Target Organism : Shigella Dysenteriae

Total records found: 11

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_0322	23811206	2013	In vitro selection of a DNA aptamer targeted against Shigella dysenteriae	S 1	ATAGGAGTCACGACGACCAGAA-CGGAACTAGCGTTTAAATGCCAGGACTGAAGTAGGCAGGG-TATGTGCGTCTACCTCTTGACTAAT	87	5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3'	ssDNA	Shigella Dysenteriae	Whole cell	Identify an aptamer targeted against Shigella dysenteriae and develop a sandwich-type fluorescent bioassay for quantification.	Obtained linear range between 10(2)-10(7) cfu/mL of S. dysenteriae, and the limit of detection was 50 cfu/mL	8	Fluorescence Binding Assay	23.47 ± 2.48 nM	Detection	Whole Cell-SELEX	5'-FAM Labeled and Biotinylated	N/A	N/A	Best Candidate	N/A	N/A
ABdb_0323	23811206	2013	In vitro selection of a DNA aptamer targeted against Shigella dysenteriae	S12	ATAGGAGTCACGACGACCAGAA-CCTGGCGGGTCCCGGGGTAAACGGCACAAACGATAAAGAA-TATGTGCGTCTACCTCTTGACTAAT	87	5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3'	ssDNA	Shigella Dysenteriae	Whole cell	Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification	N/A	8	Fluorescence Binding Assay	N/A	Detection	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0324	23811206	2013	In vitro selection of a DNA aptamer targeted against Shigella dysenteriae	S2	ATAGGAGTCACGACGACCAGAA-AAGATGACACTTGGCAGCCGCCTCGAGTGTCCTACACGCA-TATGTGCGTCTACCTCTTGACTAAT	87	5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3'	ssDNA	Shigella Dysenteriae	Whole cell	Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification	N/A	8	Fluorescence Binding Assay	N/A	Detection	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0325	23811206	2013	In vitro selection of a DNA aptamer targeted against Shigella dysenteriae	S8	ATAGGAGTCACGACGACCAGAA-GCCAGATGAGGCCGGCAGGGCCCAAGTGTTGCTCGGGCTA-TATGTGCGTCTACCTCTTGACTAAT	87	5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3'	ssDNA	Shigella Dysenteriae	Whole cell	Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification	N/A	8	Fluorescence Binding Assay	N/A	Detection	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0326	23811206	2013	In vitro selection of a DNA aptamer targeted against Shigella dysenteriae	S21	ATAGGAGTCACGACGACCAGAA-TGCACGGGACAAGAGTACACGCCGATTGCCAGGCACAGTG-TATGTGCGTCTACCTCTTGACTAAT	87	5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3'	ssDNA	Shigella Dysenteriae	Whole cell	Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification	N/A	8	Fluorescence Binding Assay	75.49 ± 3.74 nM	Detection	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0327	23811206	2013	In vitro selection of a DNA aptamer targeted against Shigella dysenteriae	S10	ATAGGAGTCACGACGACCAGAA-GGGGAAGCCGATCAGGCCAATCATTGAGGGTGAACTAGCT-TATGTGCGTCTACCTCTTGACTAAT	87	5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3'	ssDNA	Shigella Dysenteriae	Whole cell	Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification	N/A	8	Fluorescence Binding Assay	N/A	Detection	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0328	23811206	2013	In vitro selection of a DNA aptamer targeted against Shigella dysenteriae	S19	ATAGGAGTCACGACGACCAGAA-TTATCGGCTGGCAAAACTGCGGCTGGAGCTCACAACTAGA-TATGTGCGTCTACCTCTTGACTAAT	87	5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3'	ssDNA	Shigella Dysenteriae	Whole cell	Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification	N/A	8	Fluorescence Binding Assay	N/A	Detection	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0329	23811206	2013	In vitro selection of a DNA aptamer targeted against Shigella dysenteriae	S13	ATAGGAGTCACGACGACCAGAA-TCAGCGAGGGCCAATTAGAAGGGTACTCATGTCTGTGGAC-TATGTGCGTCTACCTCTTGACTAAT	87	5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3'	ssDNA	Shigella Dysenteriae	Whole cell	Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification	N/A	8	Fluorescence Binding Assay	N/A	Detection	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0330	23811206	2013	In vitro selection of a DNA aptamer targeted against Shigella dysenteriae	S24	ATAGGAGTCACGACGACCAGAA-CCAGGCGGAATGTGTCTTCGTTTTGCGAGTGTTAAGGGCG-TATGTGCGTCTACCTCTTGACTAAT	87	5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3'	ssDNA	Shigella Dysenteriae	Whole cell	Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification	N/A	8	Fluorescence Binding Assay	N/A	Detection	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1094	30413894	2018	An impedimetric aptasensor for Shigella dysenteriae using a gold nanoparticle-modified glassy carbon electrode	Aptamer	ATAGGAGTCACGACGACCAGAACGGAACTAGCGTTTAAATGCCAGGACTGAAGTAGGCAGGGATTAGTCAAGAGGTAGACGCACATA	87	N/A	ssDNA	Shigella Dysenteriae (PTCC 1188)	Outer membrane protein (OMP)	Developed an impedimetric aptasensor using GCE modified with AuNPs for the detection of S. dysenteriae.	Display linear dynamic range that extends from 10(1) to 10(6) CFU/mL and a limit of detection of 100 CFU/mL.	N/A	N/A	N/A	Biosensor	N/A	5'-Thiolated	N/A	N/A	N/A	N/A	N/A
ABdb_1950	41135162	2026	Silver-decorated nanobeads for high-performance and flexible analysis of Shigella dysenteriae utilizing a paper-based aptasensor	Aptamer	ATAGGAGTCACGACGACCAGAACGGAACTAGCGTTTAAATGCCAGGACTGAAGTAGCAGGGATTAGTCAAGAGGTAGACGCACATA	86	N/A	ssDNA	Shigella Dysenteriae	Whole cell	Developed an Ag/MBs-modified paper-based aptasensor to detect S. dysenteriae.	MB-based assays achieve broad linearity (DPV = 10(2)–10(8) CFU/mL, EIS = 10(1)–10(9) CFU/mL) and high sensitivity (DPV = 90 CFU/mL, EIS = 8.09 CFU/mL).	N/A	N/A	N/A	Biosensor	N/A	5'-Amidation (NH₂)	N/A	Long stability of up to 28 days at 4°C.	N/A	N/A	N/A