Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 31
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0713 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp1 | TGAGCCCAAGCCCTGGTATG-TTCTTCCCTTTTATTAGTCCTGTATTCCTCTACTGTTGCC-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | With sandwich Sp1 and Sp20, the aptamer assay achieved a concentration range for S. sonnei of 10(2) cfu/mL to 10(7) cfu/mL and a detection limit of 30 cfu/mL. | 12 | Flow Cytometry | 5.98 ± 0.835 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled and Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0714 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp13 | TGAGCCCAAGCCCTGGTATG-TATCCGATTTTATCTGTCCAATATTCCCTGTGTCTACCTT-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | N/A | 12 | Flow Cytometry | 97.38 ± 36.2 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0715 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp16 | TGAGCCCAAGCCCTGGTATG-TATCTTCACTTGACCTTTACCGCAATCGTCCATGTATCTG-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | N/A | 12 | Flow Cytometry | 682.2 ± 125 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0716 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp19 | TGAGCCCAAGCCCTGGTATG-TTCTACCCAACTGCTTTAATAGTCACTGTCATAGTTCCAC-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0717 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp20 | TGAGCCCAAGCCCTGGTATG-TCGTCGATTATTGTTTCAGTTCAGTTCCCCCGCGTTCCGA-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | With sandwich Sp1 and Sp20, the aptamer assay achieved a concentration range for S. sonnei of 10(2) cfu/mL to 10(7) cfu/mL and a detection limit of 30 cfu/mL. | 12 | Flow Cytometry | 14.32 ± 2.19 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled and HEX (hexachlorofluorescein) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0718 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp22 | TGAGCCCAAGCCCTGGTATG-CCTACCTTAGTCCGTTTCGCTGTGTTTGTCCAATATTCCT-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | N/A | 12 | Flow Cytometry | 4.98 ± 0.357 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0719 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp23 | TGAGCCCAAGCCCTGGTATG-CTTCACTTGACCCTTATCGCTTCTAACACAACCGCTTTTT-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | N/A | 12 | Flow Cytometry | 5.735 ± 0.478 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0720 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp28 | TGAGCCCAAGCCCTGGTATG-TATTCCCCCTTATTTTAGCCATTTTGTTACATCTTCCGTC-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | N/A | 12 | Flow Cytometry | 72.89 ± 22.16 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0721 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp29 | TGAGCCCAAGCCCTGGTATG-ATATTCGTTCTTTTCGCCTTAACTTCTCGTGTTTCCTTAC-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | N/A | 12 | Flow Cytometry | 47.83 ± 9.7 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0897 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-3 | ATACCAGCTTATTCAATTCCA-TGGTCCCTCGTGTTTATTATGTTGTCTGAACTGGCTG-AGATTGCACTTACTATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | Sandwich complex pair of SS-3 and SS-4 shows a linear dynamic range of 10(3)-10(6) cells/mL, and a limit of detection of 10(3) cells per mL for S. sonnei. | 8 | Surface Plasmon Resonance (SPR) | 39.32 ± 5.02 nM | Biosensor | Whole Cell-SELEX | 5'-Cyanine5 (Cy5) Labeled or 5′-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0898 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-4 | ATACCAGCTTATTCAATTCCA-CACATACCAAAAACACAGCACACTTCATCAATTTCACG-AGATTGCACTTACTATCT | 77 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | Sandwich complex pair of SS-3 and SS-4 shows a linear dynamic range of 10(3)-10(6) cells/mL, and a limit of detection of 10(3) cells per mL for S. sonnei. | 8 | Surface Plasmon Resonance (SPR) | 15.89 ± 1.77 nM | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0899 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-1 | ATACCAGCTTATTCAATTCCA-GGGCATGTGGACCTGCGATTTCGGTTTGGTGTGGTTGGGG-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0900 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-2 | ATACCAGCTTATTCAATTCCA-CCCCATGTCTGTTTCTTTTAACAGGTAATCCGCCTTATGC-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0901 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-5 | ATACCAGCTTATTCAATTCCA-CAGGACAAAAATTCGGGAAGGCGGCCTTCCACTCTTTCTG-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0902 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-6 | ATACCAGCTTATTCAATTCCA-ATACAGTGAAGGCCCAGGAGGCAAATTCTAGGACGAAAGC-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0903 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-7 | ATACCAGCTTATTCAATTCCA-CACCAAGTCGCCTCCTCTGCCCCCATGTAAATCGTTACAT-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0904 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-8 | ATACCAGCTTATTCAATTCCA-GAACAATTTCACGCACACCGCGTAGATACCACCTCGTGCA-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0905 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-9 | ATACCAGCTTATTCAATTCCA-CGACGAACTACACCACAGGCCCTTAACACATCTACTTGTA-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0906 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-10 | ATACCAGCTTATTCAATTCCA-CATGCTAACTGCCATCACCACTATTTATGATTCCATCCAT-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0907 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-11 | ATACCAGCTTATTCAATTCCA-CGCAACACAGAAACACCCGTACACAAACAGTTTCAGCCCG-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0908 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-12 | ATACCAGCTTATTCAATTCCA-TGCGTAGTTCTCTTAACAACCATTCAGCGTATTTTCGTGG-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0909 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-13 | ATACCAGCTTATTCAATTCCA-CAGGCACGAGTTCATCACACACCATACACAGTTCGTTACT-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0910 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-14 | ATACCAGCTTATTCAATTCCA-CCACACCACACACTACACGCATAAAACCACGAAACTACAC-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0911 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-15 | ATACCAGCTTATTCAATTCCA-GGGTATGTGGACTTGCGATTTCGGTTTGGTGTGGTTGGGG-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0912 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-16 | ATACCAGCTTATTCAATTCCA-CATACAGTGGCCAGATTTACCAACACACCTTTCCATACGC-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0913 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-17 | ATACCAGCTTATTCAATTCCA-CCACTCACATATTAACAACACCACATGAATATATTTCG-AGATTGCACTTACTATCT | 77 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0914 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-18 | ATACCAGCTTATTCAATTCCA-ACAGGGCATGTCTTCATCAACGCTTACCACACACCGCTCG-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0915 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-19 | ATACCAGCTTATTCAATTCCA-CACTCATGCGCACCGCGTCGCACTTAATCAGTGTTGTGC-AGATTGCACTTACTATCT | 78 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0916 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-20 | ATACCAGCTTATTCAATTCCA-GGGCATGTGGACTTGCGATTTCGGTTTGGTGTGGTTGGGG-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0917 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-21 | ATACCAGCTTATTCAATTCCA-CAGACACACCAACGCACGGGCACACGCTACAAATGTAAGT-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1486 | 32151909 | 2020 | Surface-enhanced Raman spectroscopic-based aptasensor for Shigella sonnei using a dual-functional metal complex-ligated gold nanoparticles dimer | S. Sonnei aptamer | TGAGCCCAAGCCCTGGTATGTTCTTCCCTTTTATTAGTCCTGTATTCCTCTACTGTTGCCGGCAGGTCTACTTTGGGATC | 80 | N/A | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Developed a SERS aptasensor using a composite material integrated with the Raman active 4-MBA ligand of the Eu-complex and citrate-stabilised Au nanoparticles (cit-Au NPs) for the detection of S. sonnei. | Showed a good linear relationship in the range of 10–10(6) cfu/mL with a limit of detection (LOD) as low as 10 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |