Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 117
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0105 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F23 | ATACCAGCTTATTCAATT-CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | F23 showed great specificity to P. aeruginosa and no cross-reactivity with other bacterial species. | 15 | Flow Cytometry | 17.27 ± 5.00 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0106 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F12 | ATACCAGCTTATTCAATT-CCCCCGTTGCTTTCGCTTTTCCTTTTGCTTTTGTTCGCTTCGTCCCTGCTTCCTTTCTTG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0107 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F8 | ATACCAGCTTATTCAATT-CCGTGGCGTTCTGTTTGTTCGTTGTTTTTTGGTTTTTCCTTCTTTTTTTGTTTTTGGTTG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0108 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F1 | ATACCAGCTTATTCAATT-GGCGCGCGTTGTGTGGTTTGGCTTTTTTCGTTTGTTTTTCTTGGGTGCTTGTCTTCGTTG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0109 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F20 | ATACCAGCTTATTCAATT-CCCTCGCCGTACGTTCTCCGTTTTGTCAGGTGTTGTTTTTTCCGTCCTCTTCTCGTGTGC-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0110 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F4 | ATACCAGCTTATTCAATT-CCACCGATTCCCTTCGATCGTATTCGTGTTGCTCTCGTGTTGTAATGCGTCCTGTGCTTG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0111 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F6 | ATACCAGCTTATTCAATT-GGCACCGGCTTGTCTGTTTCTCTTGGTTCGCCGCTGGACTTTGTTAGCTCCCTCCGCTTG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0112 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F7 | ATACCAGCTTATTCAATT-CCCCACAACCTGACCTTTCTATTCCGTTCCCCTTTTTTCAGCTTCTTTCCGGCCTCTGTT-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0113 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F18 | ATACCAGCTTATTCAATT-CCACCACCGGGTTGTTTTTCCTGCAGGCCTTTATCGTTTTCCGCGCTCGATTCGGTCATG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0114 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F5 | ATACCAGCTTATTCAATT-CCACCGTGCTTTATATTACCCGTCCACCCTTCGGTCTTTCTCCCCGTGTCGCTCCGCTTT-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0115 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F21 | ATACCAGCTTATTCAATT-CCACCGGGCCTCGTATTCGTACTGTTTGATTCTTTGGCTTTGTAGCGGACGTACTGGGTG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0116 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F2 | ATACCAGCTTATTCAATT-CCCCCGCGCCCGTCTCTCTCAATCTCCGCATTCTTTAGTTCTCATCCTCCCTGTGTGTTT-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0117 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F24 | ATACCAGCTTATTCAATT-GACACCCGGAGTAATTCCGTTTTAAGCGTCTTTCATGTGTTCCCTTTCGTTCCTCCCTTG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0118 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F15 | ATACCAGCTTATTCAATT-CCCAAGGTCGAGTTCCTAGTCTTACCGTATTTCACTTTCCTGGTTCTTACCTCCCCCTCA-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0119 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F22 | ATACCAGCTTATTCAATT-CGGCGCGAGTCGACTGCACAGGGTCCTATTGCTTATGGTCATGGTTTCGTTTCATCCTCG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0120 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F16 | ATACCAGCTTATTCAATT-CCCGCGATATGACCATCCAGCTGCTCCTCTGTTATTGTTGGTTTTCCTGTTTTCCTTTGT-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0121 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F17 | ATACCAGCTTATTCAATT-CCCCAGTGCTCAGCTTCTCCTCCGTCTCATTCTTCTGTAGGATCGTTCTGTTTTGGTACT-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | 57.63 ± 11.64 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0122 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F10 | ATACCAGCTTATTCAATT-CCCACCGTCCTCGTGCTTAGTCTTTATGTTTCGTCCTTTTCTTTCTTCGTTCTGTCGCCT-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0242 | https://doi.org/10.1007/s12257-012-0556-6 | 2013 | Screening and anti-virulent study of N-acyl homoserine lactones DNA aptamers against Pseudomonas aeruginosa quorum sensing | ALSap 1 | GCAATGGTACGGTACTTCC-CAACCCCGTCTATCACGTCGCTCTTGCGTTGGTTG-CAAAAGTGCACGCTACTTTGCTAA | 78 | 5'-GCAATGGTACGGTACTTCC-N35-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Amino lactam surrogate (ALS) of N-acyl homoserine lactone (HSL) | DNA aptamers that bind specifically to HSL and show strong inhibitory activity on biofilm formation. | N/A | 14 | Enzyme-Linked Immunosorbent Assay (ELISA) | 7.5 ~ 10 nM (for ALS) | Therapeutics | SELEX | N/A | Aptamers had no influence on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_0243 | https://doi.org/10.1007/s12257-012-0556-6 | 2013 | Screening and anti-virulent study of N-acyl homoserine lactones DNA aptamers against Pseudomonas aeruginosa quorum sensing | ALSap 2 | GCAATGGTACGGTACTTCC-CAACCCCGTCTATCACGTCGCTGTTGCGTTGGTTG-CAAAAGTGCACGCTACTTTGCTAA | 78 | 5'-GCAATGGTACGGTACTTCC-N35-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Amino lactam surrogate (ALS) of N-acyl homoserine lactone (HSL) | DNA aptamers that bind specifically to HSL and show strong inhibitory activity on biofilm formation. | N/A | 14 | Enzyme-Linked Immunosorbent Assay (ELISA) | 7.5 ~ 10 nM (for ALS) | Therapeutics | SELEX | N/A | Aptamers had no influence on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_0244 | https://doi.org/10.1007/s12257-012-0556-6 | 2013 | Screening and anti-virulent study of N-acyl homoserine lactones DNA aptamers against Pseudomonas aeruginosa quorum sensing | ALSap 3 | GCAATGGTACGGTACTTCC-CGCCGCCGCGTTCTCATCGCGTGATGTAGTGTCCG-CAAAAGTGCACGCTACTTTGCTAA | 78 | 5'-GCAATGGTACGGTACTTCC-N35-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Amino lactam surrogate (ALS) of N-acyl homoserine lactone (HSL) | DNA aptamers that bind specifically to HSL and show strong inhibitory activity on biofilm formation. | N/A | 14 | Enzyme-Linked Immunosorbent Assay (ELISA) | 17.5 ~ 20 nM (for ALS) and 30 ~ 35 nM (for 3O-C12-HSL) | Therapeutics | SELEX | N/A | Aptamers had no influence on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_0245 | https://doi.org/10.1007/s12257-012-0556-6 | 2013 | Screening and anti-virulent study of N-acyl homoserine lactones DNA aptamers against Pseudomonas aeruginosa quorum sensing | ALSap 4 | GCAATGGTACGGTACTTCC-CGCCGGCTTCTCTTGCCGTGATGTAGTGTCCG-CAAAAGTGCACGCTACTTTGCTAA | 75 | 5'-GCAATGGTACGGTACTTCC-N35-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Amino lactam surrogate (ALS) of N-acyl homoserine lactone (HSL) | DNA aptamers that bind specifically to HSL and show strong inhibitory activity on biofilm formation. | N/A | 14 | Enzyme-Linked Immunosorbent Assay (ELISA) | 15 nM (for ALS) and 20 ~ 25 nM (for 3O-C12-HSL) | Therapeutics | SELEX | N/A | Aptamers had no influence on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_0246 | https://doi.org/10.1007/s12257-012-0556-6 | 2013 | Screening and anti-virulent study of N-acyl homoserine lactones DNA aptamers against Pseudomonas aeruginosa quorum sensing | ALSap 5 | GCAATGGTACGGTACTTCC-CGGGGCCCGCTTCTGGTGCGGTGTACTAGTGACCG-CAAAAGTGCACGCTACTTTGCTAA | 78 | 5'-GCAATGGTACGGTACTTCC-N35-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Amino lactam surrogate (ALS) of N-acyl homoserine lactone (HSL) | DNA aptamers that bind specifically to HSL and show strong inhibitory activity on biofilm formation. | ALSap-5 at 0.5 µM, about 90% of biofilm, 50.9% reduced pyocyanin secretions, as well as secretions of LasA protease and LasB elastase were inhibited. | 14 | Enzyme-Linked Immunosorbent Assay (ELISA) | 10 ~ 12.5 nM (for ALS) and 20 nM (for 3O-C12-HSL) | Therapeutics | SELEX | N/A | Aptamers had no influence on bacterial growth. | N/A | Best Candidate | N/A | N/A |
| ABdb_0247 | https://doi.org/10.1007/s12257-012-0556-6 | 2013 | Screening and anti-virulent study of N-acyl homoserine lactones DNA aptamers against Pseudomonas aeruginosa quorum sensing | ALSap 6 | GCAATGGTACGGTACTTCC-CGGGGCGGGCTGTCATGCCCATCCTACCGTGACCG-CAAAAGTGCACGCTACTTTGCTAA | 78 | 5'-GCAATGGTACGGTACTTCC-N35-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Amino lactam surrogate (ALS) of N-acyl homoserine lactone (HSL) | DNA aptamers that bind specifically to HSL and show strong inhibitory activity on biofilm formation. | N/A | 14 | Enzyme-Linked Immunosorbent Assay (ELISA) | 15 ~ 17.5 nM (for ALS) and 45 ~ 50 nM (for C4-HSL) | Therapeutics | SELEX | N/A | Aptamers had no influence on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_0248 | https://doi.org/10.1007/s12257-012-0556-6 | 2013 | Screening and anti-virulent study of N-acyl homoserine lactones DNA aptamers against Pseudomonas aeruginosa quorum sensing | ALSap 7 | GCAATGGTACGGTACTTCC-CGGGGCGGCCTGTGTTGGCCTACCTAGCGAGACCG-CAAAAGTGCACGCTACTTTGCTAA | 78 | 5'-GCAATGGTACGGTACTTCC-N35-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Amino lactam surrogate (ALS) of N-acyl homoserine lactone (HSL) | DNA aptamers that bind specifically to HSL and show strong inhibitory activity on biofilm formation. | N/A | 14 | Enzyme-Linked Immunosorbent Assay (ELISA) | 12.5 ~ 15 nM (for ALS) and 35 ~ 40 nM (for C4-HSL) | Therapeutics | SELEX | N/A | Aptamers had no influence on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_0249 | https://doi.org/10.1007/s12257-012-0556-6 | 2013 | Screening and anti-virulent study of N-acyl homoserine lactones DNA aptamers against Pseudomonas aeruginosa quorum sensing | ALSap 8 | GCAATGGTACGGTACTTCC-CGCTGCCCCCTGTCCTGGGTTAGCTAGCGAGAGCG-CAAAAGTGCACGCTACTTTGCTAA | 78 | 5'-GCAATGGTACGGTACTTCC-N35-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Amino lactam surrogate (ALS) of N-acyl homoserine lactone (HSL) | DNA aptamers that bind specifically to HSL and show strong inhibitory activity on biofilm formation. | 86% of pyocyanin secretion was inhibited by 6 µM of ALSap-8, and biofilm formation, and the secretions of LasA protease and LasB elastase were also decreased by 9.3%, 17.5%, and 19% respectively. | 14 | Enzyme-Linked Immunosorbent Assay (ELISA) | 10 nM (for ALS) and 25 ~ 30 nM (for C4-HSL) | Therapeutics | SELEX | N/A | Aptamers had no influence on bacterial growth. | N/A | Best Candidate | N/A | N/A |
| ABdb_0321 | https:doi.org10.1007s13765-013-3019-7 | 2013 | Potential of fluorophore labeled aptamers for Pseudomonas aeruginosa detection in drinking water | P.aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 10145) | Whole cell | Develop a fluorophore-labelled aptamer to detect P. aeruginosa in drinking water. | The limit of detection for P. aeruginosa was 5.07 cells/mL, with a linear dynamic range of 5.64 to 100 cells/mL. | N/A | N/A | N/A | Biosensor | N/A | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0656 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.33 | TGTACCGTCTGAGCGATTCGTAC-CATAGGGTGCTTTTCAAGGCCACACGTTAGTGTA-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | 100 nM or 6.6 μg/mL of Exotoxin A in human serum was detected. | 14 | Surface Plasmon Resonance (SPR) | 4.2 and 4.5 μM | Diagnostic | Decoy-SELEX | 5'-Amidation (NH₂-(CH2)6) and 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0657 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.02 | TGTACCGTCTGAGCGATTCGTAC-TACGCCACACGTGGTGAGGGATTCGATCGCTTGA-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0658 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.20 | TGTACCGTCTGAGCGATTCGTAC-TGCTATTCATCACCACTCTAGAGCCACTTTTAAA-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0659 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.22 | TGTACCGTCTGAGCGATTCGTAC-TGGGCGGCGAGCCACCCGGCAATTTAGTACAGGC-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0660 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.36 | TGTACCGTCTGAGCGATTCGTAC-AAAGCATCCAGCCGGTATGTGCCAGAGTCTCTGA-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0661 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.38 | TGTACCGTCTGAGCGATTCGTAC-AAATGTGAGTGGCCAGGCATCAGGTACGTCGGTA-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0662 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.03 | TGTACCGTCTGAGCGATTCGTAC-GGATAGGTGCCTCTGCTTCATCATGTTGAACTTA-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0663 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.13 | TGTACCGTCTGAGCGATTCGTAC-AGTTTCACCAGTCGCCTGTTAGCCGTGATATACG-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0664 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.27 | TGTACCGTCTGAGCGATTCGTAC-TGTCAATATTACGTTGCTCTTAGGTTCACCATCT-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0665 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.28 | TGTACCGTCTGAGCGATTCGTAC-TTGTGATTCAAATAGGCGTGTTGGTGTGAGACCT-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0666 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.23 | TGTACCGTCTGAGCGATTCGTAC-CGTGGATCATGCTTCGCGTCGGTTTATAGGTTCC-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0667 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.39 | TGTACCGTCTGAGCGATTCGTAC-AGAAGAGCATCGGTAACTTCCATAGGAGATGGGG-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0668 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.06 | TGTACCGTCTGAGCGATTCGTAC-CATCCGAGGGTATTGTATGCGTATATCCTAGTCG-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0669 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.10 | TGTACCGTCTGAGCGATTCGTAC-CAAGTTCCTCATGGAGGGTGCTCAGAGCTTAGAC-AGCCAGTCAGTGTTAAGGAGTAA | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0670 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.34 | TGTACCGTCTGAGCGATTCGTAC-AGGGGGATTCCTAGGGCCCGGCCCAACGCTGTTT-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0671 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.42 | TGTACCGTCTGAGCGATTCGTAC-CAAGACCCTTGAATCACGGGTAGGGTCTCGTAAC-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0674 | 25476286 | 2015 | Aptamer-functionalized localized surface plasmon resonance sensor for the multiplexed detection of different bacterial species | Pae-apt | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 15692) | Whole cell | The aptamer-immobilized LSPR sensor was developed for bacteria detection. | Showed a detection limit of 30 cfu per assay. | N/A | N/A | 17.27 ± 5 nM | Biosensor | N/A | 3'-Thiolated (SH-(CH2)3) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0834 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | JN08 | ATGAGAGCGTCGGTGTGGTAACTTAATCCTCTAGTTTTAATTCTAGATACGGCGCATGCACTCTATGTAGGAGGGTGCGGAAGTA | 85 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 54.9 ± 7.8 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0835 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | JN27 | ATGAGAGCGTCGGTGTGGTAACTAGTCTGATTTCTATTTCCTTTAATTAGTCTGCACACATTGCATTGTAGGAGGGTGCGGAAGTA | 86 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 28.5 ± 4.9 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0836 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | JN27.SH | TAATTAGTCTGCACACATTGCATTGTAGGAGGGTGCGGAAGTA | 43 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 26.9 ± 5.6 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0837 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | JN08.SH | ATGCACTCTATGTAGGAGGGTGCGGA | 26 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 52.9 ± 10.4 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0838 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | JN17.SH | ATCCTCCTATCTATCGGTAGTTGTAGGAGGGTGCGG | 36 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 29 ± 7.3 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0839 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | JN21.SH | AGAGCGTCGGTGTGGTAACTGTTCAGGAGGATGACATTGTCGCCT | 45 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 18.1 ± 3.4 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0840 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | St17Lp21 | ATCCTCCTAGGTAACTGTTCAGGATGTAGGAGGGT | 35 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 16.9 ± 3.9 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0841 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | St21Lp17 | AAGCGTCGGTGTTCTATCGGTAGTTGACACCGACGCCT | 38 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 13.5 ± 2 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0842 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | St08Lp17 | ATGCACTCTTCTATCGGTAGTTGAGGGTGCGG | 32 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 12.5 ± 2.4 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0918 | 28119514 | 2017 | High Efficiency Binding Aptamers for a Wide Range of Bacterial Sepsis Agents | Antibac1 | TCGCGCGAGTCGTCTG-GGGACAGGGAGTGCGCTGCTCCCC-CCGCATCGTCCTCCC | 55 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922), Klebsiella Pneumoniae (ATCC 27853), Proteus Mirabilis (ATCC 00557), Pseudomonas Aeruginosa (ATCC 700603), Staphylococcus aureus (S. aureus) (ATCC 29213), Streptococcus Pneumoniae (ATCC 23855), and Enterococcus Faecium (ATCC 29212), and Proteus Vulgaris, Morganella Morganii, Citrobacter Freundii, and Acinetobacter Baumannii | Peptidoglycan | Develop generic probes as biological recognition elements in biosensors for sepsis diagnosis in the clinical setting. | Antibac1 bound with higher efficiency to both gram-positive (S. aureus, S. penumoniae, L. monocytogenes) and gram-negative (A. baumannii, C. freudii, K. pneumoniae, P. aeruginosa, P. mirabilis). | N/A | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 268.50 ± 54.34 nM (for A. baumannii); 51.74 ± 11.75 nM (for L. monocytogenes); 31.82 ± 4.38 nM (for E.coli); 170.10 ± 32.13 nM (for S.aureus) and 256.10 ± 47.89 nM (for K. pneumoniae) | Diagnostic | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0919 | 28119514 | 2017 | High Efficiency Binding Aptamers for a Wide Range of Bacterial Sepsis Agents | Antibac2 | TCGCGCGAGTCGTCTG-GGGGACTAGAGGACTTGTGCGGCC-CCGCATCGTCCTCCC | 55 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922), Klebsiella Pneumoniae (ATCC 27853), Proteus Mirabilis (ATCC 00557), Pseudomonas Aeruginosa (ATCC 700603), Staphylococcus aureus (S. aureus) (ATCC 29213), Streptococcus Pneumoniae (ATCC 23855), and Enterococcus Faecium (ATCC 29212), and Proteus Vulgaris, Morganella Morganii, Citrobacter Freundii, and Acinetobacter Baumannii | Peptidoglycan | Develop generic probes as biological recognition elements in biosensors for sepsis diagnosis in the clinical setting. | Antibac2 bound with higher efficiency to the gram-positive species S. aureus and E. faecium and to the gram-negative species (A. baumannii, C. freudii, K. pneumoniae, M. moraganii, P. aeruginosa, P. mirabilis, and E. coli). | N/A | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 71.92 ± 9.74 nM (for A. baumannii); 54.19 ± 12.09 nM (for L. monocytogenes); 62.43 ± 11.97 nM (for E.coli); 194.90 ± 38.55 nM (for S.aureus) and 195.90 ± 42.91 nM (for K. pneumoniae) | Diagnostic | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0950 | https://doi.org/10.1007/s00604-017-2142-2 | 2017 | A magnetic relaxation switch aptasensor for the rapid detection of Pseudomonas aeruginosa using superparamagnetic nanoparticles | Aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Develop a magnetic relaxation switch (MRSw) aptasensor (SPIO-aptamer) for the determination of Pseudomonas aeruginosa in real food and drinking water samples. | Exhibit a linear range from 10(0) cfu/mL to 10(6) cfu/mL, and a detection limit of 50 cfu/mL was obtained within 40 mins. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1021 | 29098517 | 2018 | Influence of aptamer-targeted antibiofilm agents for treatment of Pseudomonas aeruginosa biofilms | PA-ap1 (F23) | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Aptamer-ciprofloxacin-SWNTs complex for antibiofilm activity. | 90% inhibitory efficiency of complex aptamer-ciprofloxacin-SWNTs on biofilm formation. | 16 | Flow Cytometry | 17.27 ± 5.00 nM | Targeted Delivery/Therapeutics | Whole Cell-SELEX | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1072 | 30014163 | 2018 | Selective capture and sensitive fluorometric determination of Pseudomonas aeruginosa by using aptamer modified magnetic nanoparticles | P. aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa | Whole cell | A fluorometric assay for the detection of the food pathogen P. aeruginosa based on hybridization of aptamer and FAM-cDNA (aptamer&FAM-cDNA@MNPs). | Display a linear range between 10 and 10(8) cfu/mL, with a detection limit as low as 1 cfu/mL. The detection process can be finished within <1.5 h. | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1073 | 29260861 | 2018 | Whole-Cell Pseudomonas aeruginosa Localized Surface Plasmon Resonance Aptasensor | Bt-aptamer | ATACCAGCTTATTCAATTCCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTGAGATAGTAAGTGCAATCT | 96 | N/A | ssDNA | Pseudomonas Aeruginosa PAO1 | Whole cell | A localized surface plasmon resonance (LSPR) based sensing platform was developed to detect the whole-cell Pseudomonas aeruginosa strain PAO1. | Achieve a limit of detection (LOD) of 10 cfu/mL with a linear range of 10(0)–10(3) cfu/mL. | N/A | N/A | 17.27 ± 5.00 nM | Biosensor | Whole Cell-SELEX | 5′-Biotinylated Polyethene Glycol (Bt-PEG) thiol/PEG thiol (1:3) or 5'-6FAM-aptamer-Biotin-3' | N/A | Stable in ambient conditions for ≥2 months. | N/A | N/A | N/A |
| ABdb_1074 | 30247907 | 2018 | Graphene Oxide Quantum Dots Assisted Construction of Fluorescent Aptasensor for Rapid Detection of Pseudomonas aeruginosa in Food Samples | P.aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 15442) | Whole cell | Develop a fluorescent aptasensor based on DNA hybridization and fluorescence resonance energy transfer for the detection of P. aeruginosa. | Shows a wide linear range of 1.28 × 10(3)-2.00 × 10(7) cfu/mL with a detection limit of 100 cfu/mL within 2 h. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1075 | 35547676 | 2018 | Development of a fluorescence assay for highly sensitive detection of Pseudomonas aeruginosa based on an aptamer-carbon dots/graphene oxide system | PA1 | TGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGACGTGACCGCTGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGAC | 84 | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify and develop an aptamer-based fluorescence assay (aptamer-CDs/GO system) for culture-independent detection of P. aeruginosa. | Achieved a wide detection range from 10(1) to 10(7) CFU/mL with a detection limit as low as 9 CFU/mL. | 12 | N/A | 15.16 ± 3.62 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1076 | 35547676 | 2018 | Development of a fluorescence assay for highly sensitive detection of Pseudomonas aeruginosa based on an aptamer-carbon dots/graphene oxide system | PA2 | TGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGACGTGACCGTTGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGAC | 84 | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify and develop an aptamer-based fluorescence assay (aptamer-CDs/GO system) for culture-independent detection of P. aeruginosa. | N/A | 12 | N/A | 14.11 ± 2.59 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1077 | 35547676 | 2018 | Development of a fluorescence assay for highly sensitive detection of Pseudomonas aeruginosa based on an aptamer-carbon dots/graphene oxide system | PA3 | TGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGACACGACGCATGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGAC | 84 | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify and develop an aptamer-based fluorescence assay (aptamer-CDs/GO system) for culture-independent detection of P. aeruginosa. | N/A | 12 | N/A | 32.59 ± 8.89 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1078 | 35547676 | 2018 | Development of a fluorescence assay for highly sensitive detection of Pseudomonas aeruginosa based on an aptamer-carbon dots/graphene oxide system | PA4 | TGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGACGCACGTTGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGAC | 82 | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify and develop an aptamer-based fluorescence assay (aptamer-CDs/GO system) for culture-independent detection of P. aeruginosa. | N/A | 12 | N/A | 16.39 ± 8.14 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1079 | 35547676 | 2018 | Development of a fluorescence assay for highly sensitive detection of Pseudomonas aeruginosa based on an aptamer-carbon dots/graphene oxide system | PA5 | TGGACCTTGCGATTGACAGCTCGTGGCACGTGCCGCTCGCCTTGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGAC | 80 | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify and develop an aptamer-based fluorescence assay (aptamer-CDs/GO system) for culture-independent detection of P. aeruginosa. | N/A | 12 | N/A | 30.69 ± 7.15 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1082 | https://doi.org/10.1002/slct.201801008 | 2018 | Exploiting Stokes and anti-Stokes type emission profiles of aptamer-functionalized luminescent nanoprobes for multiplex sensing applications | P. aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | aptamer-functionalized QD and UCNP nanoprobes that were conjugated with partially complementary DNA-modified magnetic beads for separation. | The limit of detection was 25 cfu/mL for P. aeruginosa with a linear range from 10(2)-10(6) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1220 | 30779754 | 2019 | C4-HSL aptamers for blocking quorum sensing and inhibiting biofilm formation in Pseudomonas aeruginosa and its structure prediction and analysis | A16 | CCATCCACACTCCGCAAGTGGGGAGGGGAGAGACGACGATCCTGTGGGTTTTCTGCAGTGAGTCGTGTTTTCGACTTATTGCGTCGGCTGCCTCTACAT | 99 | 5'-CCATCCACACTCCGCAAG-N30-TTTT-hybridsequence-TTTT-N10-CGTCGGCTGCCTCTACAT-3' | ssDNA | Pseudomonas Aeruginosa | C4-HSL of the rhl system quorum sensing molecule | Identify aptamers that inhibit biofilm formation and quorum sensing. | Biofilm formation by P. aeruginosa was reduced by about 1/3. | 10 | Saturation Binding Assay | 28.47 nM | Therapeutics | Structure Switching SELEX | N/A | Aptamers caused no effect on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_1221 | 30779754 | 2019 | C4-HSL aptamers for blocking quorum sensing and inhibiting biofilm formation in Pseudomonas aeruginosa and its structure prediction and analysis | A46 | CCATCCACACTCCGCAAGTATGAGGACAGTTGGAGGGCGCGCCGTGTTTTTTCTGCAGTGAGTCGTGTTTCCTCGCTCACGCGTCGGCTGCCTCTACAT | 99 | 5'-CCATCCACACTCCGCAAG-N30-TTTT-hybridsequence-TTTT-N10-CGTCGGCTGCCTCTACAT-3' | ssDNA | Pseudomonas Aeruginosa | C4-HSL of the rhl system quorum sensing molecule | Identify aptamers that inhibit biofilm formation and quorum sensing. | Biofilm formation by P. aeruginosa was reduced by about 1/3. | 10 | Saturation Binding Assay | N/A | Therapeutics | Structure Switching SELEX | N/A | Aptamers caused no effect on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_1222 | 30779754 | 2019 | C4-HSL aptamers for blocking quorum sensing and inhibiting biofilm formation in Pseudomonas aeruginosa and its structure prediction and analysis | A1 | CCATCCACACTCCGCAAGTTTTAGGAGTAGTGGTGTGGGGACCGACTCTTTTCTGCAGTGAGTCGTGTTTTCGAGTCATCCCGTCGGCTGCCTCTACAT | 99 | 5'-CCATCCACACTCCGCAAG-N30-TTTT-hybridsequence-TTTT-N10-CGTCGGCTGCCTCTACAT-3' | ssDNA | Pseudomonas Aeruginosa | C4-HSL of the rhl system quorum sensing molecule | Identify aptamers that inhibit biofilm formation and quorum sensing. | Biofilm formation by P. aeruginosa was reduced by about 1/3. | 10 | Saturation Binding Assay | N/A | Therapeutics | Structure Switching SELEX | N/A | Aptamers caused no effect on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_1223 | 30779754 | 2019 | C4-HSL aptamers for blocking quorum sensing and inhibiting biofilm formation in Pseudomonas aeruginosa and its structure prediction and analysis | A2 | CCATCCACACTCCGCAAGTGAGATGTGGTGTAGGCAACTCGGCATAGATTTTCTGCAGTGAGTCGTGTTTTTTGACACGGCCGTCGGCTGCCTCTACAT | 99 | 5'-CCATCCACACTCCGCAAG-N30-TTTT-hybridsequence-TTTT-N10-CGTCGGCTGCCTCTACAT-3' | ssDNA | Pseudomonas Aeruginosa | C4-HSL of the rhl system quorum sensing molecule | Identify aptamers that inhibit biofilm formation and quorum sensing. | Biofilm formation by P. aeruginosa was reduced by about 1/3. | 10 | Saturation Binding Assay | N/A | Therapeutics | Structure Switching SELEX | N/A | Aptamers caused no effect on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_1224 | 30637436 | 2019 | Aptamer-mediated colorimetric and electrochemical detection of Pseudomonas aeruginosa utilizing peroxidase-mimic activity of gold NanoZyme | F23 | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Aptamer-mediated tunable NanoZyme colorimetric and electrochemical sensors for the detection of Pseudomonas aeruginosa. | Possess a detection limit of the electrochemical sensor of ~ 60 CFU/mL in water within 10 min. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1227 | 30877887 | 2019 | A new aptamer/polyadenylated DNA interdigitated gold electrode piezoelectric sensor for rapid detection of Pseudomonas aeruginosa | P. aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Developed a piezoelectric sensor (Au IDE-MSPQC) based on magnetic bead/aptamer/polyadenylated-DNA for the detection of P. aeruginosa. | The limits of detection (LOD) of the method were as low as 9 CFU/mL in buffer and 52 CFU/mL in a simulated blood sample. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (Biotin-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1230 | 31472413 | 2019 | Vertical capacitance aptasensors for real-time monitoring of bacterial growth and antibiotic susceptibility in blood | P. aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Vertical-type aptamer-functionalized sensor (aptasensor) for monitoring bacterial growth and antibiotic susceptibility in blood in real-time. | Detect bacteria growth in blood at 10(0)-10(3) CFU/mL in real-time within 12 hours and the MIC for S. aureus was approximately 1 and 0.1 μg/mL for gentamicin and amikacin, respectively, | N/A | N/A | N/A | Biosensor | N/A | 3'-Thiolated (SH-(CH2)3) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1232 | https:doi.org10.1039C9AY01509D | 2019 | A nano-sized chitosan particle based electrochemical aptasensor for sensitive detection of P. aeruginosa | P.aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa | Whole cell | Develop an aptasensor based on a glassy carbon electrode (GCE) modified with nano-sized chitosan particles (NCs) for sensitive and simultaneous detection of P. aeruginosa. | Displayed a low detection limit of 3 CFU/mL, wide linearity of 10(1)–10(7) CFU/mL and a recovery rate from 93.2% to 124%. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1233 | https://doi.org/10.1021/acssuschemeng.9b01314 | 2019 | Development of a Sensitive Diagnostic Device Based on Zeolitic Imidazolate Frameworks-8 Using Ferrocene–Graphene Oxide as Electroactive Indicator for Pseudomonas aeruginosa Detection | P.aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa | Whole cell | An electrochemical biosensor (Fc-GO/Apt/HZIFs-8/GCE ) based on aptamers immobilized in engineered zeolitic imidazolate Framework-8 (ZIFs-8) for the detection of P. aeruginosa in human urine samples. | Exhibits a wide linear dynamic range (from 1.2 × 10(1) to 1.2 × 10(7) CFU/mL) with a low detection limit of 1 CFU/mL. | N/A | N/A | N/A | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1234 | 31362188 | 2019 | Dual-aptamers labeled polydopamine-polyethyleneimine copolymer dots assisted engineering a fluorescence biosensor for sensitive detection of Pseudomonas aeruginosa in food samples | P. aeruginosa aptamer1 | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 15442) | Whole cell | A dual aptamer labelled PDA-PEI copolymer dots-based biosensor for detection and quantification of P. aeruginosa. | The LOD of P. aeruginosa is as low as 1 cfu/mL with a linear range from 10(1)–10(7) cfu/mL in 1.5h. | N/A | N/A | N/A | Biosensor | N/A | 5'-COOH (Carboxylated) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1235 | 31362188 | 2019 | Dual-aptamers labeled polydopamine-polyethyleneimine copolymer dots assisted engineering a fluorescence biosensor for sensitive detection of Pseudomonas aeruginosa in food samples | P. aeruginosa aptamer2 | ATGCACTCTTCTATCGGTAGTTGAGGGTGCGG | 32 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 15442) | Whole cell | A dual aptamer labelled PDA-PEI copolymer dots-based biosensor for detection and quantification of P. aeruginosa. | The LOD of P. aeruginosa is as low as 1 cfu/mL with a linear range from 10(1)–10(7) cfu/mL in 1.5h. | N/A | N/A | N/A | Biosensor | N/A | 5'-COOH (Carboxylated) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1236 | 31279171 | 2019 | A novel enzyme-free electrochemical biosensor for rapid detection of Pseudomonas aeruginosa based on high catalytic Cu-ZrMOF and conductive Super P | P-aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Develop a Cu-ZrMOF@Aptamer@DNA nanocomposite-based enzyme-free electrochemical biosensor to detect P. aeruginosa. | Exhibit a wide linearity range of 10-10(6) CFU/mL and a low limit of detection of 2 CFU/mL within 120 min. | N/A | N/A | N/A | Biosensor | N/A | 5'-Phosphate | N/A | The biosensor had acceptable storage stability (98.1% and 83.9%) within 7 days of storage at 4°C. | N/A | N/A | N/A |
| ABdb_1237 | 31655899 | 2019 | Impedimetric aptasensor for Pseudomonas aeruginosa by using a glassy carbon electrode modified with silver nanoparticles | P.aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa | Whole cell | Develop an aptasensor based on an immobilised NH2-aptamer that was covalently attached to the AgNP/GCE surface for the detection of P. aeruginosa. | The impedance increases on going from 10(2) to 10(7) CFU/mL concentrations of P. aeruginosa, and the detection limit is 33 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1247 | 30771102 | 2019 | Fluorometric determination of lipopolysaccharides via changes of the graphene oxide-enhanced fluorescence polarization caused by truncated aptamers | LA27 | CCTTCTAACAGAATGTTGTTAGATAGC | 27 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium), Escherichia Coli (E. Coli) 055:B5 and Pseudomonas Aeruginosa 10 | Lipopolysaccharide (LPS) | Developed an aptamer-based graphene oxide-based fluorescence polarization assay to detect LPSs from S. typhimurium, P. aeruginosa 10 and E. coli 055:B5. | Detection limits (3σ/S) obtained within 30 minutes using LA27 with respect to LPS, Pa-LPS, and Ecoli-LPS were 38.7, 88.0, and 154 ng/mL, respectively. | N/A | Isothermal Titration Calorimetry (ITC) | 46.2 ± 9.5 nM | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1248 | 30771102 | 2019 | Fluorometric determination of lipopolysaccharides via changes of the graphene oxide-enhanced fluorescence polarization caused by truncated aptamers | LA80 | ATAGGAGTCACGACGACCAGCCTTCTAACAGAATGTTGTTAGATAGCTTTGAAGCTGGTCTATGTGCGTCTACCTCTTGA | 80 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium), Escherichia Coli (E. Coli) 055:B5 and Pseudomonas Aeruginosa 10 | Lipopolysaccharide (LPS) | Developed an aptamer-based graphene oxide-based fluorescence polarization assay to detect LPSs from S. typhimurium, P. aeruginosa 10 and E. coli 055:B5. | Detection limits (3σ/S) obtained using LA80 with respect to LPS, Pa-LPS, and Ecoli-LPS were 0.185, 2.56 and 2.82 μg/mL, respectively. | N/A | Isothermal Titration Calorimetry (ITC) | 102 ± 17 nM | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1249 | 30771102 | 2019 | Fluorometric determination of lipopolysaccharides via changes of the graphene oxide-enhanced fluorescence polarization caused by truncated aptamers | LA60 | TCACGACGACCAGCCTTCTAACAGAATGTTGTTAGATAGCTTTGAAGCTGGTCTATGTGC | 60 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium), Escherichia Coli (E. Coli) 055:B5 and Pseudomonas Aeruginosa 10 | Lipopolysaccharide (LPS) | Developed an aptamer-based graphene oxide-based fluorescence polarization assay to detect LPSs from S. typhimurium, P. aeruginosa 10 and E. coli 055:B5. | N/A | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1250 | 30771102 | 2019 | Fluorometric determination of lipopolysaccharides via changes of the graphene oxide-enhanced fluorescence polarization caused by truncated aptamers | LA54 | CGACGACCAGCCTTCTAACAGAATGTTGTTAGATAGCTTTGAAGCTGGTCTATG | 54 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium), Escherichia Coli (E. Coli) 055:B5 and Pseudomonas Aeruginosa 10 | Lipopolysaccharide (LPS) | Developed an aptamer-based graphene oxide-based fluorescence polarization assay to detect LPSs from S. typhimurium, P. aeruginosa 10 and E. coli 055:B5. | N/A | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1251 | 30771102 | 2019 | Fluorometric determination of lipopolysaccharides via changes of the graphene oxide-enhanced fluorescence polarization caused by truncated aptamers | LA48 | CGACCAGCCTTCTAACAGAATGTTGTTAGATAGCTTTGAAGCTGGTCT | 48 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium), Escherichia Coli (E. Coli) 055:B5 and Pseudomonas Aeruginosa 10 | Lipopolysaccharide (LPS) | Developed an aptamer-based graphene oxide-based fluorescence polarization assay to detect LPSs from S. typhimurium, P. aeruginosa 10 and E. coli 055:B5. | N/A | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1252 | 30771102 | 2019 | Fluorometric determination of lipopolysaccharides via changes of the graphene oxide-enhanced fluorescence polarization caused by truncated aptamers | LA40 | CCTTCTAACAGAATGTTGTTAGATAGCTTTGAAGCTGGTC | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium), Escherichia Coli (E. Coli) 055:B5 and Pseudomonas Aeruginosa 10 | Lipopolysaccharide (LPS) | Developed an aptamer-based graphene oxide-based fluorescence polarization assay to detect LPSs from S. typhimurium, P. aeruginosa 10 and E. coli 055:B5. | N/A | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1253 | 30771102 | 2019 | Fluorometric determination of lipopolysaccharides via changes of the graphene oxide-enhanced fluorescence polarization caused by truncated aptamers | LA36 | GCCTTCTAACAGAATGTTGTTAGATAGCTTTGAAGC | 36 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium), Escherichia Coli (E. Coli) 055:B5 and Pseudomonas Aeruginosa 10 | Lipopolysaccharide (LPS) | Developed an aptamer-based graphene oxide-based fluorescence polarization assay to detect LPSs from S. typhimurium, P. aeruginosa 10 and E. coli 055:B5. | LA36 has good specificity. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1254 | 30771102 | 2019 | Fluorometric determination of lipopolysaccharides via changes of the graphene oxide-enhanced fluorescence polarization caused by truncated aptamers | LA22 | TTCTAACAGAATGTTGTTAGAT | 22 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium), Escherichia Coli (E. Coli) 055:B5 and Pseudomonas Aeruginosa 10 | Lipopolysaccharide (LPS) | Developed an aptamer-based graphene oxide-based fluorescence polarization assay to detect LPSs from S. typhimurium, P. aeruginosa 10 and E. coli 055:B5. | N/A | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1372 | 32792573 | 2020 | Electrical antimicrobial susceptibility testing based on aptamer-functionalized capacitance sensor array for clinical isolates | Aptamer 4 | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (KP1-ESBL, KP2-ESBL, KP3, KP4-ESBL, KP5-ESBL) | Whole cell | Electrical AST (e-AST) chips composed of 60 aptamer-functionalized capacitance sensors to detect bacteria and measure the antibiotic susceptibility to 11 antibiotics at five different concentrations. | The discrepancies between e-AST and BMD tests were estimated to be 2.20% mE, 0.38% ME, and 0.38%, which are lower than the FDA requirements (mE ≤ 10%, ME ≤ 3%, and VME ≤ 1.5%). | N/A | N/A | N/A | Diagnostic | N/A | 3'-Thiolated (SH-(CH2)3) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1376 | 32785202 | 2020 | Spectroscopic Study on Pseudomonas Aeruginosa Biofilm in the Presence of the Aptamer-DNA Scaffolded Silver Nanoclusters | NC1 | TACTTCCGCACCCTCCTACA | 20 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 10145) | Biofilm | DNA aptamer-enclosed silver nanoclusters (Ag-NC) were used to prevent biofilms. | Potency of an aptamer-DNA enclosed Ag-NC with a decrease in the net Ld wrt control follows NC2 > NC1 > NC5 > positive control ≈ NC3 > NC6. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1377 | 32785202 | 2020 | Spectroscopic Study on Pseudomonas Aeruginosa Biofilm in the Presence of the Aptamer-DNA Scaffolded Silver Nanoclusters | NC2 | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 10145) | Biofilm | DNA aptamer-enclosed silver nanoclusters (Ag-NC) were used to prevent biofilms. | Potency of an aptamer-DNA enclosed Ag-NC with a decrease in the net Ld wrt control follows NC2 > NC1 > NC5 > positive control ≈ NC3 > NC6. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1378 | 32785202 | 2020 | Spectroscopic Study on Pseudomonas Aeruginosa Biofilm in the Presence of the Aptamer-DNA Scaffolded Silver Nanoclusters | NC3 | CCCTTTCCCTTTCCCATTCCCGTTCCCTTTCCCTTTCCCATTCCCGTTA | 49 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 10145) | Biofilm | DNA aptamer-enclosed silver nanoclusters (Ag-NC) were used to prevent biofilms. | Potency of an aptamer-DNA enclosed Ag-NC with a decrease in the net Ld wrt control follows NC2 > NC1 > NC5 > positive control ≈ NC3 > NC6. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1379 | 32785202 | 2020 | Spectroscopic Study on Pseudomonas Aeruginosa Biofilm in the Presence of the Aptamer-DNA Scaffolded Silver Nanoclusters | NC5 | ATGAGAGCGTCGGTGTGGTA-CCCTTTCCCTTTCCCATTCCCGTTCCCTTTCCCTTTCCCATTCCCGTTA-TACTTCCGCACCCTCCTACA | 89 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 10145) | Biofilm | DNA aptamer-enclosed silver nanoclusters (Ag-NC) were used to prevent biofilms. | Potency of an aptamer-DNA enclosed Ag-NC with a decrease in the net Ld wrt control follows NC2 > NC1 > NC5 > positive control ≈ NC3 > NC6. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1380 | 32785202 | 2020 | Spectroscopic Study on Pseudomonas Aeruginosa Biofilm in the Presence of the Aptamer-DNA Scaffolded Silver Nanoclusters | NC6 | ATGAGAGCGTCGGTGTGGTA | 20 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 10145) | Biofilm | DNA aptamer-enclosed silver nanoclusters (Ag-NC) were used to prevent biofilms. | Potency of an aptamer-DNA enclosed Ag-NC with a decrease in the net Ld wrt control follows NC2 > NC1 > NC5 > positive control ≈ NC3 > NC6. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1455 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C1R1 | TAGGGAAGAGAAGGACATATGAT-GCGCGCGAGATTAACCCCCCAATGCTGCACCGAGCCACGA-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | With 250 cells as the lowest measured cell number by the C1R1. The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | 31 ± 2 nM | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1456 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C2R1 | TAGGGAAGAGAAGGACATATGAT-GCGGCAGGGAAGGACTATGTGGGTGAAAGGAGTGCGCGGG-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | N/A | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1457 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C2R2 | TAGGGAAGAGAAGGACATATGAT-GCAGCGGGATGGGGTAAATGGTGGCGAGAGGCGTCGGGGG-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | N/A | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1458 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C4R2 | TAGGGAAGAGAAGGACATATGAT-GCGGGTTGACTAGTACATGACCACTTGAGTCGCTTGAACT-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | Labelling efficiency by C4R2 of approximately 60 % fluorescence signal relative to R16 values. The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | N/A | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1459 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C6R3 | TAGGGAAGAGAAGGACATATGAT-GCGGGGAGAGGCGAAAGAAGCTGGGATGGAAGGGCGTAGG-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | N/A | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1460 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C10R5 | TAGGGAAGAGAAGGACATATGAT-GCAGCCACAGCAGAGACGGGAAGGGCCAGGGTTGAGCGGG-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | N/A | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1461 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C10R6 | TAGGGAAGAGAAGGACATATGAT-GCGGCGGTGGGGCTTTCGGTGATTTGGGCGGTTTGGCGGG-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | N/A | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1547 | 34107210 | 2021 | A Low-Field Magnetic Resonance Imaging Aptasensor for the Rapid and Visual Sensing of Pseudomonas aeruginosa in Food, Juice, and Water | Anti-P. aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Developed a low-field magnetic resonance imaging (LF-MRI) aptasensor based on the difference in magnetic behaviour of two magnetic nanoparticles with diameters of 10 (MN10) and 400 nm (MN400) for the rapid detection of P. aeruginosa. | Show a detection limit of 100 cfu/mL with a wide linear range from 3.1 × 10(2) to 3.1 × 10(7) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1552 | https://doi.org/10.1016/j.microc.2021.106388 | 2021 | Rapid and sensitive determination of Pseudomonas aeruginosa by using a glassy carbon electrode modified with gold nanoparticles and aptamer-imprinted polydopamine | Aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa | Whole cell | Develop an electrochemical sensor based on a combination of aptasensing and molecular imprinting employing GCE/AuNP/Aptamer-MIP for ultrasensitive detection of P. aeruginosa. | Exhibited a wide linear dynamic concentration range of 10(1) to 10(7) CFU/ml with a low detection limit of 1 CFU/ml. | N/A | N/A | N/A | Detection | N/A | 5'-Amidation (NH₂) | N/A | The GCE/AuNP/Aptamer-MIP aptasensor signal remained unchanged, and only a 3% decrease in the peak current occurred after 50 repetitive cycles. | N/A | N/A | N/A |
| ABdb_1581 | 33303152 | 2021 | Hollow carbon nanocapsules-based nitrogen-doped carbon nanofibers with rosary-like structure as a high surface substrate for impedimetric detection of Pseudomonas aeruginosa | Aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa | Whole cell | Developed an electrochemical aptasensor based on hollow carbon nanocapsule-based nitrogen-doped carbon nanofibers (CNCNF) with a rosary-like structure for the detection of PA. | The linear range and LOD of the aptasensor were 101-107 CFU/ml and 1 CFU/ml. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | After 8 days of storage in Fe(CN)6 3-/4- at 4°C, the electrode was found to be 89% of its initial activity. | N/A | N/A | N/A |
| ABdb_1656 | 36418544 | 2022 | Colorimetric detection of Pseudomonas aeruginosa by aptamer-functionalized gold nanoparticles | Aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Developed a colorimetric biosensor using aptamer-functionalized AuNPs for identifying P. aeruginosa. | P. aeruginosa was detected after 5 h for concentrations from 10(8) to 10(5) CFU/mL, with 10(5) and 10(4) CFU/mL being the detection limits for colour change by the naked eye and UV-Vis spectrometry, respectively. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1657 | 35884243 | 2022 | Label-Free Electrochemical Aptasensor for the Detection of the 3-O-C12-HSL Quorum-Sensing Molecule in Pseudomonas aeruginosa | APT | GCAATGGTACGGTACTTCCCGGGGCCCGCTTCTGGTGCGGTGTACTAGTGACCGCAAAAGTGCACGCTACTTTGCTAA | 78 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | N-3-oxo-dodecanoyl L-homoserine lactone (3-O-C12-HSL) | An electrochemical aptasensor using a carbon-based SPE modified with AuNPs was developed for the detection of 3-O-C12-HSL. | Exhibited a logarithmic range from 0.5 to 30 µM, with a limit of detection of 145 ng mL−1 (0.5 µM). | N/A | Surface Plasmon Resonance (SPR) | 106.7 ± 9.3 nM | Biosensor | N/A | 3'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1769 | 37164985 | 2023 | Selecting antibacterial aptamers against the BamA protein in Pseudomonas aeruginosa by incorporating genetic algorithm to optimise computational screening method | Apt31 | ACCATCTGTGTAAGGGGTAAGGGGTGGGGGTGGGTACGTCT | 41 | N/A | ssDNA | Pseudomonas Aeruginosa | Outer membrane protein BamA (β-barrel assembly machinery A) | Selecting antibacterial aptamers against the BamA protein in Pseudomonas aeruginosa by incorporating a genetic algorithm to optimise the computational screening method. | Treatment of P. aeruginosa with 10 µM Apt31 for 2 h resulted in a significant reduction in CFU/mL and growth percentage. | N/A | N/A | N/A | Therapeutics | In-silico Method | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1770 | 38157041 | 2023 | A point-of-care aptasensor based on the upconversion nanoparticles/MoS2 FRET system for the detection of Pseudomonas aeruginosa infection | Aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa | Whole cell | Develop an aptasensor based on FRET between UCNPs-apt/MoS2 for rapid detection of P. aeruginosa. | Exhibit a wide linear detection range 8.7 × 10 ~ 8.7 × 10(7) cfu/mL, and a low limit of detection (LOD) of 15.5 cfu/mL within 1.5 h. | N/A | N/A | N/A | Biosensor | N/A | 5'-COOH (Carboxylated) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1816 | 36493674 | 2023 | Sandwich-Type Electrochemical Aptasensor for Highly Sensitive and Selective Detection of Pseudomonas Aeruginosa Bacteria Using a Dual Signal Amplification Strategy | F23 | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 15442) | Whole cell | Developed a sandwich-type electrochemical aptasensor using a carbon screen-printed electrode (MIL101(Cr)/MWCNT) and AgNPs/C-g-C3N4/Apt for P. aeruginosa detection. | Display a limit of detection of 1 CFU/mL and a linear range of 10 to 10(7) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | The DPV current intensity of the aptasensor for 10(5) CFU/mL of P. aeruginosa was approximately 92.4% of its initial signals after 21 days stored at 4°C. | N/A | N/A | N/A |
| ABdb_1820 | 36705734 | 2023 | A universal approach for sensitive and rapid detection of different pathogenic bacteria based on aptasensor-assisted SERS technique | P. aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (CICC 21636) | Whole cell | Developed an assembled aptasensor based on Fe3O4@Au@Ag nanocomposites for the detection of various pathogenic bacteria. | Showed a linear range of 10-10(7) CFU/mL, with a detection limit of 3.84 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1823 | 36166924 | 2023 | Ultrasensitive multicolor electrochromic sensor built on closed bipolar electrode: Application in the visual detection of Pseudomonas aeruginosa | Aptamer | TTTTTCCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 65 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 10145) | Whole cell | An ultrasensitive multicolour electrochromic platform based on a closed bipolar electrode (BPE) was developed for visual sensing of P. aeruginosa. | The detection limit was as low as 0.33 CFU/mL, and the linear range was 10(0)-10(8) CFU/mL within 30 min by the naked eye. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1838 | https://doi.org/10.1002/adfm.202403440 | 2024 | Next-Generation Wound Care: Aptamer-Conjugated Polydiacetylene/Polyurethane Nanofibrous Biosensors for Selective In Situ Colorimetric Detection of Pseudomonas | F23 | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Developed an aptamer-modified polydiacetylene-based electrospun nanofibrous wound dressing for the detection of Pseudomonas aeruginosa. | The LOD for the aptamer-modified membrane P-F23 was 1.42 × 10(6) CFU/cm^2. | N/A | N/A | N/A | Biosensor | N/A | Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1839 | https://doi.org/10.1002/adfm.202403440 | 2024 | Next-Generation Wound Care: Aptamer-Conjugated Polydiacetylene/Polyurethane Nanofibrous Biosensors for Selective In Situ Colorimetric Detection of Pseudomonas | St21Lp17 | AAGCGTCGGTGTTCTATCGGTAGTTGACACCGACGCCT | 38 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Developed an aptamer-modified polydiacetylene-based electrospun nanofibrous wound dressing for the detection of Pseudomonas aeruginosa. | The LOD for the aptamer-modified membrane P-St21Lp17 was 4.46 × 10(6) CFU/cm^2. | N/A | N/A | N/A | Biosensor | N/A | Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1883 | 41431270 | 2025 | Bioimaging with fluorescent nucleic-acid aptamers for the specific detection and quantification of Pseudomonas aeruginosa alone and in heterogeneous bacterial populations | F23 | ATACCAGCTTATTCAATT-CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG-AGATAGTAAGTGCAATCT | 96 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 15692) | Whole cell | Develop a fluorescent aptamer for detecting Pseudomonas aeruginosa. | 73.79% of live P. aeruginosa cells (3102/4204) were labeled by the Cy5‐F23 aptamer, compared to only 0.06% of live S. aureus (4/6767). | 15 | Flow Cytometry | 17.27 ± 5.00 nM | Imaging | Whole Cell-SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | The aptamer remains highly stable for 72 hours. | N/A | N/A | N/A |
| ABdb_1904 | 40517569 | 2025 | Ultrasensitive electrochemical aptasensor for Pseudomonas aeruginosa detection using N-doped MWCNTs/AgNPs nanocomposite | F23 | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa | Whole cell | Developed an electrochemical P.A. biosensor based on N-MWCNTs/AgNPs-10/Apt for the detection of P. aeruginosa. | Exhibited a wide linear detection range from 10(-1) to 10(6) CFU/mL, and the limit of detection is 0.0798 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1907 | 41149287 | 2025 | Real-Time and Selective Detection of Pseudomonas aeruginosa in Beef Samples Using a g-C3N4-Doped Multimetallic Perovskite-Based Electrochemical Aptasensor | P. aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa | Whole cell | Developed an electrochemical aptasensor based on aptamer functionalized FeCoCuNiO-g-C3N4 nanocomposite for the detection of P. aeruginosa in food samples. | Exhibited a low detection limit of 3.03 CFU/mL and over a range of 1 × 10(1)–1 × 10(7) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1926 | 40136943 | 2025 | Nanoparticle-Enhanced Acoustic Wave Biosensor Detection of Pseudomonas aeruginosa in Food | P. aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa PAO1 | Whole cell | Developed a biosensor for detecting P. aeruginosa in whole milk samples using an aptamer functionalized antifouling linking molecule 3-(2-mercaptoethanoxy)propanoic acid (HS-MEG-COOH), and another one with the addition of AuNPs. | Exhibited a linear range 10(2)-10(5) CFU/mL and limit of detection (LOD) of 86 CFU/mL in PBS and 157 CFU/mL in milk, and with AuNPs, reducing the extrapolated LOD to 68 CFU/mL in PBS and 46 CFU/mL in milk. | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2118 | 30382404 | 2018 | A bimodal (SERS and colorimetric) aptasensor for the detection of Pseudomonas aeruginosa | P. aeruginosa aptamer | N/A | N/A | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | The dual-mode aptasensor based on SERS and colorimetry assay for the determination of P. aeruginosa. | LOD of the aptasensor was 20 cfu/mL for SERS mode and 50 cfu·mL−1 for color mode with a linear range from 10^2 cfu/mL to 10^6 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |