Target Organism : Salmonella Paratyphi A

Total records found: 17

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_0232	23698275	2013	Highly specific and cost-efficient detection of Salmonella Paratyphi A combining aptamers with single-walled carbon nanotubes	Apt22	GAATTCAGTCGGACAGCG-ATGGACGAATATCGTCTCCCAGTGAATTCAGTCGGACAGCG-GATGGACGAATATCGTCTCCC	80	5'-GAATTCAGTCGGACAGCG-N40-GATGGACGAATATCGTCTCCC-3'	ssDNA	Salmonella Paratyphi A	Whole cell	Identify aptamers that bind to and detect S. Paratyphi A based on the noncovalent self-assembly of individual SWNTs and DNAzyme-labelled aptamer detection probe.	LOD of the method was 10(3) cfu/mL with a range from 10(3) to 10(7) cfu/mL, and detection signals of target bacteria were 4.4-fold higher than S. Enteritidis, 4.3-fold higher than S. Arizonae, 56.3-fold higher than S. aureus, and 24.3-fold higher than E. coli K88.	17	Fluorescence Spectroscopy	47 ± 3 nM	Biosensor	Whole Cell-SELEX	FITC Labeled	N/A	N/A	Best Candidate	N/A	N/A
ABdb_0233	23698275	2013	Highly specific and cost-efficient detection of Salmonella Paratyphi A combining aptamers with single-walled carbon nanotubes	Apt10	GAATTCAGTCGGACAGCG-GATGATGGACGTATATCGTCTCCCATGAATTCAGTCGGACAGCG-GATGGACGAATATCGTCTCCC	83	5'-GAATTCAGTCGGACAGCG-N40-GATGGACGAATATCGTCTCCC-3'	ssDNA	Salmonella Paratyphi A	Whole cell	Identify aptamers that bind to and detect S. Paratyphi A based on the noncovalent self-assembly of individual SWNTs and DNAzyme-labelled aptamer detection probe.	N/A	17	Fluorescence Spectroscopy	73 ± 9 nM	Biosensor	Whole Cell-SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_0234	23698275	2013	Highly specific and cost-efficient detection of Salmonella Paratyphi A combining aptamers with single-walled carbon nanotubes	Apt 45	GAATTCAGTCGGACAGCG-ATGGACGAATATCGTCTCCCAGTGAATTCAGTCGGACAGC-GATGGACGAATATCGTCTCCC	79	5'-GAATTCAGTCGGACAGCG-N40-GATGGACGAATATCGTCTCCC-3'	ssDNA	Salmonella Paratyphi A	Whole cell	Identify aptamers that bind to and detect S. Paratyphi A based on the noncovalent self-assembly of individual SWNTs and DNAzyme-labelled aptamer detection probe.	N/A	17	Fluorescence Spectroscopy	68 ± 6 nM	Biosensor	Whole Cell-SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_0235	23698275	2013	Highly specific and cost-efficient detection of Salmonella Paratyphi A combining aptamers with single-walled carbon nanotubes	Apt 60	GAATTCAGTCGGACAGCG-CGCCCACCCATAATGGATCAGGGCGGGCACCACGATG-GATGGACGAATATCGTCTCCC	76	5'-GAATTCAGTCGGACAGCG-N40-GATGGACGAATATCGTCTCCC-3'	ssDNA	Salmonella Paratyphi A	Whole cell	Identify aptamers that bind to and detect S. Paratyphi A based on the noncovalent self-assembly of individual SWNTs and DNAzyme-labelled aptamer detection probe.	N/A	17	Fluorescence Spectroscopy	56 ± 9 nM	Biosensor	Whole Cell-SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_0722	https://doi.org/10.1039/C5AY02298C	2015	Highly sensitive fluorescent aptasensor for Salmonella paratyphi A via DNase I-mediated cyclic signal amplification	Apt 10	GATGATGGACGTATATCGTCTCCCATGAATTCAGTCGGACAGCG	44	N/A	ssDNA	Salmonella Paratyphi A	Whole cell	Developed an aptasensor composed of a designed aptamer (DA) and two short FAM-modified sequences (probe 1 and probe 2) for fluorimetric determination of S. paratyphi A via DNase I-mediated cyclic signal amplification.	Obtained a concentration ranging from 1 × 10(2) to 1 × 10(11) cells/mL with a detection limit of 1 × 10(2) cells/mL.	N/A	N/A	N/A	Biosensor	N/A	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_0723	https://doi.org/10.1039/C5AY02298C	2015	Highly sensitive fluorescent aptasensor for Salmonella paratyphi A via DNase I-mediated cyclic signal amplification	Apt 22	ATGGACGAATATCGTCTCCCAGTGAATTCAGTCGGACAGCG	41	N/A	ssDNA	Salmonella Paratyphi A	Whole cell	Developed an aptasensor composed of a designed aptamer (DA) and two short FAM-modified sequences (probe 1 and probe 2) for fluorimetric determination of S. paratyphi A via DNase I-mediated cyclic signal amplification.	Obtained a concentration ranging from 1 × 10(2) to 1 × 10(11) cells/mL with a detection limit of 1 × 10(2) cells/mL.	N/A	N/A	N/A	Biosensor	N/A	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_0724	https://doi.org/10.1039/C5AY02298C	2015	Highly sensitive fluorescent aptasensor for Salmonella paratyphi A via DNase I-mediated cyclic signal amplification	Apt 45	ATGGACGAATATCGTCTCCCAGTGAATTCAGTCGGACAGC	40	N/A	ssDNA	Salmonella Paratyphi A	Whole cell	Developed an aptasensor composed of a designed aptamer (DA) and two short FAM-modified sequences (probe 1 and probe 2) for fluorimetric determination of S. paratyphi A via DNase I-mediated cyclic signal amplification.	Obtained a concentration ranging from 1 × 10(2) to 1 × 10(11) cells/mL with a detection limit of 1 × 10(2) cells/mL.	N/A	N/A	N/A	Biosensor	N/A	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_0725	https://doi.org/10.1039/C5AY02298C	2015	Highly sensitive fluorescent aptasensor for Salmonella paratyphi A via DNase I-mediated cyclic signal amplification	Apt 60	CGCCCACCCATAATGGATCAGGGCGGGCACCACGATG	37	N/A	ssDNA	Salmonella Paratyphi A	Whole cell	Developed an aptasensor composed of a designed aptamer (DA) and two short FAM-modified sequences (probe 1 and probe 2) for fluorimetric determination of S. paratyphi A via DNase I-mediated cyclic signal amplification.	Obtained a concentration ranging from 1 × 10(2) to 1 × 10(11) cells/mL with a detection limit of 1 × 10(2) cells/mL.	N/A	N/A	N/A	Biosensor	N/A	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_0726	https://doi.org/10.1039/C5AY02298C	2015	Highly sensitive fluorescent aptasensor for Salmonella paratyphi A via DNase I-mediated cyclic signal amplification	Apt 1	CGAAGGGGCTATGCCGCCTACATAGACCGTCACGA	35	N/A	ssDNA	Salmonella Paratyphi A	Whole cell	Developed an aptasensor composed of a designed aptamer (DA) and two short FAM-modified sequences (probe 1 and probe 2) for fluorimetric determination of S. paratyphi A via DNase I-mediated cyclic signal amplification.	Obtained a concentration ranging from 1 × 10(2) to 1 × 10(11) cells/mL with a detection limit of 1 × 10(2) cells/mL.	N/A	N/A	N/A	Biosensor	N/A	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_0727	https://doi.org/10.1039/C5AY02298C	2015	Highly sensitive fluorescent aptasensor for Salmonella paratyphi A via DNase I-mediated cyclic signal amplification	Apt 2	GGCCGGCAATACGGCCGAGCCCGGGGTTCCTCCGA	35	N/A	ssDNA	Salmonella Paratyphi A	Whole cell	Developed an aptasensor composed of a designed aptamer (DA) and two short FAM-modified sequences (probe 1 and probe 2) for fluorimetric determination of S. paratyphi A via DNase I-mediated cyclic signal amplification.	Obtained a concentration ranging from 1 × 10(2) to 1 × 10(11) cells/mL with a detection limit of 1 × 10(2) cells/mL.	N/A	N/A	N/A	Biosensor	N/A	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_0728	https://doi.org/10.1039/C5AY02298C	2015	Highly sensitive fluorescent aptasensor for Salmonella paratyphi A via DNase I-mediated cyclic signal amplification	Apt 3	GCCACGCGCAGCAATCAAACCCGGCCCCCTGCTCC	35	N/A	ssDNA	Salmonella Paratyphi A	Whole cell	Developed an aptasensor composed of a designed aptamer (DA) and two short FAM-modified sequences (probe 1 and probe 2) for fluorimetric determination of S. paratyphi A via DNase I-mediated cyclic signal amplification.	Obtained a concentration ranging from 1 × 10(2) to 1 × 10(11) cells/mL with a detection limit of 1 × 10(2) cells/mL.	N/A	N/A	N/A	Biosensor	N/A	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_0729	https://doi.org/10.1039/C5AY02298C	2015	Highly sensitive fluorescent aptasensor for Salmonella paratyphi A via DNase I-mediated cyclic signal amplification	Apt 4	TGGCCAGAGTACGAGTAAGGGAGGTCACAACCTTA	35	N/A	ssDNA	Salmonella Paratyphi A	Whole cell	Developed an aptasensor composed of a designed aptamer (DA) and two short FAM-modified sequences (probe 1 and probe 2) for fluorimetric determination of S. paratyphi A via DNase I-mediated cyclic signal amplification.	Obtained a concentration ranging from 1 × 10(2) to 1 × 10(11) cells/mL with a detection limit of 1 × 10(2) cells/mL.	N/A	N/A	N/A	Biosensor	N/A	N/A	N/A	N/A	Best Candidate	N/A	N/A
ABdb_1405	32810775	2020	Highly adaptable and sensitive FRET-based aptamer assay for the detection of Salmonella paratyphi A	Sal 1	ATTAGTCAAGAGGTAGACGCACATAAGGGGTCTGGTGTCGGGCCGCGGGTCAGGGGGGTAAGGGATTCTGGTCGTCGTGACTCCTAT	87	5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3'	ssDNA	Salmonella Paratyphi A (ATCC 9150)	Whole cell	Identify an aptamer and develop a GO/CdTeQDaptamer-based FRET assay for the detection of Salmonella paratyphi A.	The detection limit was 10 CFU/mL within 15 min with no cross-reactivity with other bacterial species.	11	Indirect ELASA (aptamer linked immunosorbent assay)	N/A	Biosensor	Whole Cell-SELEX	N/A	N/A	N/A	Best Candidate	N/A	N/A
ABdb_1406	32810775	2020	Highly adaptable and sensitive FRET-based aptamer assay for the detection of Salmonella paratyphi A	Sal 2	ATTAGTCAAGAGGTAGACGCACATAAGGAGTCACGACGACCAGAAACGTTTGCGGTGTTGAGCGGTTCTGGTCGTCGTGACTCCTAT	87	5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3'	ssDNA	Salmonella Paratyphi A (ATCC 9150)	Whole cell	Identify an aptamer and develop a GO/CdTeQDaptamer-based FRET assay for the detection of Salmonella paratyphi A.	The detection limit was 10(3) CFU/mL.	11	Indirect ELASA (aptamer linked immunosorbent assay)	N/A	Biosensor	Whole Cell-SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1407	32810775	2020	Highly adaptable and sensitive FRET-based aptamer assay for the detection of Salmonella paratyphi A	Sal 3	ATTAGTCAAGAGGTAGACGCACATAACGGCGGCAGCGAGGGCGAACCAGGGGGGGCACACCGAGCTTCTGGTCGTCGTGACTCCTAT	87	5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3'	ssDNA	Salmonella Paratyphi A (ATCC 9150)	Whole cell	Identify an aptamer and develop a GO/CdTeQDaptamer-based FRET assay for the detection of Salmonella paratyphi A.	N/A	11	Indirect ELASA (aptamer linked immunosorbent assay)	N/A	Biosensor	Whole Cell-SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1408	32810775	2020	Highly adaptable and sensitive FRET-based aptamer assay for the detection of Salmonella paratyphi A	Sal 4	ATTAGTCAAGAGGTAGACGCACATAAGTATTTAGCGAACTCGCGGAGGTTCAGTAAAGAATGTACTTCTGGTCGTCGTGACTCCTAT	87	5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3'	ssDNA	Salmonella Paratyphi A (ATCC 9150)	Whole cell	Identify an aptamer and develop a GO/CdTeQDaptamer-based FRET assay for the detection of Salmonella paratyphi A.	N/A	11	Indirect ELASA (aptamer linked immunosorbent assay)	N/A	Biosensor	Whole Cell-SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1409	32810775	2020	Highly adaptable and sensitive FRET-based aptamer assay for the detection of Salmonella paratyphi A	Sal 5	ATTAGTCAAGAGGTAGACGCACATAGCCACTCGACCCGCCAGAAACGGCGACAGGATGGCCGCGGTTCTGGTCGTCGTGACTCCTAT	87	5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3'	ssDNA	Salmonella Paratyphi A (ATCC 9150)	Whole cell	Identify an aptamer and develop a GO/CdTeQDaptamer-based FRET assay for the detection of Salmonella paratyphi A.	N/A	11	Indirect ELASA (aptamer linked immunosorbent assay)	N/A	Biosensor	Whole Cell-SELEX	N/A	N/A	N/A	N/A	N/A	N/A