identify aptamer against MRE and develop modified sandwich ELISA to detect alpha toxin in undiluted human serum samples. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0653 | 25633102 | 2015 | In vitro selection of single-stranded DNA molecular recognition elements against S. aureus alpha toxin and sensitive detection in human serum | R12.44 | TGTACCGTCTGAGCGATTCGTAC-TCCCGAAAGCGCGTCAGCCTGGGAGGTTATGCGG-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Molecular recognition element (MRE) targeting alpha toxin | Identify aptamer against MRE and develop modified sandwich ELISA to detect alpha toxin in undiluted human serum samples. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0696 | 25533762 | 2015 | Identification of Staphylococcus aureus infection by aptamers directly radiolabeled with technetium-99m | SA20 | GCAATGGTACGGTACTTCC-GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT-CAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | 99mTc-labelled aptamers for bacterial infection identification. | EC50 value of 99mTc labelled aptamer was 70.86 nM and displayed a target/non-target ratio of 4.0±0.5. | N/A | Radiolabeled Binding assay | N/A | Diagnostic | N/A | 5'-Amidation (NH₂-(CH2)6) and 5'-Radiolabelled (32P-labeled) | N/A | Radiolabeled aptamers with 99mTc were stable in 0.9% saline solution, in plasma, and in the presence of excess cysteine (50-, 500-, and 5000-fold), even for long period of 24hr. | N/A | N/A | N/A |
| ABdb_0697 | 25533762 | 2015 | Identification of Staphylococcus aureus infection by aptamers directly radiolabeled with technetium-99m | SA23 | GCAATGGTACGGTACTTCC-GGGCTGGCCAGATCAGACCCCGGATGATCATCCTTGTGAGAACCA-CAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | 99mTc-labelled aptamers for bacterial infection identification. | EC50 value of 99mTc labelled aptamer was 61.50 nM and displayed a target/non-target ratio of 4.0±0.5. | N/A | Radiolabeled Binding assay | N/A | Diagnostic | N/A | 5'-Amidation (NH₂-(CH2)6) and 5'-Radiolabelled (32P-labeled) | N/A | Radiolabeled aptamers with 99mTc were stable in 0.9% saline solution, in plasma, and in the presence of excess cysteine (50-, 500-, and 5000-fold), even for long period of 24hr. | N/A | N/A | N/A |
| ABdb_0698 | 25533762 | 2015 | Identification of Staphylococcus aureus infection by aptamers directly radiolabeled with technetium-99m | SA34 | GCAATGGTACGGTACTTCC-CACAGTCACTCAGACGGCCGCTATTGTTGCCAGATTGCCTTTGGC-CAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | 99mTc-labelled aptamers for bacterial infection identification. | EC50 value of 99mTc labelled aptamer was 72.42 nM and displayed a target/non-target ratio of 4.0±0.5. | N/A | Radiolabeled Binding assay | N/A | Diagnostic | N/A | 5'-Amidation (NH₂-(CH2)6) and 5'-Radiolabelled (32P-labeled) | N/A | Radiolabeled aptamers with 99mTc were stable in 0.9% saline solution, in plasma, and in the presence of excess cysteine (50-, 500-, and 5000-fold), even for long period of 24hr. | N/A | N/A | N/A |
| ABdb_0699 | 25461175 | 2015 | A new aptamer/graphene interdigitated gold electrode piezoelectric sensor for rapid and specific detection of Staphylococcus aureus | S. aureus aptamer. | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | Developed an aptamer/graphene interdigitated gold electrode piezoelectric sensor to detect Staphylococcus aureus. | Achieved a detection limit of 41 cfu/mL with a linear range of 4.1×10(1) to 4.1×10(5) cfu/mL. The detection is rapid, completing in less than 60 minutes. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0701 | 26241735 | 2015 | Gold nanoparticles enhanced SERS aptasensor for the simultaneous detection of Salmonella typhimurium and Staphylococcus aureus | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | A GNPs-modified Raman-based biosensor was developed for the simultaneous detection of S. typhimurium and S. aureus. | Linear detection range of 10^2 to 10^7 cfu/mL for both; LOD of 35 cfu/mL for S. aureus. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0703 | https://doi.org/10.1080/00032719.2015.1036278 | 2015 | Aptamer Immobilized Magnetoelastic Sensor for the Determination of Staphylococcus aureus | S. aureus aptamer. | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Develop an aptamer-based magnetoelastic sensor for the detection of S. aureus. | Linear dynamic range of 10^1–10^11 cfu/mL and detection limit of 5 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0756 | 27179422 | 2016 | Inhibition of the superantigenic activities of Staphylococcal enterotoxin A by an aptamer antagonist | S3 | ATACCAGCTTATTCAATT-CCCGCCTCTGAGCATTATTAATGTTATACCTTACGGCTGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and block superantigen activity of SEA. | Inhibited PBMCs proliferation with an inhibition rate of 84% and reduced IFN-γ, TNF-α, IL-2, and IL-6 secretions by 89%, 87%, 73%, 69%, respectively. PEGS3 allowed 79% of the mice to survive the lethal challenge. | 9 | Enzyme-Linked Aptamer Assay (ELAA) | 36.93 ± 7.29 nM | Therapeutics/Immunmodulatory | SELEX | 5′-Polyethylene glycol (PEG) with 5'-Amidation (NH₂) and 3’-Inverted Thymidine (3'-idT) and 5'-Biotinylated or 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0757 | 27179422 | 2016 | Inhibition of the superantigenic activities of Staphylococcal enterotoxin A by an aptamer antagonist | S6 | ATACCAGCTTATTCAATT-GCCGCGGAATTGTGGCTTGGTGTCGTGGTCAGGGGCTGG-AGATAGTAAGTGCAATCT | 75 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and block superantigen activity of SEA. | N/A | 9 | Enzyme-Linked Aptamer Assay (ELAA) | N/A | Therapeutics/Immunmodulatory | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0758 | 27179422 | 2016 | Inhibition of the superantigenic activities of Staphylococcal enterotoxin A by an aptamer antagonist | S12 | ATACCAGCTTATTCAATT-GCCACTGTGGACTTGTTATTCGTCTTTGCCGTCTAATTCG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and block superantigen activity of SEA. | Inhibited PBMCs proliferation with an inhibition rate of 84%. | 9 | Enzyme-Linked Aptamer Assay (ELAA) | 79.35 ± 12.09 nM | Therapeutics/Immunmodulatory | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0759 | 27179422 | 2016 | Inhibition of the superantigenic activities of Staphylococcal enterotoxin A by an aptamer antagonist | S23 | ATACCAGCTTATTCAATT-GCAACAATGTTGTGTCAGCAAGTTGGTTGGCGGTGTATTG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and block superantigen activity of SEA. | N/A | 9 | Enzyme-Linked Aptamer Assay (ELAA) | N/A | Therapeutics/Immunmodulatory | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0760 | https:doi.org10.1016j.carbon.2016.04.014 | 2016 | Biodegradable graphene oxide and polyaptamer DNA hybrid hydrogels for implantable drug delivery | Polyaptamer (PA) | ATCGGCTAGCACGTACAGAACTAAAAAAAAAAAA-GTCGGCTTAGCCTCAACCCCC-AAGGCAAAAAGGCAT | 70 | N/A | ssDNA | Escherichia Coli (E. Coli) and Staphylococcus aureus (S. aureus) | Kanamycin (Kan) | Kan-loaded PA-GO (Kan/PA-GO) hybrid hydrogels for antibacterial effects. | Significantly reduced the viability of E. coli and S. aureus to 24.2 ± 4.8% and 17.7 ± 0.7%, respectively. | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 5'-Phosphate | N/A | N/A | N/A | N/A | N/A |
| ABdb_0784 | 27650576 | 2016 | G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA | PA#2/8 | ATACCAGCTTATTCAATT-AGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCT-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838, P6031) | Staphylococcus aureus Protein A (SpA) | Develop ELONA to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. | PA#2/8 and its truncated variant PA#2/8[S1-58] were able to differentiate between the highly Protein A-producing S. aureus Cowan strain. | N/A | Enzyme-Linked Oligonucleotide Assay (ELONA) | 101.4 ± 5.9 nM (of 3′-biotinylated) and 189.9 ± 13.0 nM (of 5′-biotinylated) | Detection | N/A | 5'-and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0785 | 27650576 | 2016 | G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA | PA#2/8[S1-58] | ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCT | 58 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838, P6031) | Staphylococcus aureus Protein A (SpA) | Develop ELONA to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. | PA#2/8 and its truncated variant PA#2/8[S1-58] were able to differentiate between the highly Protein A-producing S. aureus Cowan strain. | N/A | Enzyme-Linked Oligonucleotide Assay (ELONA) | 11.3 ± 1.4 nM (of 3′-biotinylated) and 23.7 ± 2.0 nM (of 5′-biotinylated) | Detection | N/A | 5'-and 3'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0786 | 27650576 | 2016 | G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA | PA#2/8[S1-50] | ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTC | 50 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838, P6031) | Staphylococcus aureus Protein A (SpA) | Develop ELONA to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. | N/A | N/A | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Detection | N/A | 5'-and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0787 | 27650576 | 2016 | G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA | PA#2/8[S1-43] | ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGG | 43 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838, P6031) | Staphylococcus aureus Protein A (SpA) | Develop ELONA to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. | N/A | N/A | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Detection | N/A | 5'-and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0788 | 27650576 | 2016 | G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA | PA#2/8[S28-50] | AGGGGGATAGAGGGGGTGGGTTC | 23 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838, P6031) | Staphylococcus aureus Protein A (SpA) | Develop ELONA to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. | N/A | N/A | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Detection | N/A | 5'-and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0796 | 27091327 | 2016 | Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography | HedC2 | TGCAGGATCCGGTATCCGTGGACGGTGTGCAGGATCCGGTATCCGTGGGCACGAGAATTCCTCCGTTGCG | 70 | 5'-TGCAGGATCCGGTATCCGTG-N40-CGCAACGGAGGAATTCTCGT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and detect SEB in infected serum samples. | LOD in the minimum quantity of 5 ng SEB per 100 µl of human serum. | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | 2.3 × 10(−11) M | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0797 | 27091327 | 2016 | Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography | HedC3 | TGCAGGATCCGGTATCCGTGCACACACACCCAACAACCAGCTGCCGCACCGGAGGAATTCTCGT | 64 | 5'-TGCAGGATCCGGTATCCGTG-N40-CGCAACGGAGGAATTCTCGT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and detect SEB in infected serum samples. | N/A | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0798 | 27091327 | 2016 | Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography | HedC7 | TGCAGGATCCGGTATCCGTGGGCGGGGCCATGCAGGATCCGGTATCCGTGGGCCGCAACGGAGGAATCTCGT | 72 | 5'-TGCAGGATCCGGTATCCGTG-N40-CGCAACGGAGGAATTCTCGT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and detect SEB in infected serum samples. | N/A | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0799 | 27091327 | 2016 | Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography | HedC8 | CCGTGGCCGCAACGGAGGAATTCTCGT | 27 | 5'-TGCAGGATCCGGTATCCGTG-N40-CGCAACGGAGGAATTCTCGT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and detect SEB in infected serum samples. | N/A | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0800 | 27091327 | 2016 | Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography | HedC9 | ACGAGAATTCCTCCGTTGCGGCACAGTTGGGCAGGAACCTGTGGGGCGTGCGCAACGGAGGAATTCTCGT | 70 | 5'-TGCAGGATCCGGTATCCGTG-N40-CGCAACGGAGGAATTCTCGT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and detect SEB in infected serum samples. | N/A | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0801 | 27091327 | 2016 | Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography | HedC10 | ACGAGAATTCCTCCGTTGCGGCCCACGGATACC | 33 | 5'-TGCAGGATCCGGTATCCGTG-N40-CGCAACGGAGGAATTCTCGT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and detect SEB in infected serum samples. | N/A | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0802 | 27091327 | 2016 | Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography | HedC11 | TGCAGGATCCGGTATCCGTGCGCAACGGAGGAATTCTCGT | 40 | 5'-TGCAGGATCCGGTATCCGTG-N40-CGCAACGGAGGAATTCTCGT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and detect SEB in infected serum samples. | N/A | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0803 | 27091327 | 2016 | Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography | HedC12 | ACGAGAATTCCTCCGTTGCGGCCCACGGATACAGGATCCTGCATGCCTGTCCACGGATACCGGATCCTCA | 70 | 5'-TGCAGGATCCGGTATCCGTG-N40-CGCAACGGAGGAATTCTCGT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and detect SEB in infected serum samples. | N/A | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0804 | 27091327 | 2016 | Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography | HedC17 | TGCAGGATCCGGTATCCGTGCCAAACACACCAAAAGCCCCCCCAACCCACAACCACGTCC | 60 | 5'-TGCAGGATCCGGTATCCGTG-N40-CGCAACGGAGGAATTCTCGT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and detect SEB in infected serum samples. | N/A | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0805 | 27318566 | 2016 | Staphylococcus aureus detection in blood samples by silica nanoparticle-oligonucleotides conjugates | Aptamer | GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT | 45 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Aptamer-functionalized silica magnetic nanoparticles-based assay for on-site determination of S. aureus. | Detects S. aureus cells as low as 682 CFU in whole blood, with a linear range from 800 CFU/ml blood to 104 CFU/ml blood. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0809 | 27411775 | 2016 | Rapid and Selective Detection of Pathogenic Bacteria in Bloodstream Infections with Aptamer-Based Recognition | Apt-S. aureus | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAACTTTTTTTTT | 71 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Aptamer-based capture platform using Fe3O4@mTiO2 magnetic nanoparticles for the detection of bacteria. | Display a favourable bacterial-capture efficiency of about 80% even at low infectious doses (10–2000 CFU/mL). | N/A | N/A | N/A | Detection | N/A | 3'-Amidation (NH₂-(CH2)7) and 3'-FAM Labeled ((CH2)7-FAM) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0812 | 26641108 | 2016 | Dual Recognition Strategy for Specific and Sensitive Detection of Bacteria Using Aptamer-Coated Magnetic Beads and Antibiotic-Capped Gold Nanoclusters | SA-aptamer | GCAATGGTACGGTACTTCC-TCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGT-CAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Aptamer-coated magnetic beads (Apt-MB) and Van-functionalized fluorescent gold nanoclusters (AuNCs@Van) were employed for specific capture of SA. | Sensitive quantification of SA in the range of 32–10(8) cfu/mL with the detection limit of 16 cfu/mL via fluorescence intensity. | N/A | N/A | N/A | Biosensor | N/A | 5′-Biotinylated and 5′-Cyanine3 (Cy3) and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0813 | 27427591 | 2016 | Duplex Identification of Staphylococcus aureus by Aptamer and Gold Nanoparticles | SA23 | GGGCTGGCCAGATCAGACCCCGGATGATCATCCTTGTGAGAACCA | 45 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | Develop an aptamer-AuNPs-based colorimetric method for duplex identification of S. aureus. | AuNPs as a sensor could well distinguish S. aureus from S. enteritidis and P. mirabilis. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0817 | 26971274 | 2016 | Dual-excitation upconverting nanoparticle and quantum dot aptasensor for multiplexed food pathogen detection | S. aureus aptamer | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Dual-excitation aptasensing platform based on the luminescent nanoparticles (QDs and UCNPs) for the detection of Salmonella typhimurium and Staphylococcus aureus. | Linear detection range: 50 to 10⁶ cfu/mL; LOD: 16 cfu/mL (S. aureus). | N/A | N/A | 35 nM | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0918 | 28119514 | 2017 | High Efficiency Binding Aptamers for a Wide Range of Bacterial Sepsis Agents | Antibac1 | TCGCGCGAGTCGTCTG-GGGACAGGGAGTGCGCTGCTCCCC-CCGCATCGTCCTCCC | 55 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922), Klebsiella Pneumoniae (ATCC 27853), Proteus Mirabilis (ATCC 00557), Pseudomonas Aeruginosa (ATCC 700603), Staphylococcus aureus (S. aureus) (ATCC 29213), Streptococcus Pneumoniae (ATCC 23855), and Enterococcus Faecium (ATCC 29212), and Proteus Vulgaris, Morganella Morganii, Citrobacter Freundii, and Acinetobacter Baumannii | Peptidoglycan | Develop generic probes as biological recognition elements in biosensors for sepsis diagnosis in the clinical setting. | Antibac1 bound with higher efficiency to both gram-positive (S. aureus, S. penumoniae, L. monocytogenes) and gram-negative (A. baumannii, C. freudii, K. pneumoniae, P. aeruginosa, P. mirabilis). | N/A | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 268.50 ± 54.34 nM (for A. baumannii); 51.74 ± 11.75 nM (for L. monocytogenes); 31.82 ± 4.38 nM (for E.coli); 170.10 ± 32.13 nM (for S.aureus) and 256.10 ± 47.89 nM (for K. pneumoniae) | Diagnostic | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0919 | 28119514 | 2017 | High Efficiency Binding Aptamers for a Wide Range of Bacterial Sepsis Agents | Antibac2 | TCGCGCGAGTCGTCTG-GGGGACTAGAGGACTTGTGCGGCC-CCGCATCGTCCTCCC | 55 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922), Klebsiella Pneumoniae (ATCC 27853), Proteus Mirabilis (ATCC 00557), Pseudomonas Aeruginosa (ATCC 700603), Staphylococcus aureus (S. aureus) (ATCC 29213), Streptococcus Pneumoniae (ATCC 23855), and Enterococcus Faecium (ATCC 29212), and Proteus Vulgaris, Morganella Morganii, Citrobacter Freundii, and Acinetobacter Baumannii | Peptidoglycan | Develop generic probes as biological recognition elements in biosensors for sepsis diagnosis in the clinical setting. | Antibac2 bound with higher efficiency to the gram-positive species S. aureus and E. faecium and to the gram-negative species (A. baumannii, C. freudii, K. pneumoniae, M. moraganii, P. aeruginosa, P. mirabilis, and E. coli). | N/A | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 71.92 ± 9.74 nM (for A. baumannii); 54.19 ± 12.09 nM (for L. monocytogenes); 62.43 ± 11.97 nM (for E.coli); 194.90 ± 38.55 nM (for S.aureus) and 195.90 ± 42.91 nM (for K. pneumoniae) | Diagnostic | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0953 | 29160851 | 2017 | Development of An Impedimetric Aptasensor for the Detection of Staphylococcus aureus | PA#2/8[S1-58] | ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCT | 58 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (DSM 20231) | Staphylococcus aureus Protein A (SpA) | Developed an impedimetric aptasensor for the detection of S. aureus. | Showed a limit of detection of 10 CFU/mL within 10 minutes. | N/A | Electrochemical impedance spectroscopy (EIS) | 18.5 ± 1.8 | Biosensor | N/A | 3'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0956 | 28803475 | 2017 | Intuitive Label-Free SERS Detection of Bacteria Using Aptamer-Based in Situ Silver Nanoparticles Synthesis | S.aureus-AptamerS | TCCCTACGGCGCTAACCTCCCAACCGCTCCACCCTGCCTCCGCCTCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CICC 21600) | Whole cell | Developed a SERS-based aptasensor using aptamer@AgNPs for the detection of bacteria. | Exhibited a linear concentration, ranging from 10(1) to 10(7) cfu/mL with the detection limit of 1.5 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0965 | 28287715 | 2017 | Dual-Recognition Förster Resonance Energy Transfer Based Platform for One-Step Sensitive Detection of Pathogenic Bacteria Using Fluorescent Vancomycin-Gold Nanoclusters and Aptamer-Gold Nanoparticles | Aptamer | GCAATGGTACGGTACTTCC-TCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGT-CAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Bacterial cell wall | Develop a dual-molecular FRET platform based on the recognition of bacterial cell walls by antibiotic and aptamer molecules, respectively, for the detection of pathogenic bacteria. | Shows a linear concentration of Staph. aureus in the range from 20 to 10(8) cfu/mL with a detection limit of 10 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated and Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0974 | 27951452 | 2017 | (1→3)-β-D-glucan aptamers labeled with technetium-99m: Biodistribution and imaging in experimental models of bacterial and fungal infection | Seq6 | CGACTGACGCCTCCAAGCCACACGTGTGAGAAGGGTGTTATCATGTATTTCGTGTTCCTTTCGTCATTCCTTTGTCTGCATGCATCGCTACGTG | 94 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | (1 → 3)-β-D-glucans | Radiolabeled aptamers were evaluated to identify infectious foci caused by bacterial cells. | The target/non-target ratios were 3.17 ± 0.22 for seq6 in S. aureus-infected animals. | N/A | N/A | 0.303 ± 0.067 μM | Imaging | N/A | 5'-Radiolabelled (99mTc labeled) | N/A | In vitro stability of seq6 aptamer labelled with 99mTc in the presence of 0.9% saline, plasma, and cysteine excess (molar ratio) was above 84.2 ± 2.9% in all cases at 24hrs. | N/A | N/A | N/A |
| ABdb_0975 | 28715874 | 2017 | Detection of bacterial infection by a technetium-99m-labeled peptidoglycan aptamer | Antibac1 | TCGCGCGAGTCGTCTGGGGACAGGGAGTGCGCTGCTCCCCCCGCACGTCCTCCC | 54 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Peptidoglycan | Radiolabeled aptamers were evaluated for biodistribution studies and scintigraphic imaging in infection‐bearing mice. | Achieved a high target-to-non-target (T/NT) ratio of 4.7 ± 0.9 at 1.5 h and 4.6 ± 0.1 at 3.0 h in bacterial-infected models. | N/A | Binding Assay | 0.170 ± 0.032 μM | Imaging | N/A | 5'-Inverted Thymidine (5'-idT), 3'-Amidation (NH₂-(CH2)6) and 5'-Radiolabelled (99mTc labeled) | N/A | Radiolabeling yields were superior to 90% and 99mTc‐Antibac1 was highly stable in the presence of saline, plasma, and cysteine up to 6 h. | N/A | Distribution half-life: 6.7 min and Elimination half-life: 41.3 min. | N/A |
| ABdb_0980 | 28691795 | 2017 | Copper-Based Metal-Organic Framework Nanoparticles with Peroxidase-Like Activity for Sensitive Colorimetric Detection of Staphylococcus aureus | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | A colorimetric method for the detection of S. aureus was developed using aptamer-modified Cu-MOF nanoparticles. | The linear range for S. aureus detection is 50-10,000 CFU/mL, with a detection limit of 20 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0981 | 28159108 | 2017 | An enhanced chemiluminescence resonance energy transfer aptasensor based on rolling circle amplification and WS2 nanosheet for Staphylococcus aureus detection | Aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | A chemiluminescence resonance energy transfer aptasensor was developed for the detection of S. aureus with Co2+ enhanced N-(aminobutyl)-N-(ethylisoluminol) (ABEI) functional flowerlike gold nanoparticles (Co2+/ABEI-AuNFs) and WS2 nanosheet. | The CL signal was found to be linear within the range of 50 cfu/mL to 1.5 × 10(5) cfu/mL, and the limit of detection was 15 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1012 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB10 | TAGCTCACTCATTAGGCAC-TCGAGAGGGATCTCGGGGCGTGCGATGATTTTGCCTTCAT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | A dual-labelled sandwich detection system was developed using biotinylated RAB10 and FITC-labelled RAB35, with a limit of detection (LOD) of 10^2 CFU/mL of S. aureus, and showed 2.7-fold more signal than other bacteria. | 10 | Flow Cytometry | 46 ± 24 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1013 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB20 | TAGCTCACTCATTAGGCAC-GCGTTACGTTAGTGGCCGCCTATGAGGACAGGCGGTTGTA-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | N/A | 10 | Flow Cytometry | 128 ± 45 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1014 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB28 | TAGCTCACTCATTAGGCAC-TGGACGTCGTGGCGGAGGTTTTATAAAACGGCGCCACTGT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | N/A | 10 | Flow Cytometry | 49 ± 39 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1015 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB35 | TAGCTCACTCATTAGGCAC-GGGGGGTTGTGCCATTTAAGATGACCGGTTGCCGCGATTT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | A dual-labelled sandwich detection system was developed using biotinylated RAB10 and FITC-labelled RAB35, with a limit of detection (LOD) of 10^2 CFU/mL of S. aureus, and showed 2.7-fold more signal than other bacteria. | 10 | Flow Cytometry | 34 ± 5 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1016 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB1 | TAGCTCACTCATTAGGCAC-CGGGTGGGCTCCAATATGAATCGCTTGCCCTGACGCTATCT-GCATAGTTAAGCCAGCC | 77 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | N/A | 10 | Flow Cytometry | 56 ± 87 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1017 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB3 | TAGCTCACTCATTAGGCAC-CGTAGTCTAGTGTCGATTAGTTTCCTTGAGACCTTGTGCT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | N/A | 10 | Flow Cytometry | 37 ± 112 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1018 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB5 | TAGCTCACTCATTAGGCAC-CGTAGTCTAGTGTCGATTAGTTTCCTTGCTATTGCAGACCTTGTGCT-GCATAGTTAAGCCAGCC | 83 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | N/A | 10 | Flow Cytometry | 58 ± 14 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1019 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB9 | TAGCTCACTCATTAGGCAC-TCGAGAGGGATCTCGGGGCGTGCGATGATTTTGCCTTCAT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1020 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB21 | TAGCTCACTCATTAGGCAC-GGGGGGTTGTGCCATTTAAGATGACCGGTTGCCAAGATG-GCATAGTTAAGCCAGCC | 75 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1080 | https://doi.org/10.1002/slct.201801008 | 2018 | Exploiting Stokes and anti-Stokes type emission profiles of aptamer-functionalized luminescent nanoprobes for multiplex sensing applications | S. aureus aptamer | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTCCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Aptamer-functionalized QD and UCNP nanoprobes conjugated with partially complementary DNA-modified magnetic beads for separation of different bacteria. | The limit of detection was 15 cfu/mL for S. aureus with a linear range from 10(2)-10(6) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1084 | 29729642 | 2018 | Design and fabrication of an electrochemical aptasensor using Au nanoparticles/carbon nanoparticles/cellulose nanofibers nanocomposite for rapid and sensitive detection of Staphylococcus aureus | Staphylococcus aureus aptamer | TCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTC | 46 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed an impedimetric aptasensor using AuNPs/CNPs/CNFs nanocomposites for the rapid detection of S. aureus. | Exhibited a wide linear dynamic range 1.2 × 10(1) to 1.2 × 10(8) CFU/mL with a LOD of 1 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1150 | 29550346 | 2018 | An aptasensor for staphylococcus aureus based on nicking enzyme amplification reaction and rolling circle amplification | Aptamer | TCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGT | 45 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | A chemiluminescence aptasensor for S. aureus detection based on aptamer recognition and the DNA amplification cycle (NEAR-RCA) was developed. | Detect S. aureus specifically with a good linear correlation at 5-10(4) CFU/mL and limit of detection (LoD) of 5 CFU/mL. | N/A | N/A | 210.70 ± 135.91 nM | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1180 | 32254837 | 2018 | Sensitive and specific detection of clinical bacteria via vancomycin-modified Fe3O4@Au nanoparticles and aptamer-functionalized SERS tags | Sa1 | GCAATGGTACGGTACTTCCACTTAGGTCGAGGTTAGTTTGTCTTGCTGGCGCATCCACTGAGCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Develop a dual-recognition SERS platform using vancomycin-modified Fe3O4@Au magnetic nanoparticles (Fe3O4@Au-Van MNPs) for the detection of E. coli and S. aureus. | The LOD of the platform was 20 cells/mL for S. aureus, with a capture efficiency of up to 88.89% within 15 min. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1183 | 30236483 | 2018 | Staggered Target SELEX, a novel approach to isolate non-cross-reactive aptamer for detection of SEA by apta-qPCR | C5 | CCTAACCGATATCACACTCAC-GGCTAGCGGACAGGTGTAGGTCGGAATCCTTCAGCGTAGA-GTTGGTCGTCATTGGAGTATC | 82 | 5'-CCTAACCGATATCACACTCAC-40N-GTTGGTCGTCATTGGAGTATC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers by ST-SELEX and use them for the detection of SEA via apta-Real-time PCR (apta-qPCR). | The limit of detection (LOD) was 146.67 fM. | 10 | Surface Plasmon Resonance (SPR) | 7.44 ± 0.6 nM | Detection | Staggered Target SELEX (ST-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1184 | 30236483 | 2018 | Staggered Target SELEX, a novel approach to isolate non-cross-reactive aptamer for detection of SEA by apta-qPCR | C7 | CCTAACCGATATCACACTCAC-AGTATACCGCTCCACCAGTGTGATATCGGGATCTGCTGAC-GTTGGTCGTCATTGGAGTATC | 82 | 5'-CCTAACCGATATCACACTCAC-40N-GTTGGTCGTCATTGGAGTATC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers by ST-SELEX and use them for the detection of SEA via apta-Real-time PCR (apta-qPCR). | The limit of detection (LOD) was 146.67 fM. | 10 | Surface Plasmon Resonance (SPR) | 7.44 ± 0.6 nM | Detection | Staggered Target SELEX (ST-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1185 | 30236483 | 2018 | Staggered Target SELEX, a novel approach to isolate non-cross-reactive aptamer for detection of SEA by apta-qPCR | C10 | CCTAACCGATATCACACTCAC-GTAGTGAGGTGGGTCGTGAAGGGAGGCACTACTGGTGCGT-GTTGGTCGTCATTGGAGTATC | 82 | 5'-CCTAACCGATATCACACTCAC-40N-GTTGGTCGTCATTGGAGTATC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers by ST-SELEX and use them for the detection of SEA via apta-Real-time PCR (apta-qPCR). | The limit of detection (LOD) was 146.67 fM. | 10 | Surface Plasmon Resonance (SPR) | 7.44 ± 0.6 nM | Detection | Staggered Target SELEX (ST-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1186 | 30236483 | 2018 | Staggered Target SELEX, a novel approach to isolate non-cross-reactive aptamer for detection of SEA by apta-qPCR | C13 | CCTAACCGATATCACACTCAC-GAGGTGAGGGTGCGAGGGTAAGGGGGCAAACCTGGTGCGT-GTTGGTCGTCATTGGAGTATC | 82 | 5'-CCTAACCGATATCACACTCAC-40N-GTTGGTCGTCATTGGAGTATC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers by ST-SELEX and use them for the detection of SEA via apta-Real-time PCR (apta-qPCR). | The limit of detection (LOD) was 146.67 fM. | 10 | Surface Plasmon Resonance (SPR) | 7.44 ± 0.6 nM | Detection | Staggered Target SELEX (ST-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1187 | 30236483 | 2018 | Staggered Target SELEX, a novel approach to isolate non-cross-reactive aptamer for detection of SEA by apta-qPCR | C16 | CCTAACCGATATCACACTCAC-ACGTAGTGAGGGTTGCGAGGGTAAGGTGGTCAGTATACGC-GTTGGTCGTCATTGGAGTATC | 82 | 5'-CCTAACCGATATCACACTCAC-40N-GTTGGTCGTCATTGGAGTATC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers by ST-SELEX and use them for the detection of SEA via apta-Real-time PCR (apta-qPCR). | The limit of detection (LOD) was 146.67 fM. | 10 | Surface Plasmon Resonance (SPR) | 7.44 ± 0.6 nM | Detection | Staggered Target SELEX (ST-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1200 | 29533818 | 2018 | Culture-free, highly sensitive, quantitative detection of bacteria from minimally processed samples using fluorescence imaging by smartphone | S. aureus–specific aptamer (Sap) | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (USA300) | Surface protein | Developed a smartphone-based detection using aptamer-functionalized fluorescent magnetic nanoparticles (FMNPs) for Staphylococcus aureus. | Showed a minimum detectable concentration as low as 10 cfu/ml in a peanut milk sample within 10 min. | N/A | N/A | 3.03 nM | Biosensor | N/A | 5'-COOH (Carboxylated) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1231 | 31472413 | 2019 | Vertical capacitance aptasensors for real-time monitoring of bacterial growth and antibiotic susceptibility in blood | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Vertical-type aptamer-functionalized sensor (aptasensor) for monitoring bacterial growth and antibiotic susceptibility in blood in real-time. | Detect bacteria growth in blood at 10(0)-10(3) CFU/mL in real-time within 12 hours and the MIC for P. aeruginosa was approximately 1 μg/mL for both gentamicin and amikacin. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1257 | 31307721 | 2019 | Dual-recognition surface-enhanced Raman scattering(SERS)biosensor for pathogenic bacteria detection by using vancomycin-SERS tags and aptamer-Fe3O4@Au | S. aureus-aptamer | GCAATGGTACGGTACTTCCACTTAGGTCGAGGTTAGTTTGTCTTGCTGGCGCATCCACTGAGCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed a dual-recognition SERS biosensor using Vancomycin-Au@MBA and aptamer-Fe3O4@Au for the detection of pathogenic bacteria. | A detection limit of 3 cells/mL with a wide dynamic linear range from 10 to 10(7) cells/mL can be achieved within 50 min. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1278 | 31380872 | 2019 | A transcription aptasensor: amplified, label-free and culture-independent detection of foodborne pathogens via light-up RNA aptamers | SA31 | TCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGA | 45 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Develop a transcription aptasensor by using a light-up RNA aptamer for culture-free detection of intact foodborne pathogens. | The dynamic range was 10(2)-10(6) CFU/mL, and the LOD of the transcription aptasensor was estimated to be 77.0 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1279 | 31617347 | 2019 | Ultrasensitive Fluorometric Angling Determination of Staphylococcus aureus in Vitro and Fluorescence Imaging in Vivo Using Carbon Dots with Full-Color Emission | S. aureus aptamer (Apt) | GCAATGGTACGGTACTTCC-TCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGT-CAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | An ultrasensitive magnetic fluorescence aptasensor was designed using Fe3O4/CD for the separation and detection of S. aureus. | The FRET-based aptasensor achieved a wide linear range of 50–10(7) CFU/mL and a detection limit of 8 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1332 | 31080198 | 2019 | Polyadenine-mediated Immobilization of Aptamers on a Gold Substrate for the Direct Detection of Bacterial Pathogens | 10A-S1 | AAAAAAAAAA-TTTTT-TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 77 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed a SPR-based aptasenor using polyadenine-mediated immobilization of aptamers on a gold substrate for the detection of E. coli or S. aureus. | The detection limit of the current SPR aptasensors is 1 x 10(6) CFU/mL for S. aureus. | N/A | N/A | N/A | Biosensor | N/A | 5'-PolyA (10A) and Five thymine (5T) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1333 | 31080198 | 2019 | Polyadenine-mediated Immobilization of Aptamers on a Gold Substrate for the Direct Detection of Bacterial Pathogens | 10A-S2 | AAAAAAAAAA-TTTTT-GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 103 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed a SPR-based aptasenor using polyadenine-mediated immobilization of aptamers on a gold substrate for the detection of E. coli or S. aureus. | N/A | N/A | N/A | N/A | Biosensor | N/A | 5'-PolyA (10A) and Five thymine (5T) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1336 | 31080198 | 2019 | Polyadenine-mediated Immobilization of Aptamers on a Gold Substrate for the Direct Detection of Bacterial Pathogens | 30A-S1 | AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-TTTTT-TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 97 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed a SPR-based aptasenor using polyadenine-mediated immobilization of aptamers on a gold substrate for the detection of E. coli or S. aureus. | N/A | N/A | N/A | N/A | Biosensor | N/A | 5'-PolyA (30A) and Five thymine (5T) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1337 | 31080198 | 2019 | Polyadenine-mediated Immobilization of Aptamers on a Gold Substrate for the Direct Detection of Bacterial Pathogens | 30A-S2 | AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-TTTTT-GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 123 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed a SPR-based aptasenor using polyadenine-mediated immobilization of aptamers on a gold substrate for the detection of E. coli or S. aureus. | N/A | N/A | N/A | N/A | Biosensor | N/A | 5'-PolyA (30A) and Five thymine (5T) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1338 | 30622036 | 2019 | An electrochemical aptasensor for staphylococcal enterotoxin B detection based on reduced graphene oxide and gold nano-urchins | Aptamer SEB | TGCAGGATCCGGTATCCGTGCACACACACCCAACAACCAGCTGCCGCACCGGAGGAATTCTCGT | 64 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | An electrochemical aptasensor was developed using a screen-printed electrode modified with reduced graphene oxide (rGO) and gold nano-urchins (AuNUs) for the detection of SEB. | A wide linear range of 5.0–500.0 fM was observed, with a detection limit of 0.21 fM. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1347 | 31196418 | 2019 | Functional chimera aptamer and molecular beacon based fluorescent detection of Staphylococcus aureus with strand displacement-target recycling amplification | Aptamer | CACACCGCAGCAGTGGGAACGTTTCAGCCATGCAAGCATCACGCCCGT | 48 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed a fluorescent detection of S. aureus based on a functional chimaera and a molecular beacon. | Display a broad concentration range from 80 CFU/mL to 8 × 10(6) CFU/mL and the detection limit of 39 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1350 | 32333113 | 2020 | Inhibitory effects of aptamer targeted teicoplanin encapsulated PLGA nanoparticles for Staphylococcus aureus strains | SA20 | GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT | 45 | N/A | ssDNA | Staphylococcus aureus (S. aureus) susceptible strains and MRSA | Whole cell | Aptamer-PLGA nanoparticles (Apt-teicoplanin-PLGA NPs) for the delivery of teicoplanin antibiotic. | MICs of teicoplanin decreased by 32- and 64-fold for susceptible strains and MRSA strains, respectively. | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1373 | 32792573 | 2020 | Electrical antimicrobial susceptibility testing based on aptamer-functionalized capacitance sensor array for clinical isolates | Aptamer 5 | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (P101, T82, C970, R4308, R4319) | Whole cell | Electrical AST (e-AST) chips composed of 60 aptamer-functionalized capacitance sensors to detect bacteria and measure the antibiotic susceptibility to 11 antibiotics at five different concentrations. | The discrepancies between e-AST and BMD tests were estimated to be 2.20% mE, 0.38% ME, and 0.38%, which are lower than the FDA requirements (mE ≤ 10%, ME ≤ 3%, and VME ≤ 1.5%). | N/A | N/A | N/A | Diagnostic | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1410 | https://doi.org/10.1007/s12161-020-01821-4 | 2020 | Fluorescent Turn-on Aptasensor of Staphylococcus aureus Based on the FRET Between Green Carbon Quantum Dot and Gold Nanoparticle | Staphylococcus aureus aptamer | GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT | 45 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed FRET-based aptasensor with CQDs and GNPs for the detection of S. aureus. | Linear detection range of 10⁸ to 10¹ CFU/mL with a detection limit (LOD) of 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1436 | 32350613 | 2020 | A fluorescent aptasensor for Staphylococcus aureus based on strand displacement amplification and self-assembled DNA hexagonal structure | Aptamer | CACACCGCAGCAGTGGGAACGTTTCAGCCATGCAAGCATCACGCCCGT | 48 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | A fluorescent aptasensor based on MB-apt-cDNA duplex for S. aureus in milk samples. | Exhibits a broad linear range from 7 to 7 × 10(7) CFU/mL, with a detection limit of 1.7 CFU/mL for S. aureus. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1488 | 32347530 | 2020 | A sensitive and rapid bacterial antibiotic susceptibility test method by surface enhanced Raman spectroscopy | S. aureus aptamer | TCCCTACGGCGCTAACCTCCCAACCGCTCCACCCTGCCTCCGCCTCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CICC 21600) | Whole cell | Developed a rapid antibiotic susceptibility test (AST) method and determined the MIC value by the Bacteria-aptamer@AgNPs-SERS method. | When treated with 2(−1) μg/mL vancomycin for 1 h, the Raman peak intensity of S. aureus was 556 a.u., and when the concentration of antibiotics was sub-MIC (2(−2) and 2(−3) μg/mL), the peak value of 735 cm−1 increased, and the Raman intensity was 2177 a.u. and 2903 a.u. | N/A | N/A | N/A | Detection | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1503 | 34347427 | 2021 | Aptamer-Functionalized DNA-Silver Nanocluster Nanofilm for Visual Detection and Elimination of Bacteria | Apt-G | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAACGGGTGGGGTGGGGTGGGG | 80 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | DNA-templated silver nanoclusters (N4-AgNC/Apt-G) for the visual detection and effective elimination of bacteria. | After treatment with 5 μM N4-AgNCs/Apt-G, a significantly reduced number of colonies was observed. At the lowest inhibitory concentration of 6.25 μM, the number of colonies decreased by only 4-fold, which is significantly less than the 7-fold reduction observed at 5 μM. Obtained recovery rates ranging from 88% to 115% of S. aureus. | N/A | N/A | N/A | Diagnostic/Therapeutics | N/A | N/A | N4-AgNCs/Apt-G was found to be nontoxic at low concentrations, and cell viability was more than 80% at a concentration of 6.25 μM. | N/A | N/A | N/A | N/A |
| ABdb_1544 | 34051601 | 2021 | Sensitive detection of S. Aureus using aptamer- and vancomycin -copper nanoclusters as dual recognition strategy | Aptamer | GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT | 45 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed an aptamer- and antibiotic-based dual detection sensor, combines copper nanoclusters (CuNCs) for the detection of S. aureus. | Showed a linear range of 10(2)-10(8) CFU/mL, and a detection limit of 80 CFU/mL after 45 min. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1545 | https://doi.org/10.1016/j.electacta.2021.139633 | 2021 | A new electrochemical aptasensor based on gold/nitrogen-doped carbon nano-onions for the detection of Staphylococcus aureus | Anti-S. aureus aptamer | TCGGCACGTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTC | 43 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed an electrochemical aptasensor based on SPEs modified with AuNPs and NCNOs for the detection of S. aureus. | Measured S. aureus quickly with a limit of detection of 3 CFU/mL in the linear range of 10–10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1586 | 34074432 | 2021 | One-step colorimetric detection of Staphylococcus aureus based on target-induced shielding against the peroxidase mimicking activity of aptamer-functionalized gold-coated iron oxide nanocomposites | Aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | Developed a colorimetric sensor using apt-Fe3O4/Au nanocomposites for the detection of Staphylococcus aureus. | Display a linear range from 10 to 10(6) CFU/mL, with the visible limit of detection as low as 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1588 | 34753577 | 2021 | An efficient SERS platform for the ultrasensitive detection of Staphylococcus aureus and Listeria monocytogenes via wheat germ agglutinin-modified magnetic SERS substrate and streptavidin/aptamer co-functionalized SERS tags | S. aureus-aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed an aptasensor using WGA modified-Fe3O4@Au MNPs and Streptavidin (SA)/aptamer co-functionalized SERS tags for S. aureus and L. mono detection. | The LOD for S. aureus was 3 cells/mL and a favorable linear relation (10-10(7) cells/mL). | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1594 | 34041580 | 2021 | Fabrication of gold/silver nanodimer SERS probes for the simultaneous detection of Salmonella typhimurium and Staphylococcus aureus | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed an aptamer-facilitated gold/silver nanodimer SERS probe for the simultaneous detection of the two bacteria with the help of magnetic separation enrichment. | Achieved a linear range of 3.2 × 10(2) to 3.2 × 10(7) cfu/mL, with a detection limit of 96 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5′-SH-A-Rox and 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1596 | 34406747 | 2021 | Upconversion Nanoprobes Based on a Horseradish Peroxidase-Regulated Dual-Mode Strategy for the Ultrasensitive Detection of Staphylococcus aureus in Meat | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed a colorimetric and fluorescent dual-mode nanoprobe using apt-MNPs and HRP-UCNPs-cDNA for the detection of S. aureus. | Obtained limits of detection of 22 CFU/mL for fluorescence and 20 CFU/mL for colorimetry in a linear range of 56–5.6 × 10(6) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1611 | 35573794 | 2022 | Aptamer-Targeted Drug Delivery for Staphylococcus aureus Biofilm | SA31 | GCAATGGTACGGTACTTCC-TCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGA-CAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (DSM 20231) | Whole cell | Aptamer-targeted liposomes encapsulating antibiotics for accumulation and delivery to eradicate S. aureus biofilm. | SA31-modified liposomes fully eradicated all viable, culturable bacteria in all biofilm samples. | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 3'-5-propargylamino-ddUTP-Cy5 or 3'-N3 modified | N/A | SA23 appeared more stable than the other aptamers in plasma over a 16-hour incubation period. | N/A | N/A | N/A |
| ABdb_1639 | https:doi.org10.1016j.arabjc.2022.104274 | 2022 | Application of G-quadruplex aptamer conjugated MSNs to deliver ampicillin for suppressing S. aureus biofilm on mice bone | PA76 | 3’-ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCTACAATCGTAATCAGTTAG-5’ | 76 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | MSNs-APT-AMP nanosystem for antibiofilm activity against S. aureus biofilm. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1640 | https:doi.org10.1016j.arabjc.2022.104274 | 2022 | Application of G-quadruplex aptamer conjugated MSNs to deliver ampicillin for suppressing S. aureus biofilm on mice bone | PA63 | 3’-ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCTACAAT-5’ | 63 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | MSNs-APT-AMP nanosystem for antibiofilm activity against S. aureus biofilm. | No significant biofilm on the surface of the bone after 48 h treatment with 100 µg/mL of the three-component system. | N/A | N/A | N/A | Therapeutics | N/A | N/A | No significant toxicity at 100 µg/mL for MCF-7 cells in 48 h. | N/A | Best Candidate | N/A | N/A |
| ABdb_1641 | https:doi.org10.1016j.snb.2022.132752 | 2022 | Novel nanozyme-catalyzed and magnetically assisted colorimetric biosensor for Staphylococcus aureus detection with a low matrix effect from complex environments | SA31 | GCAATGGTACGGTACTTCCTCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGACAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Staphylococcus aureus Protein A (SpA) | Vancomycin-modified magnetic nanoparticles (Fe3O4 @Au-Van MNPs) combined with an aptamer were prepared for S. aureus detection. | The biosensor can distinguish more than 100 CFU/mL of pathogens by the naked eye and LOD of 2 CFU/mL for S. aureus. | N/A | N/A | N/A | Biosensor | N/A | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1650 | 35869107 | 2022 | An innovative dual recognition aptasensor for specific detection of Staphylococcus aureus based on Au/Fe3O4 binary hybrid | Apt | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 6538) | Whole cell | Developed an imprinted aptasensor (apt-AuNPs@ Fe3O4) for the quantification of S. aureus. | Exhibited a wide linear range of 10(1)-10(7) CFU/mL with a Limit of Detection (LOD ) of 1 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | The aptasensor retained approximately 95% of its original activity for four weeks. | N/A | N/A | N/A |
| ABdb_1651 | 35829778 | 2022 | An ultrasensitive sandwich-type electrochemical aptasensor using silver nanoparticle/titanium carbide nanocomposites for the determination of Staphylococcus aureus in milk | Apts | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CICC 23656) | Whole cell | Developed a novel sandwich-type electrochemical aptasensor using AgNPs@Ti3C2 nanocomposites for the detection of S. aureus. | Showed a low detection limit (LOD) of 1 CFU/mL and a linear range of 52–5.2 × 10(7) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | 92.68% of the initial current of the aptasensor was reserved when stored for 15 days at 4°C. | N/A | N/A | N/A |
