Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 1
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_1125 | 33418673 | 2018 | Fast and Sensitive Detection of Salmonella in Milk Samples Using Aptamer-Functionalized Magnetic Silica Solid Phase and MCM-41-Aptamer Gate System | S. enterica specific aptamer | TATGGCGGCGTCACCCGACGGGGACTT | 27 | N/A | ssDNA | Salmonella Enterica | Whole cell | Developed an aptamer-gated MCM-41 silica system (Fe3O4@SiO2@pGMA and MCM-41 particles) to detect S. enterica in food samples. | The linear range is from 2000 CFU/mL to 104 CFU/mL in milk, with the LOD of 2336 cells. | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |