Target Organism : Shigella Flexneri

Total records found: 11

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_0712	https://doi.org/10.1080/00032719.2015.1052974	2015	Determination of Shigella flexneri by a Novel Fluorescent Aptasensor	Aptamer1	CCTCATGTCGAACAGCAACACTGCAACACTGTATAGTCCTGTGTGCCTTGAGCGTTTATTCTGAGCT	67	N/A	ssDNA	Shigella Flexneri (CGMCC 1.1868)	Whole cell	Developed a homogeneous fluorescent aptasensor using a dye-labelled aptamer and graphene oxide, using target recycling amplification for Shigella flexneri detection.	A linear relationship was displayed from 500 to 10(9) CFU/mL with a limit of detection of 100 CFU/mL.	N/A	N/A	29 ± 4 nM	Biosensor	N/A	Carboxyfluorescein-GGGCCC at the 5' and 3' ends	N/A	N/A	N/A	N/A	N/A
ABdb_1346	https://doi.org/10.1016/j.foodcont.2018.11.048	2019	Naked-eyes detection of Shigella flexneri in food samples based on a novel gold nanoparticle-based colorimetric aptasensor	Sh. flexneri binding aptamer	CCGGACTAGGGCTGGTTAGCTTCAATACTGCTGGGCGAGG	40	N/A	ssDNA	Shigella Flexneri (ATCC 12022)	Whole cell	Developed a colourimetric aptasensor based on an aptamer and gold nanoparticles (AuNPs) for the visual detection of Sh. flexneri.	Achieved a linear range from 10(2) to 10(6) CFU/mL with the detection limit of 80 CFU/mL, and the detection time was 20 min or less.	14	N/A	42.6 ± 7.11 nM	Biosensor	Whole Cell-SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1570	33582948	2021	Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples	SHI05	TAGCTCACTCATTAGGCACGACTCACTCTTGAAGGGGTGAGGCATGGTGGTATCAGCATAGTTAAGCCAGCC	72	5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3'	ssDNA	Shigella Flexneri (ATCC 9199)	Whole cell	Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples.	N/A	10	Flow Cytometry	144.4 nM	Detection	Whole Cell-SELEX	5'-FITC Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1571	33582948	2021	Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples	SHI08	TAGCTCACTCATTAGGCACATGCACCGAGGTCAGAAGTGCCTGTAATACACACCCCTCGGCATAGTTAAGCCAGCC	76	5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3'	ssDNA	Shigella Flexneri (ATCC 9199)	Whole cell	Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples.	N/A	10	Flow Cytometry	301.4 nM	Detection	Whole Cell-SELEX	5'-FITC Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1572	33582948	2021	Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples	SHI 9	TAGCTCACTCATTAGGCACCGAGTGCAAGATGTCCTACCCGATGAAGTAGGTTGGGTCTGCATAGTTAAGCCAGCC	76	5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3'	ssDNA	Shigella Flexneri (ATCC 9199)	Whole cell	Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples.	N/A	10	Flow Cytometry	279.7 nM	Detection	Whole Cell-SELEX	5'-FITC Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1573	33582948	2021	Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples	SHI23	TAGCTCACTCATTAGGCACCTTGGCTTAAAATGATAGCTAGTGGCAGATTGTTAATTTGGCATAGTTAAGCCAGCC	76	5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3'	ssDNA	Shigella Flexneri (ATCC 9199)	Whole cell	Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples.	The assay is able to detect 10(2) CFU/mL cells.	10	Flow Cytometry	231.2 nM	Detection	Whole Cell-SELEX	5'-FITC Labeled	N/A	N/A	Best Candidate	N/A	N/A
ABdb_1574	33582948	2021	Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples	SHI27	TAGCTCACTCATTAGGCACATGGCAAGGTTGCCTTTTTGAGCGCGCTGCATAGTTAAGCCAGCC	64	5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3'	ssDNA	Shigella Flexneri (ATCC 9199)	Whole cell	Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples.	N/A	10	Flow Cytometry	328.9 nM	Detection	Whole Cell-SELEX	5'-FITC Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1575	33582948	2021	Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples	SHI31	TAGCTCACTCATTAGGCACCAGCCGGAAGGACCAGCTAGCTCACTCATTAGGCACCGAAGTGTGGTGCATAGTTAAGCCAGCC	83	5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3'	ssDNA	Shigella Flexneri (ATCC 9199)	Whole cell	Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples.	N/A	10	Flow Cytometry	186.1 nM	Detection	Whole Cell-SELEX	5'-FITC Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1576	33582948	2021	Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples	SHI37	TAGCTCACTCATTAGGCACGAACGGGCTTGTCTTTCCATAATTCGTGCGAAAGTGCCGCATAGTTAAGCCAGCC	74	5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3'	ssDNA	Shigella Flexneri (ATCC 9199)	Whole cell	Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples.	N/A	10	Flow Cytometry	176.7 nM	Detection	Whole Cell-SELEX	5'-FITC Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1577	33582948	2021	Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples	SHI42	TAGCTCACTCATTAGGCACTAGCGGAAGCTTAGTGTAAACGAGTGATAATGTGTTATGTGCATAGTTAAGCCAGCC	76	5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3'	ssDNA	Shigella Flexneri (ATCC 9199)	Whole cell	Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples.	N/A	10	Flow Cytometry	173.6 nM	Detection	Whole Cell-SELEX	5'-FITC Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1819	36705734	2023	A universal approach for sensitive and rapid detection of different pathogenic bacteria based on aptasensor-assisted SERS technique	S. flexneri aptamer	CAGCAACACTGCAACACTGTATAGTCCTGTGTGCC	35	N/A	ssDNA	Shigella Flexneri (CGMCC 1.1868)	Whole cell	Developed an assembled aptasensor based on Fe3O4@Au@Ag nanocomposites for the detection of various pathogenic bacteria.	Showed a linear range of 10-10(7) CFU/mL, with a detection limit of 2.72 CFU/mL.	N/A	N/A	N/A	Biosensor	N/A	5'-Thiolated (HS-(CH2)6)	N/A	N/A	N/A	N/A	N/A