Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 1
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_1226 | 31403764 | 2019 | Rapid Detection of Mycoplasma-Infected Cells by an ssDNA Aptamer Probe | Aptamer A15-1 | GTGGGGTTGAAAACGCCGGAGAGGGTGTGTGGGTGGGGTA | 40 | 5'-ATCCAGAGTGACGCAGCA-N40-TGGACACGGTGGCTTAGT-3' | ssDNA | Mycoplasma-Infected Cells (Jeko-1 lymphoma cells) | Whole cell | Develop an aptamer probe for the rapid detection of mycoplasma-infected cells. | Mycoplasma-positive cells showed a strong signal, but no signal was detected in the mycoplasma-negative cells. | 15 | Flow Cytometry | 24.5 nM | Detection | Whole Cell-SELEX | 5'-Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |