AptBacterialDB

Target Organism : Porphyromonas Gingivalis

Total records found: 15

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_0586 252698122015Screening and development of DNA aptamers specific to several oral pathogensAPG-1CGGATCCATGGGCACTATTTATATCAA-TATGCCAGCATTTCGCCAACGGTGGTCATACAGTGTGAA-AATGTCGTTGGTGGCCC835'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3'ssDNAPorphyromonas Gingivalis (ATCC 33277)Whole cellScreen and develop aptamers specific to oral pathogens.All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet.N/AModified Western Blot AssayN/ADetectionWhole Cell-SELEXDIG (Digoxigenin) LabeledN/AN/AN/AN/AN/A
ABdb_0587 252698122015Screening and development of DNA aptamers specific to several oral pathogensAPG-2CGGATCCATGGGCACTATTTATATCAA-GGGTATCCCACTCGGACGTTCATACCTGGCTGGTTGCAA-AATGTCGTTGGTGGCCC835'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3'ssDNAPorphyromonas Gingivalis (ATCC 33277)Whole cellScreen and develop aptamers specific to oral pathogens.All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet.N/AModified Western Blot AssayN/ADetectionWhole Cell-SELEXDIG (Digoxigenin) LabeledN/AN/AN/AN/AN/A
ABdb_0588 252698122015Screening and development of DNA aptamers specific to several oral pathogensAPG-3CGGATCCATGGGCACTATTTATATCAA-AGCGCGTTTTGGACATGCGCTAGCTTCAATTTGAGCTAA-AATGTCGTTGGTGGCCC835'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3'ssDNAPorphyromonas Gingivalis (ATCC 33277)Whole cellScreen and develop aptamers specific to oral pathogens.All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet.N/AModified Western Blot AssayN/ADetectionWhole Cell-SELEXDIG (Digoxigenin) LabeledN/AN/AN/AN/AN/A
ABdb_0589 252698122015Screening and development of DNA aptamers specific to several oral pathogensAPG-4CGGATCCATGGGCACTATTTATATCAA-GCCAATGCACTCTGGTTATTCCCCTAAACATCCCGGAAA-AATGTCGTTGGTGGCCC835'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3'ssDNAPorphyromonas Gingivalis (ATCC 33277)Whole cellScreen and develop aptamers specific to oral pathogens.All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet.N/AModified Western Blot AssayN/ADetectionWhole Cell-SELEXDIG (Digoxigenin) LabeledN/AN/AN/AN/AN/A
ABdb_0590 252698122015Screening and development of DNA aptamers specific to several oral pathogensAPG-5CGGATCCATGGGCACTATTTATATCAA-CGTTTGGGGCTGTGTTGCAAGACCGTACGTTGCCCCCAA-AATGTCGTTGGTGGCCC835'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3'ssDNAPorphyromonas Gingivalis (ATCC 33277)Whole cellScreen and develop aptamers specific to oral pathogens.All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet.N/AModified Western Blot AssayN/ADetectionWhole Cell-SELEXDIG (Digoxigenin) LabeledN/AN/AN/AN/AN/A
ABdb_0591 252698122015Screening and development of DNA aptamers specific to several oral pathogensAPG-6CGGATCCATGGGCACTATTTATATCAA-TGCAACCGTGGAGTCGTGTTGAGGAGGCGCAATGCGTAA-AATGTCGTTGGTGGCCC835'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3'ssDNAPorphyromonas Gingivalis (ATCC 33277)Whole cellScreen and develop aptamers specific to oral pathogens.All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet.N/AModified Western Blot AssayN/ADetectionWhole Cell-SELEXDIG (Digoxigenin) LabeledN/AN/AN/AN/AN/A
ABdb_0592 252698122015Screening and development of DNA aptamers specific to several oral pathogensAPG-7CGGATCCATGGGCACTATTTATATCAA-TGGTACCGTGGAGTCGTGTTGAGGAGGCGCAATGCGTAA-AATGTCGTTGGTGGCCC835'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3'ssDNAPorphyromonas Gingivalis (ATCC 33277)Whole cellScreen and develop aptamers specific to oral pathogens.All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet.N/AModified Western Blot AssayN/ADetectionWhole Cell-SELEXDIG (Digoxigenin) LabeledN/AN/AN/AN/AN/A
ABdb_0593 252698122015Screening and development of DNA aptamers specific to several oral pathogensAPG-8CGGATCCATGGGCACTATTTATATCAA-TTACAGTATCCTCCCACGTTGGTTCGTGTCTTACGGAAA-AATGTCGTTGGTGGCCC835'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3'ssDNAPorphyromonas Gingivalis (ATCC 33277)Whole cellScreen and develop aptamers specific to oral pathogens.All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet.N/AModified Western Blot AssayN/ADetectionWhole Cell-SELEXDIG (Digoxigenin) LabeledN/AN/AN/AN/AN/A
ABdb_1628 358424602022DNA-aptamer-nanographene oxide as a targeted bio-theragnostic system in antimicrobial photodynamic therapy against Porphyromonas gingivalisAptamerTATGCCAGCATTTCGCCAACGGTGGTCATACAGTGTGAA39N/AssDNAPorphyromonas GingivalisWhole cellDNA-aptamer-NGO, a targeted bio-theragnostic system against P. gingivalis for antimicrobial photodynamic therapy (aPDT).MIC of DNA-aptamer-NGO was 62.5 nM, and MBC was 125 nM. aPDT using 1/2 × and 1/4 × MBC of DNA-aptamer-NGO plus irradiation of the diode laser light (1 min) has a significantly anti-biofilm effect; percentage of apoptosis cells treated with DNA-aptamer-NGO at 1/2 × and 1/4 × MIC plus diode laser were 13.9% and 12.7%; and 1/2 × MIC of DNA-aptamer-NGO, resulted in 40.3% inactivation of metabolic activity compared to 1/4 × MBC of DNA-aptamer-NGO, where only 22.2% inactivation.N/AN/AN/ADiagnostic/TherapeuticsN/AFAM LabeledAt high concentrations of DNA-aptamer-NGO, incubated for 24 hours with human red blood cells, the percentage did not exceed 5%. Also, at different concentrations, the mean percentage of HGF cell viability ranges from 95.2% to 87.6%.N/AN/AN/AN/A
ABdb_1915 400169202025Cascaded Strand Displacement Amplification and CRISPR/Cas12a Aptasensor Utilizing MoS2 Nanoflowers for Colorectal Cancer Biomarker Porphyromonas gingivalis DetectionApt-Pg1TGACTGACGACGACTC-AGTGGAGTATCGCCTTGCCGACCCGGGTGTCTACGATCAGTGAGTGGTAGT-GACTGCTCGAGCTG815'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3'ssDNAPorphyromonas Gingivalis (ATCC 33277)Whole cellIdentify specific aptamers targeting P. gingivalis and develop an aptasensor based on MoS2 nanoflowers that integrates strand displacement amplification and CRISPR/Cas12a double-amplification for detection.N/A15Fluorescence Binding AssayN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1916 400169202025Cascaded Strand Displacement Amplification and CRISPR/Cas12a Aptasensor Utilizing MoS2 Nanoflowers for Colorectal Cancer Biomarker Porphyromonas gingivalis DetectionApt-Pg2TGACTGACGACGACTC-TGGAGCTCGGGTATTCTCGTCAGACCCTCCTGAGTTGATTTTAGCAACCG-GACTGCTCGAGCTG805'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3'ssDNAPorphyromonas Gingivalis (ATCC 33277)Whole cellIdentify specific aptamers targeting P. gingivalis and develop an aptasensor based on MoS2 nanoflowers that integrates strand displacement amplification and CRISPR/Cas12a double-amplification for detection.N/A15Fluorescence Binding AssayN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1917 400169202025Cascaded Strand Displacement Amplification and CRISPR/Cas12a Aptasensor Utilizing MoS2 Nanoflowers for Colorectal Cancer Biomarker Porphyromonas gingivalis DetectionApt-Pg3TGACTGACGACGACTC-CGGCGAGTAACGACTATGTCGCACGGGTGTCTTACGAGACGGTTGGGGTC-GACTGCTCGAGCTG805'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3'ssDNAPorphyromonas Gingivalis (ATCC 33277)Whole cellIdentify specific aptamers targeting P. gingivalis and develop an aptasensor based on MoS2 nanoflowers that integrates strand displacement amplification and CRISPR/Cas12a double-amplification for detection.N/A15Fluorescence Binding AssayN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1918 400169202025Cascaded Strand Displacement Amplification and CRISPR/Cas12a Aptasensor Utilizing MoS2 Nanoflowers for Colorectal Cancer Biomarker Porphyromonas gingivalis DetectionApt-Pg4TGACTGACGACGACTC-CTTGTCCATGGCTTGTCCACTCGGGTGTCTGGACAATGAAACCGAACTGC-GACTGCTCGAGCTG805'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3'ssDNAPorphyromonas Gingivalis (ATCC 33277)Whole cellIdentify specific aptamers targeting P. gingivalis and develop an aptasensor based on MoS2 nanoflowers that integrates strand displacement amplification and CRISPR/Cas12a double-amplification for detection.N/A15Fluorescence Binding AssayN/ABiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1919 400169202025Cascaded Strand Displacement Amplification and CRISPR/Cas12a Aptasensor Utilizing MoS2 Nanoflowers for Colorectal Cancer Biomarker Porphyromonas gingivalis DetectionApt-Pg8TGACTGACGACGACTC-AGAACGCTTTATGCGCACGGGGGACTTCGGAGTCGTCGAGTACGGGTACC-GACTGCTCGAGCTG805'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3'ssDNAPorphyromonas Gingivalis (ATCC 33277)Whole cellIdentify specific aptamers targeting P. gingivalis and develop an aptasensor based on MoS2 nanoflowers that integrates strand displacement amplification and CRISPR/Cas12a double-amplification for detection.N/A15Fluorescence Binding Assay183.79 ± 3.27 nMBiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1920 400169202025Cascaded Strand Displacement Amplification and CRISPR/Cas12a Aptasensor Utilizing MoS2 Nanoflowers for Colorectal Cancer Biomarker Porphyromonas gingivalis DetectionApt-Pg8ATGACTGACGACGACTCAGAACGCTTTATGCGCACGGGGGACTTCGGAGTCGTCGAGT575'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3'ssDNAPorphyromonas Gingivalis (ATCC 33277)Whole cellIdentify specific aptamers targeting P. gingivalis and develop an aptasensor based on MoS2 nanoflowers that integrates strand displacement amplification and CRISPR/Cas12a double-amplification for detection.Achieving a limit of detection of 10 CFU/mL.15Fluorescence Binding Assay133.15 ± 48.56 nMBiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/ABest CandidateN/AN/A