| ABdb_1652 | 35870283 | 2022 | An ultrasensitive and dual-recognition SERS biosensor based on Fe3O4@Au-Teicoplanin and aptamer functionalized Au@Ag nanoparticles for detection of Staphylococcus aureus | S. aureus Apt | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | The SERS biosensor based on Fe3O4@Au-Tcp NPs as a capture probe and Au@Ag-DTNB-Apt NPs as a signal probe for the detection of S. aureus. | Showed detection limit of 1.09 CFU/mL with a broad dynamic linear range of 7.6 × 10(1)-7.6 × 10(7) CFU/mL within 50 min. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1658 | https://doi.org/10.48022/mbl.2206.06001 | 2022 | Antibiofilm Activity and Binding Specificity of Polyclonal DNA Aptamers on Staphylococcus aureus and Escherichia coli | S15K3 | CCGGAATTCCTAATACGACTCCCAGCAGCAAGGTGCGGTACCCGGGGATGCGGGCTTGCTGTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 and Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Determine the antibiofilm activity and binding specificity of the polyclonal DNA aptamers on S. aureus BPA-12 and E. coli EPEC 4. | Showed the percentage of antibiofilm activity against S. aureus BPA-12 (25.8%) and E. coli EPEC 4 (0.3%). | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1659 | https://doi.org/10.48022/mbl.2206.06001 | 2022 | Antibiofilm Activity and Binding Specificity of Polyclonal DNA Aptamers on Staphylococcus aureus and Escherichia coli | S15K4 | CCGGAATTCCTAATACGACTCCCCGGGCCCACAGGGTACGCGTCTGCGGCTGGCCGGTCCCTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 and Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Inhibition of biofilm formation by folding into unique three-dimensional structures and attaching to a specific target. | Showed the percentage of antibiofilm activity against S. aureus BPA-12 (26.3%) and E. coli EPEC 4 (2.8%). | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1660 | https://doi.org/10.48022/mbl.2206.06001 | 2022 | Antibiofilm Activity and Binding Specificity of Polyclonal DNA Aptamers on Staphylococcus aureus and Escherichia coli | S15K6 | CCGGAATTCCTAATACGACTCGCGGGACGGGGAGTGCGCTGGGCATGTGGGCGCCGGGGGATATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 and Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Inhibition of biofilm formation by folding into unique three-dimensional structures and attaching to a specific target. | Showed the highest percentage of antibiofilm activity against S. aureus BPA-12 (37.4%). | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1661 | https://doi.org/10.48022/mbl.2206.06001 | 2022 | Antibiofilm Activity and Binding Specificity of Polyclonal DNA Aptamers on Staphylococcus aureus and Escherichia coli | S15K13 | CCGGAATTCCTAATACGACTCCACGCGCAGGCAGCCACCGACCAGGTGCTCGTATGGTTGGTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 and Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Inhibition of biofilm formation by folding into unique three-dimensional structures and attaching to a specific target. | Showed the percentage of antibiofilm activity against S. aureus BPA-12 (31.8%) and E. coli EPEC 4 (9.4%). | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1662 | https://doi.org/10.48022/mbl.2206.06001 | 2022 | Antibiofilm Activity and Binding Specificity of Polyclonal DNA Aptamers on Staphylococcus aureus and Escherichia coli | S15K15 | CCGGAATTCCTAATACGACTCCAGGACAGTACTCTGGACGGCAATACGTATATACGTACGGTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 and Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Inhibition of biofilm formation by folding into unique three-dimensional structures and attaching to a specific target. | Showed the percentage of antibiofilm activity against S. aureus BPA-12 (19.1%) and E. coli EPEC 4 (-1.3%). | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1663 | https://doi.org/10.48022/mbl.2206.06001 | 2022 | Antibiofilm Activity and Binding Specificity of Polyclonal DNA Aptamers on Staphylococcus aureus and Escherichia coli | S15K20 | CCGGAATTCCTAATACGACTCCCGGCGCCACGACATGGGCGCTGCCGGTGTGGTCGCGGGATATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 and Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Inhibition of biofilm formation by folding into unique three-dimensional structures and attaching to a specific target. | Showed the highest percentage of antibiofilm activity against E. coli EPEC 4 (15.4%). | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1679 | 35031253 | 2022 | Architecting of an aptasensor for the staphylococcus aureus analysis by modification of the screen-printed carbon electrode with aptamer/Ag-Cs-Gr QDs/NTiO2 | Aptamer | TCGGCACGTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTC | 43 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | An electrochemical aptasensor employing Apt/Ag–Cs-Gr QDs/NTiO2/SPCE was developed for the detection of S. aureus. | Limit of Detection (LOD) of 3.3 CFU/mL and dynamic range of 10–5 × 10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | Compared with the initial current response, the aptsensor response changed less than 10% after 100 cycles’ continuous CV scans. | N/A | N/A | N/A |
| ABdb_1680 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K3 | CCGGAATTCCTAATACGACTC-CCAGCAGCAAGGTGCGGTACCCGGGGATGCGGGCTTGCTG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 36,70 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1681 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K4 | CCGGAATTCCTAATACGACTC-CCCGGGCCCACAGGGTACGCGTCTGCGGCTGGCCGGTCCC-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1682 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K6 | CCGGAATTCCTAATACGACTC-GCGGGACGGGGAGTGCGCTGGGCATGTGGGCGCCGGGGGA-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | S15K6 has the highest binding affinity to S. aureus BPA-12. | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 17,01 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1683 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K13 | CCGGAATTCCTAATACGACTC-CACGCGCAGGCAGCCACCGACCAGGTGCTCGTATGGTTGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 60,69 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1684 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K15 | CCGGAATTCCTAATACGACTC-CAGGACAGTACTCTGGACGGCAATACGTATATACGTACGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 20,90 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1685 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K20 | CCGGAATTCCTAATACGACTC-CCGGCGCCACGACATGGGCGCTGCCGGTGTGGTCGCGGGA-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1718 | 36058939 | 2022 | Multiple amplification-based fluorometric aptasensor for highly sensitive detection of Staphylococcus aureus | Aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | Developed a fluorometric aptasensor for the detection of S. aureus using magnetic nanoparticles (MNPs). | The proposed fluorometric aptasensor displays LOD of (1.23 cfu/mL, a wide linear range (1 ~ 10(8) cfu/mL), and a fast detection speed (~ 1.5 h). | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (Biotin-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1725 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA37 (SA-10R-37) | GCTTCCAGCTTATTGAAT-AAAGACGGGGGGGGGGACCGGCGTATGAGTGAAGATGGGG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | Achieved a limit of detection (LOD) of 39 CFUs and 414 CFUs in buffer and spiked tap water samples, respectively, with the cognate pair of SA37@Cy5 and SA81@FAM. | 10 | Flow Cytometry | 16.5 ± 3.41 nM | Biosensor | Whole Cell-SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1726 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA81 (SA-10R-81) | GCTTCCAGCTATTGAA-AACGAGGCGCAGGGGGAGGGGGTGGTACAGATAAGATGGGG-GCGCTGAAGCGCGGAAGC | 75 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | Achieved a limit of detection (LOD) of 39 CFUs and 414 CFUs in buffer and spiked tap water samples, respectively, with the cognate pair of SA37@Cy5 and SA81@FAM. | 10 | Flow Cytometry | 14.47 ± 8.18 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1727 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA25 (SA-9R-25) | GCTTCCAGCTTATTGAAT-GGGGAAGGTCGTCCGACGAACCCGGTCAGATAGGGTGGGG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | 44.92 ± 1.36 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1728 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA28 (SA-10R-28) | GCTTCCAGCTTATTGAAT-GCGGCCACGGAGGGGGTGCCGGGCGTGGAATAAGATGTGG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | 77 ± 1.22 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1729 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA35 (SA-10R-35) | GCTTCCAGCTTATTGAAT-CACAGGTGTGGGGAGGTCCCCATGGAGGTGGTTCAATG-GCGCTGAAGCGCGGAAGC | 74 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | 58.77 ± 0.73 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1730 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA40 (SA-10R-40) | GCTTCCAGCTTATTGAAT-CGACGTGAAGCAATCATGGGTGGGGTACGTCGGGTCATGG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | 126.95 ± 0.51 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1731 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA-9R-12 | GCTTCCAGCTTTATGAAT-TGGGCGTGGCGACGGTGTCAGGTCGGGGCGGTAAGACGAGG-GCGCTGAAGCGCGGAAGC | 77 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1732 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA-9R-57 | GCTTCCAGCTTATTGAAT-GGAACGAGATGGGGCATGGCGCCACGGAGGGGAATCAAGG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1733 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA-10R-1 | GCTTCCAGCTTATTGAAT-CGAGGGTAAGGGAAGTATGGCCGGTGCCCTGGAGTCAATG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1734 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA-10R-18 | GCTTCCAGCTTATTGAAT-CGGGTGGGGGGAGCGACAGACGGAAAAGCCTGGGTCAATAG-GCGCTGAAGCGCGGAAGC | 77 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1735 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA-10R-55 | GCTTCCAGCTTATTGAAT-GGAGGGGCAGGGCATGGAGCTCGACATTCATGAGATGGGG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1736 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA-10R-59 | GCTTCCAGCTTATGGAAT-GTGCCGAGGCGATACATGCACAGGCATGGTGGGATAAGGTCGGG-GCGCTGAAGCGCGGAAGC | 80 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1737 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA-10R-69 | GCTTCCAGCTTATTGAAT-CGGAGAGTCTGGCGCAGCCCTACGCCGATGTAAGATGGGG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1738 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA-10R-72 | GCTTCCAGCTTATTGAAT-CGAGGTGTGGGAGACAACGCTCCGTGACCGAGGGGAAATG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1740 | 36108985 | 2022 | Naked-eye detection of Staphylococcus aureus in powdered milk and infant formula using gold nanoparticles | Anti-S. aureus aptamer (Apt1) | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (FPR3757 USA300) | Whole cell | Developed a colorimetric LSPR aptasensor using gold nanoparticles for the detection of S. aureus in milk and infant formula. | Could be visually detected within 30 min, with detection limits of 7.5 × 10(4) CFU/mL and 8.4 × 10(4) CFU/mL in milk and infant formula, respectively. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1746 | https://doi.org/10.1016/j.snb.2021.130879 | 2022 | Aptamer-conjugated magnetic Fe3O4@Au core-shell multifunctional nanoprobe: A three-in-one aptasensor for selective capture, sensitive SERS detection and efficient near-infrared light triggered photothermal therapy of Staphylococcus aureus | Apt | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CMCC 26003) | Whole cell | Developed an aptasensor based on Fe3O4@Au nanocomposites (NCs) for capture, SERS detection, and photothermal therapy (PTT) of S. aureus. | The detection limit is 25 cfu/mL, the cell capture efficiency (CCE) is as high as 68% and it has a high photothermal conversion efficiency of 39.28%. | N/A | N/A | N/A | Diagnostic/Therapeutics | N/A | 5'-Thiolated | The cytotoxicity of Fe3O4@Au-Apt NCs to S. aureus is negligible. | The SERS intensity of S. aureus on the Fe3O4@Au-Apt NCs remains almost unchanged within 12 days. | N/A | N/A | N/A |
| ABdb_1768 | https:doi.org10.1016j.snb.2023.134218 | 2023 | Dual-mode sensing platform based on aptamer-tunable catalytic activity of mesoporous polydopamine/MnO2 nanozymes for detecting S. aureus | SA31 | GCAATGGTACGGTACTTCCTCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGACAAAAGTGCACGCTACTTTGCTA | 87 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Colourimetric-electrochemical sensing platform to detect S. aureus based on a dual-modal strategy. | Shows a low detection limit in 3 CFU/mL with a linear range between 5 and 10(7) CFU/mL and in a real sample with the recovery of 95.15%− 115.28%. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1776 | 36906992 | 2023 | An ultrasensitive electrochemical aptasensor using Tyramide-assisted enzyme multiplication for the detection of Staphylococcus aureus | SA37 | GCTTCCAGCTTATTGAATAAAGACGGGGGGGGGGACCGGCGTATGAGTGAAGATGGGGGCGCTGAAGCGCGGAAGC | 76 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | An electrochemical aptasensor based on the tyramide signal amplification (TSA) technology was developed for the detection of S. aureus. | Achieved a limit of detection (LOD) of 3 CFU/mL in buffer and 8 CFU/mL in both tap water and beef broth. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1777 | 36832038 | 2023 | Applicability of a Green Nanocomposite Consisted of Spongin Decorated Cu2WO4(OH)2 and AgNPs as a High-Performance Aptasensing Platform in Staphylococcus aureus Detection | Apt | TCGGCACGTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTC | 43 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed an aptasensing Platform based on a Green Nanocomposite consisting of Spongin Decorated Cu2WO4(OH)2 and AgNPs for Staphylococcus aureus detection. | Measured S. aureus under a linear concentration range of 10–10(8) CFU/mL and a limit of quantification and detection of 12 and 1 CFU/mL, respectively. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1778 | 37327207 | 2023 | FRET-Based Single-Molecule Detection of Pathogen Protein IsdA Using Computationally Selected Aptamers | T1-280 | ACTGTCrGrCrGrCrArCrGrCrGrUrGrUrGrUrArGrUrArCrArCrArCrGrArUrCrGrCrGrCrGrCrArCrArArUrArU | 46 | N/A | ssRNA | Staphylococcus aureus (S. aureus) | Iron-regulated Surface Determinant Protein A (IsdA) | Develop a FRET-based aptasensor for single-molecule detection of IsdA. | LOD value of T1-280 RNA was 113 pM. | N/A | Fluorescence Resonance Energy Transfer Assay (FRET) | 2.2 ± 0.5 nM | Detection | In-silico Method | 5'-Cyanine3 (Cy3) Labeled or 5'-Biotinylated and 5′ end by six nucleotides (ACT GTC), rX = RNA nucleotide | N/A | N/A | N/A | N/A | N/A |
| ABdb_1779 | 37327207 | 2023 | FRET-Based Single-Molecule Detection of Pathogen Protein IsdA Using Computationally Selected Aptamers | T2-139040 | ACTGTCrArArUrUrUrGrArArUrArUrArUrUrArGrUrGrCrGrCrGrCrCrGrUrArGrUrGrUrGrUrArArArArArUrU | 46 | N/A | ssRNA | Staphylococcus aureus (S. aureus) | Iron-regulated Surface Determinant Protein A (IsdA) | Develop a FRET-based aptasensor for single-molecule detection of IsdA. | LOD value of T2-139040 RNA was 17 pM. | N/A | Fluorescence Resonance Energy Transfer Assay (FRET) | 1.0 ± 0.3 nM | Detection | In-silico Method | 5'-Cyanine3 (Cy3) Labeled or 5'-Biotinylated and 5′ end by six nucleotides (ACT GTC), rX = RNA nucleotide | N/A | N/A | N/A | N/A | N/A |
| ABdb_1780 | 37327207 | 2023 | FRET-Based Single-Molecule Detection of Pathogen Protein IsdA Using Computationally Selected Aptamers | T3-117558 | ACTGTCrArArUrUrUrGrArGrUrGrUrGrUrGrArUrCrArUrArUrArUrCrGrUrArGrCrGrCrGrCrUrArCrArArCrC | 46 | N/A | ssRNA | Staphylococcus aureus (S. aureus) | Iron-regulated Surface Determinant Protein A (IsdA) | Develop a FRET-based aptasensor for single-molecule detection of IsdA. | LOD value of T3-117558 RNA was 11 pM. | N/A | Fluorescence Resonance Energy Transfer Assay (FRET) | 0.7 ± 0.4 nM | Detection | In-silico Method | 5'-Cyanine3 (Cy3) Labeled or 5'-Biotinylated and 5′ end by six nucleotides (ACT GTC), rX = RNA nucleotide | N/A | N/A | N/A | N/A | N/A |
| ABdb_1781 | 37327207 | 2023 | FRET-Based Single-Molecule Detection of Pathogen Protein IsdA Using Computationally Selected Aptamers | A14 | ACTGTCCACACCGCAGCAGTGGGAACGTTTCAGCCATGCAAGCATCACGCCCGT | 54 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Iron-regulated Surface Determinant Protein A (IsdA) | Develop a FRET-based aptasensor for single-molecule detection of IsdA. | LOD value of A14 DNA was 485 pM. | N/A | Fluorescence Resonance Energy Transfer Assay (FRET) | 4 ± 2 nM | Detection | N/A | 5'-Cyanine3 (Cy3) Labeled or 5'-Biotinylated and 5′ end by six nucleotides (ACT GTC) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1783 | 36549213 | 2023 | Ultrasensitive dual-enhanced sandwich strategy for simultaneous detection of Escherichia coli and Staphylococcus aureus based on optimized aptamers-functionalized magnetic capture probes and graphene oxide-Au nanostars SERS tags | Apt2 | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CMCC 26003) | Whole cell | A SERS platform using aptamers modified-Fe3O4@SiO2-Au NCs was developed for simultaneous detection of E. coli and S. aureus. | The detection limit for S. aureus was as low as 10 cfu/mL, and the linear concentration ranged from 10(1)-10(8) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) or 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1784 | https://doi.org/10.1016/j.snb.2023.133554 | 2023 | A novel Aptamer-induced CHA amplification strategy for ultrasensitive detection of Staphylococcus aureus and NIR-triggered photothermal bactericidal Activity based on aptamer-modified magnetic Fe3O4@AuNRs | Aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed a Fe3O4 @AuNRs-aptasensor based on CHA for ultrasensitive detection of S. aureus. | Achieved a linear response ranging from 10(2) to 10(6) CFU/mL and a detection limit of 10(1) CFU/mL under optimal conditions. | N/A | N/A | N/A | Biosensor | N/A | 3'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1799 | 36961921 | 2023 | Dual Synthetic Receptor-Based Sandwich Electrochemical Sensor for Highly Selective and Ultrasensitive Detection of Pathogenic Bacteria at the Single-Cell Level | S. aureus aptamer | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | An electrochemical sandwich sensor was developed for the detection of a single bacterial cell based on dual recognition by the bacteria-imprinted polymer film (BIF) and aptamer (Au@Fc-Apt). | The sensor could detect as low as 10 CFU/mL in a milk sample and 1 CFU/mL in PBS with a linear range from 10 to 10(5) CFU/mL for S. aureus. | N/A | N/A | N/A | Biosensor | N/A | 3'-Thiolated (HS-(CH2)6) | N/A | After storage at 4°C for 17 days, the sensor still retained about 92% of the initial detection signal. | N/A | N/A | N/A |
| ABdb_1800 | https://doi.org/10.1002/celc.202300257 | 2023 | Rolling Circle Amplification/G-Quadruplex-Based Dual-Signal Ratiometric Electrochemical Aptasensor for Ultrasensitive Detection of Pathogenic Bacteria | Aptamer (P1) | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 87 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923 and ATCC 29213) | Whole cell | Developed a ratiometric dual-signal electrochemical biosensor for ultrasensitive detection of S. aureus based on an aptamer recognition-induced rolling circle amplification (RCA)/G-quadruplex strategy. | Showed a good linear relationship between 10–10(6) CFU/mL with a detection limit of 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | Ferrocene (Fc) conjugated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1815 | https://doi.org/10.1016/j.cej.2023.143099 | 2023 | Design nanoprobe based on DNA tetrahedron supported hybridization chain reaction and its application to in situ analysis of bacteria | Aptamer (AA) | AGTGCGCAGCTAGCAAGGCCTTTTTTTTTTGCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 118 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 6538) | Whole cell | Developed a nanoprobe (DTAAT) based on DNA tetrahedral supported hybridization chain reaction (HCR) for in situ analysis of SA. | Detect SA with the detection limit as low as 26 CFU/mL and linear range of 50-5×10(6) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled and 3'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1817 | 36705734 | 2023 | A universal approach for sensitive and rapid detection of different pathogenic bacteria based on aptasensor-assisted SERS technique | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CICC 10473) | Whole cell | Developed an assembled aptasensor based on Fe3O4@Au@Ag nanocomposites for the detection of various pathogenic bacteria. | Showed a linear range of 10-10(7) CFU/mL, with a detection limit of 5.70 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1824 | https://doi.org/10.1016/j.microc.2023.108605 | 2023 | A SERS biosensor based on aptamer-based Fe3O4@SiO2@Ag magnetic recognition and embedded SERS probes for ultrasensitive simultaneous detection of Staphylococcus aureus and Escherichia coli | S. aureus aptamer (P1) | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (BNCC 186335) | Whole cell | Developed a SERS biosensor based on aptamer-modified Fe3O4@SiO2@Ag and Au-MPBA/DTNB@Ag for simultaneous detection of S.aureus and E.coli. | Rapidly detect S. aureus with the limit of detection (LOD) of 1 CFU/mL in 20 min and a linear range from 10(1) ∼ 10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1826 | https://doi.org/10.1016/j.microc.2023.108681 | 2023 | An electrochemical and colorimetric dual-mode aptasensor for Staphylococcus aureus based on a multifunctional MOF and magnetic separation technique | S. aureus Aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | Developed a colorimetric and electrochemical dual-mode aptasensor based on ssDNA-Au/CuMOF and MB-Apt for S. aureus detection. | Display a broad linear range from 10 to 10(8) CFU/mL, with colorimetric minimum resolution of 48 CFU/mL, and electrochemical detection limit of 5 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1830 | 38250355 | 2024 | Rapid Detection and Identification of Vancomycin-Sensitive Bacteria Using an Electrochemical Apta-Sensor | Apt1 | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (RN4220) | Whole cell | A portable electrochemical biosensor was developed for the identification of Gram-positive bacteria based on a vancomycin-modified screen-printed carbon electrode. | Demonstrated that capture was achieved in 10 min, with a limit of detection of only 2.7 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1840 | 38770656 | 2024 | Sensitive and on-Site Detection of Staphylococcus aureus Based on CRISPR/Cas 13a-Assisted Chemiluminescence Resonance Energy Transfer | S. aureus Aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Develop a CRISPR/Cas 13a-assisted CRET-based strategy for the detection of S. aureus in real samples. | Successfully detected S. aureus in drinking water and milk with detection limits of 20 and 30 cfu/mL, respectively, within the recovery of 90.07–105.50%. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1841 | 39727901 | 2024 | Competitive Electrochemical Apta-Assay Based on cDNA-Ferrocene and MXenes for Staphylococcus aureus Surface Protein A Detection | APT | ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCT | 58 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Staphylococcus aureus Protein A (SpA) | Developed a competitive aptasensor based on a ferrocene (Fc)-labeled cDNA hybridized (cDNA-Fc S13) on a specific aptamer (APT) for PrA in the presence of MXene nanosheets for the indirect detection of S. aureus. | Displayed a linear range of 10–125 nM, an LOD of 3.33 nM, and a response time under 40 min. | N/A | N/A | N/A | Biosensor | N/A | 3'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1846 | 38169279 | 2024 | "Five birds one stone" tri-modal monitoring driven lab-on-magnetic aptasensor for accurate pathogen detection and enhanced germicidal application | Anti-S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 65389) | Whole cell | A fluorescence-colorimetric-photothermal tri-modal sensing platform was developed for the detection of S. aureus by apt/KCl@CDs and magnetic multi-walled carbon nanotube composites (M-MWCNTs). | The detection limits of fluorescence, colorimetric and photothermal models were 4.81 cfu/mL, 3.40 cfu/mL and 6.74 cfu/mL, respectively with the same linear range of 10 - 1.0 ×10(7) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1849 | https://doi.org/10.1016/j.biosx.2023.100436 | 2024 | DNA origami-enhanced binding of aptamers to Staphylococcus aureus cells | PA#2/8 [1–58] | ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCT | 58 | N/A | ssDNA | Staphylococcus aureus (S. aureus) SA5 | Staphylococcus aureus Protein A (SpA) | Developed a DNA origami-based biosensor for the detection of SA. | Five-times higher affinity of the aptamer-functionalized DNA origami compared to pure aptamers. | N/A | Enzyme-Linked Oligonucleotide Assay (ELONA) | 160 ± 9 nM | Biosensor | N/A | 5'-PolyA (21A) or PolyT (21 T) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1851 | 38180496 | 2024 | Development of an electrochemical sensitive aptasensor based on a zeolite imidazolate framework-8 and gold nanoparticles for the determination of Staphylococcus aureus bacteria | Aptamer | TCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTC | 46 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed an electrochemical aptasensor based on a glassy carbon electrode (GCE) modified with zeolite imidazolate framework-8 (ZIF 8) and gold nanoparticles (AuNPs) for the detection of S. aureus. | Showed a linear response in the concentration range of 1.5 × 10(1) to 1.5 × 10(7) CFU mL−1 and a detection limit of 3.4 CFU/mL. | N/A | N/A | (9.04 ± 1.27) × 10(−1) nM | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | Response of the proposed aptasensor reached 98.9%, 94.3%, and 92.8% of the initial response on the first, second, and third days, respectively, when kept at 4°C. | N/A | N/A | N/A |
| ABdb_1852 | 37751632 | 2024 | A novel paper-based electrochemiluminescence biosensor for non-destructive detection of pathogenic bacteria in real samples | Aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTGCTAACCCCCCTTAATCCCCCC | 104 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed a paper-based electrochemiluminescence (ECL) aptasensor based on a Ru-MOF-5 NFs modified Indium tin oxide (ITO) electrode for the detection of S. aureus. | Exhibited a linear range from 5 to 10(8) CFU/mL, and a limit of detection (LOD) of 1 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-COOH (Carboxylated) | N/A | After 9 days at 4°C, the ECL signal of aptsensor retained 95.8% of its initial value, suggesting satisfactory storage stability. | N/A | N/A | N/A |
| ABdb_1869 | 37639893 | 2024 | Nano-biosensor based on manganese dioxide nanosheets and carbon dots for dual-mode determination of Staphylococcus aureus | Aptamer1 | TCGGCACGTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTC | 43 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed a fluorescence and colorimetry dual-mode sensor to detect S. aureus by MnO2 NSs and CDs. | Had a broad linear range of 37 ∼ 3.7 × 10(6) CFU/mL and low detection limits of 9 CFU/mL (ratiometric fluorescence) and 22 CFU/mL (colorimetry). | N/A | N/A | N/A | Biosensor | N/A | 5'-COOH (Carboxylated) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1870 | 37639893 | 2024 | Nano-biosensor based on manganese dioxide nanosheets and carbon dots for dual-mode determination of Staphylococcus aureus | Aptamer2 | GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT | 45 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed a fluorescence and colorimetry dual-mode sensor to detect S. aureus by MnO2 NSs and CDs. | Had a broad linear range of 37 ∼ 3.7 × 10(6) CFU/mL and low detection limits of 9 CFU/mL (ratiometric fluorescence) and 22 CFU/mL (colorimetry). | N/A | N/A | N/A | Biosensor | N/A | 5'-COOH (Carboxylated) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1872 | 38669846 | 2024 | Ultra-sensitive and rapid detection of Salmonella enterica and Staphylococcus aureus to single-cell level by aptamer-functionalized carbon nanotube field-effect transistor biosensors | S. aureus aptamer | AACGAGGCGCAGGGGGAGGGGGTGGTACAGATAAGATGGGG | 41 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CMCC(B) 26003) | Whole cell | Developed an aptamer-functionalized CNT-FET biosensor for the detection of these foodborne pathogens. | Could detect S. aureus at a limit of detection (LOD) as low as 1.2 CFU in PBS buffer with a linear range from 10(2)-1.28 × 10(4) CFU/mL. | N/A | Flow Cytometry | 0.65 ± 0.2 μM | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6), 5'-FAM Labeled and 3'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1889 | 39894103 | 2025 | Introduce a novel, extremely sensitive aptamer against staphylococcal enterotoxin type D | Aptamer 1 | CCTAACCGATATCACACTCAC-GGGTGCAGCCCGGAGCGGCTTGCATGATTGGGTTGGTGGG-GTTGGTCGTCATTGGAGTATC | 82 | 5'-CCTAACCGATATCACACTCAC-N40-GTTGGTCGTCATTGGAGTATC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin D (SED) | Isolate high-affinity ssDNA aptamers with specificity for SED. | The limit of detection (LOD) for SED was determined to be 45 nM. | 10 | Surface Plasmon Resonance (SPR) and Enzyme-Linked Apta-Sorbent Assay (ELASA) | 4.4 ± 2.26 nM (by SPR) and 13.43 nM (by ELASA) | Diagnostic | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1895 | 39793372 | 2025 | Aptamer-molecularly imprinted polymer sensors for the detection of bacteria in water | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) strain SH1000 | Whole cell | Developed an electrochemical sensor based on aptamer-molecularly imprinted polymer (Apta-MIP) for the multiplexed detection of Staphylococcus aureus and Escherichia coli. | Can detect S. aureus with a limit of detection of 4 CFU/mL and exhibited a broad dynamic range from 1 CFU/mL to 10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1905 | 41123678 | 2025 | Portable AI-driven electrochemical aptasensor for real-time Staphylococcus aureus detection in food and beverages | IsdA-specific aptamer | GCGCACGCGUGUGUAGUACACACGAUCGCGCGCACAAUAU | 40 | N/A | ssRNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Iron-regulated Surface Determinant Protein A (IsdA) | Developed a portable electrochemical aptasensor integrated with machine learning using SPCE/AuNPs for the detection of S. aureus in food and beverage samples. | The lowest detection limit for S. aureus was 1 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1913 | 40187870 | 2025 | 3D DNA walkers integrated with self-reporting MOFs: Pioneering ratiometric electrochemical sensing for Staphylococcus aureus | S. aureus aptamer (Apt) | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed a ratiometric electrochemical aptasensor utilizing a magnetic 3D DNA walking machine and self-assembly of MOF for the sensitive detection of S. aureus. | Demonstrates a detection range from 10 to 2 × 10(5) CFU/mL and achieves a low LOD of 2.3 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | After a duration of seven days, the ratio value maintained 91.89% of its initial intensity. | N/A | N/A | N/A |
| ABdb_1914 | 40335784 | 2025 | A novel strategy for ultrasensitive detection and effective inactivation of Staphylococcus aureus based on Fe3O4-QCS-PEI-Cu-aptamer and ladder-branch HCR | Aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed an integrated strategy based on Fe3O4-quaternary ammonium chitosan-polyetherimide-Cu-aptamer (Fe3O4-QCS-PEI-Cu-aptamer) and ladder-branch hybridization chain reaction (HCR) for the detection and inactivation of S. aureus. | The sensor demonstrated a limit of detection (LOD) of 3 CFU/mL for S. aureus and, under near-infrared (NIR) irradiation, achieved an antimicrobial efficiency of 99.946%. | N/A | N/A | N/A | Diagnostic/Therapeutics | N/A | 3'-COOH (Carboxylated) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1930 | 40916637 | 2025 | Study of Bacteriostasis of Kaempferide on Foodborne Pathogenic Bacteria by Indirect Determination of Capillary Electrophoresis | AP3 | TCCCTACGGCGCTAACCTCCCAACCGCTCCACCCTGCCTCCGCCTCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 6538) | Whole cell | Developed an aptamer-based capillary sieving electrophoresis (CE)-Laser-induced fluorescence (LIF) detection of three bacteria, Vibrio parahaemolyticus, Escherichia coli, and Staphylococcus aureus. | The measured limit of detection (LOD) for S. aureus was 1.67 × 10(7) CFU/mL and a linear range of 3.00-150 × 10(7) CFU/mL. | N/A | N/A | N/A | Detection | N/A | Extension chain for AP3 (T3), 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1934 | 41533198 | 2026 | Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureus | CA 7.1 | ACACTAGATCAGTCACAG-GATTAAGGATCGTTGTTGGGTGGTTTCCGTAATTACTATC-GACTTGACTCAGACATCT | 76 | 5'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Clumping factor A (ClfA) | Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection. | N/A | 11 | N/A | N/A | Detection | Ni-NTA affinity SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1935 | 41533198 | 2026 | Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureus | CA 15.1 | ACACTAGATCAGTCACAG-GGTTGCTCAGGAGAAGGGAACGTGGGTGGTGGCGCGGACG-GACTTGACTCAGACATCT | 76 | 5'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Clumping factor A (ClfA) | Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection. | N/A | 11 | N/A | N/A | Detection | Ni-NTA affinity SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1936 | 41533198 | 2026 | Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureus | CA 3.1 | ACACTAGATCAGTCACAG-ACGGGGAGAGGGTCATCTCTGGTTTCGGGGTGCTAATTCT-GACTTGACTCAGACATCT | 76 | 5'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Clumping factor A (ClfA) | Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection. | N/A | 11 | N/A | N/A | Detection | Ni-NTA affinity SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1937 | 41533198 | 2026 | Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureus | CA 8.1 | ACACTAGATCAGTCACAG-CCCCGACCTGTACACGTACTACCCGATGACATTTGGTGTT-GACTTGACTCAGACATCT | 76 | 5'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Clumping factor A (ClfA) | Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection. | N/A | 11 | N/A | N/A | Detection | Ni-NTA affinity SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1938 | 41533198 | 2026 | Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureus | CA 13.1 | ACACTAGATCAGTCACAG-TGGACGCGGCGGGCCGGATTAAGTTGAGGAGAGGGGGGTG-GACTTGACTCAGACATCT | 76 | 5'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Clumping factor A (ClfA) | Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection. | N/A | 11 | N/A | N/A | Detection | Ni-NTA affinity SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1939 | 41533198 | 2026 | Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureus | CA 16.1 | ACACTAGATCAGTCACAG-AGTATATATGGATTCCGCAACGTACGCAGGGGGTGTCGCC-GACTTGACTCAGACATCT | 76 | 5'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Clumping factor A (ClfA) | Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection. | N/A | 11 | N/A | N/A | Detection | Ni-NTA affinity SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1940 | 41533198 | 2026 | Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureus | CA 14.1 | ACACTAGATCAGTCACAG-CAGAGAGGGGCGGCGAGGGACAAAGGAGGGTAGGTGTGCC-GACTTGACTCAGACATCT | 76 | 5'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Clumping factor A (ClfA) | Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection. | N/A | 11 | N/A | N/A | Detection | Ni-NTA affinity SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1941 | 41533198 | 2026 | Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureus | CA 12.1 | ACACTAGATCAGTCACAG-ATCACAGCGGAGGTTTAACGTGTGGCGGGTGTGGGGACATG-GACTTGACTCAGACATCT | 77 | 5'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Clumping factor A (ClfA) | Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection. | N/A | 11 | N/A | N/A | Detection | Ni-NTA affinity SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1942 | 41533198 | 2026 | Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureus | CA 11.1 | ACACTAGATCAGTCACAG-GAGCAACAGTCTCGCCTTCGTTACTGCGCGCGGGACGGGG-GACTTGACTCAGACATCT | 76 | 5'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Clumping factor A (ClfA) | Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection. | CA 11.1 exhibited S. aureus binding in a linear range of 10(3) to 10(8) CFU/mL and a limit of detection (LOD) of 10(3) CFU/mL. | 11 | Bead-based Binding Assay | 263.8 ± 78 nM | Detection | Ni-NTA affinity SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1943 | 41533198 | 2026 | Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureus | CA 17.1 | ACACTAGATCAGTCACAG-AAGTGGAATCAAGCATGGGTATTTTAAGCATCGTATCTCG-GACTTGACTCAGACATCT | 76 | 5'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Clumping factor A (ClfA) | Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection. | N/A | 11 | N/A | N/A | Detection | Ni-NTA affinity SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1944 | 41533198 | 2026 | Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureus | CA 5.1 | ACACTAGATCAGTCACAG-TGTTTCACGGGGGGGAGGGTAACGGAAGCTAATGGTCTCG-GACTTGACTCAGACATCT | 76 | 5'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Clumping factor A (ClfA) | Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection. | N/A | 11 | N/A | N/A | Detection | Ni-NTA affinity SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1946 | 41344010 | 2026 | SERS-based Aptasensor using Au NSs@Ag NPs/magnetic graphene oxide assemblies for simultaneous detection of Escherichia coli and Staphylococcus aureus | Apt2 & Apt4 | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAACTTTTTTTTT | 71 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed a SERS aptasensor based on aptamer-magnetic graphene oxide (MGO) and dual-functional Au NSs@Ag NPs probes for simultaneous detection of E. coli and S. aureus. | The SERS intensity shows a good linear relationship over a range of 50 to 10(6) CFU/mL, with a detection limit of 20 CFU/mL for S. aureus. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (for apt1 & apt2) and 5'-Amidation (NH₂) (for apt3 & apt4) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1953 | 11808691 | 2002 | Use of magnetic beads in selection and detection of biotoxin aptamers by electrochemiluminescence and enzymatic methods | Anti-staphylococcal enterotoxin B (SEB) aptamers | N/A | N/A | 5'-CCGGATCCGTTGATA-N20-GTGGTGTTGGCTCCC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Developed an aptamer-based electrochemiluminescence assay using a dsDNA aptamer for biotoxin detection. | Detection limit of less than 10 pg SEB with electrochemiluminescence assay. | 5 | N/A | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated (for ECL) or 5'-Amidation (NH₂-(CH2)6) (for colorimetric assays) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1988 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4520–8 | PCGGCPPCGGGPACCPAPPAPCGGPPPAGCCCAGPCAGAA | 40 | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Staphylococcus aureus Protein A (SpA) | Developed slow off-rate modified aptamer (SOMAmer) reagents against S. aureus cell surface-associated proteins, used to capture and detect S. aureus. | Efficient capture of Staph. aureus over a wide range of cell densities from 5 × 10(2) CFU/ml to 5 × 10(9) CFU/ml. | 8 | Radiolabel Filter Binding Assay | 0·22 nM | Detection | SELEX | P=NapdU (5-naphthylmethyl-aminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1989 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4503–73 | AZCZGGZZCAAAGZGGCGAZZGGGCAZCZGGZZZZZAAGZ | 40 | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Clumping factor A (ClfA) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | Efficient capture of Staph. aureus over a wide range of cell densities from 5 × 10(2) CFU/ml to 5 × 10(9) CFU/ml. | 8 | Radiolabel Filter Binding Assay | 0·79 nM | Detection | SELEX | Z=BndU (5-benzylaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1990 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4531–56 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Staphylococcus aureus Protein A (SpA) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | Able to bind whole cells of all Staph. aureus strains tested, with a detection limit of approx. 10(4) cells per well (10(5)-10(6) cells/ml). | 8 | Radiolabel Filter Binding Assay | 0·03 nM | Detection | SELEX | TrpdU (5-tryptaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1991 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4522–5 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Clumping factor A (ClfA) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 0·35 nM | Detection | SELEX | TrpdU (5-tryptaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1992 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4504–27 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Clumping factor B (ClfB) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 1·35 nM | Detection | SELEX | BndU (5-benzylaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1993 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4511–67 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Clumping factor B (ClfB) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 3·90 nM | Detection | SELEX | NapdU (5-naphthylmethyl-aminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1994 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4523–79 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Clumping factor B (ClfB) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 0·47 nM | Detection | SELEX | TrpdU (5-tryptaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1995 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4726–44 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Fibronectin-binding Protein A (FnbA) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 4·38 nM | Detection | SELEX | NapdU (5-naphthylmethyl-aminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1996 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4745–51 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Fibronectin-binding Protein A (FnbA) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 0·63 nM | Detection | SELEX | TrpdU (5-tryptaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1997 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4506–13 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Fibronectin-binding protein B (FnbB) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 4·73 nM | Detection | SELEX | BndU (5-benzylaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1998 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4516–29 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Fibronectin-binding protein B (FnbB) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 0·63 nM | Detection | SELEX | NapdU (5-naphthylmethyl-aminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1999 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4527–83 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Fibronectin-binding protein B (FnbB) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 0·84 nM | Detection | SELEX | TrpdU (5-tryptaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2000 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4727–62 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Iron-regulated Surface Determinant Protein A (IsdA) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 0·73 nM | Detection | SELEX | NapdU (5-naphthylmethyl-aminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2001 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4746–3 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Iron-regulated Surface Determinant Protein A (IsdA) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 0·16 nM | Detection | SELEX | TrpdU (5-tryptaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2002 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4728–7 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Iron-regulated Surface Determinant Protein B (IsdB) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 0·14 nM | Detection | SELEX | NapdU (5-naphthylmethyl-aminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2003 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4747–90 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Iron-regulated Surface Determinant Protein B (IsdB) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 1·98 nM | Detection | SELEX | TrpdU (5-tryptaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2004 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4507–52 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Iron-regulated Surface Determinant Protein C (IsdC) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 0·15 nM | Detection | SELEX | BndU (5-benzylaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2005 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4517–71 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Iron-regulated Surface Determinant Protein C (IsdC) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 0·08 nM | Detection | SELEX | NapdU (5-naphthylmethyl-aminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2006 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4528–22 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Iron-regulated Surface Determinant Protein C (IsdC) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 0·07 nM | Detection | SELEX | TrpdU (5-tryptaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2007 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4731–69 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Iron-regulated Surface Determinant Protein H (IsdH) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 1·30 nM | Detection | SELEX | NapdU (5-naphthylmethyl-aminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2008 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4730–3 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | SasD | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 2·17 nM | Detection | SELEX | NapdU (5-naphthylmethyl-aminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2012 | 24472539 | 2014 | DNA aptamers as a novel approach to neutralize Staphylococcus aureus α-toxin | AT-27 | N/A | N/A | 5'-ACCCCTGCAGGATCCTTTGCTGGTACC-N42-AGTATCGCTAATCAGTCTAGAGGGCCCCAGAAT-3' | ssDNA | Staphylococcus aureus (S. aureus) | α-toxin (exotoxin) | Identify aptamers that bind to and inhibit the cytotoxic activity of a-toxin and the upregulation of inflammatory cytokines TNF-a and IL-17. | Increased the viability of α-toxin-treated Jurkat T cells to about 85–90%. | 10 | N/A | N/A | Therapeutics/Immunmodulatory | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_2013 | 24472539 | 2014 | DNA aptamers as a novel approach to neutralize Staphylococcus aureus α-toxin | AT-33 | N/A | N/A | 5'-ACCCCTGCAGGATCCTTTGCTGGTACC-N42-AGTATCGCTAATCAGTCTAGAGGGCCCCAGAAT-3' | ssDNA | Staphylococcus aureus (S. aureus) | α-toxin (exotoxin) | Identify aptamers that bind to and inhibit the cytotoxic activity of a-toxin and the upregulation of inflammatory cytokines TNF-a and IL-17. | AT-33 inhibited α-toxin-induced upregulation of TNF-α and IL-17 in Jurkat T cells. Increased the viability of α-toxin-treated Jurkat T cells to about 85–90%. | 10 | N/A | N/A | Therapeutics/Immunmodulatory | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_2014 | 24472539 | 2014 | DNA aptamers as a novel approach to neutralize Staphylococcus aureus α-toxin | AT-36 | N/A | N/A | 5'-ACCCCTGCAGGATCCTTTGCTGGTACC-N42-AGTATCGCTAATCAGTCTAGAGGGCCCCAGAAT-3' | ssDNA | Staphylococcus aureus (S. aureus) | α-toxin (exotoxin) | Identify aptamers that bind to and inhibit the cytotoxic activity of a-toxin and the upregulation of inflammatory cytokines TNF-a and IL-17. | AT-36 inhibited α-toxin-induced upregulation of TNF-α and IL-17 in Jurkat T cells. Increased the viability of α-toxin-treated Jurkat T cells to about 85–90%. | 10 | N/A | N/A | Therapeutics/Immunmodulatory | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_2015 | 24472539 | 2014 | DNA aptamers as a novel approach to neutralize Staphylococcus aureus α-toxin | AT-49 | N/A | N/A | 5'-ACCCCTGCAGGATCCTTTGCTGGTACC-N42-AGTATCGCTAATCAGTCTAGAGGGCCCCAGAAT-3' | ssDNA | Staphylococcus aureus (S. aureus) | α-toxin (exotoxin) | Identify aptamers that bind to and inhibit the cytotoxic activity of a-toxin and the upregulation of inflammatory cytokines TNF-a and IL-17. | Increased the viability of α-toxin-treated Jurkat T cells to about 85–90%. | 10 | N/A | N/A | Therapeutics/Immunmodulatory | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |