Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 60
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0065 | 19284297 | 2009 | The selection and application of ssDNA aptamers against MPT64 protein in Mycobacterium tuberculosis | M64CA (aptamers 20, 34, 41, 46, and 50 ) | GGGAGCTCAGAATAAACGCTCAA-TTCGGGAATGATTATCAAATTTATGCCCTCTGAT-TTCGACATGAGGCCCGGATC | 77 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Identify an aptamer that binds to MPT64, and an aptamer-MPT64 was designed to detect M. tuberculosis by measuring MPT64 protein levels in culture filtrates. | The sandwich assay scheme based on the aptamer-protein complex had a high sensitivity (86.3%) and specificity (88.5%). | 12 | N/A | N/A | Detection | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0066 | 19284297 | 2009 | The selection and application of ssDNA aptamers against MPT64 protein in Mycobacterium tuberculosis | Aptamer 11 (named M64RA) | GGGAGCTCAGAATAAACGCTCAA-TGGGAGCTGATGTCGCATGGGTTTTGATCACATGA-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Identify an aptamer that binds to MPT64, and an aptamer-MPT64 was designed to detect M. tuberculosis by measuring MPT64 protein levels in culture filtrates. | The sandwich assay scheme based on the aptamer-protein complex had a high sensitivity (86.3%) and specificity (88.5%). | 12 | N/A | N/A | Detection | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0830 | 29594592 | 2017 | Selection of DNA aptamers against Mycobacterium tuberculosis Ag85A, and its application in a graphene oxide-based fluorometric assay | Apt22 | GCTGTGTGACTCCTGCAA-GCGGGAAGAGGGTAAGGGGAGGGAGGGTAACGCGGAGAAGGCAA-GCAGCTGTATCTTGTCTCC | 81 | 5'-GCTGTGTGACTCCTGCAA-N43-GCAGCTGTATCTTGTCTCC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Antigen 85 (Ag85A) (FbpA) | Identify aptamers that bind to and develop a graphene oxide-based fluorometric assay to detect FbpA. | Display LOD in PBS and serum of 1.5 nM and 2.1 nM, respectively, with an analytical linear range from 5 to 200 nM of FbpA. | 12 | Flow Cytometry | 62.95 nM | Biosensor | Magnetic Bead (MB)-based Protein SELEX | ATTO647N-labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0831 | 29594592 | 2017 | Selection of DNA aptamers against Mycobacterium tuberculosis Ag85A, and its application in a graphene oxide-based fluorometric assay | Apt8 | GCTGTGTGACTCCTGCAA-TCAGGAAAGAACTTAGGGGTGGGAGGAGGGTATAAATACGGAAT-GCAGCTGTATCTTGTCTCC | 81 | 5'-GCTGTGTGACTCCTGCAA-N43-GCAGCTGTATCTTGTCTCC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Antigen 85 (Ag85A) (FbpA) | Identify aptamers that bind to and develop a graphene oxide-based fluorometric assay to detect FbpA. | N/A | 12 | Flow Cytometry | 202 nM | Biosensor | Magnetic Bead (MB)-based Protein SELEX | ATTO647N-labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0947 | 28551117 | 2017 | Electrochemical determination of M. tuberculosis antigen based on Poly(3,4-ethylenedioxythiophene) and functionalized carbon nanotubes hybrid platform | MPT64 aptamer | GTACAAACGACGGCCAGT-CCTTGGGATGATTCAAGCAAAGCCTCACGCCTACGGCTAA-GTCATAGCTGTCTCTCCTG | 77 | 5'-GTACAAACGACGGCCAGT-N40-GTCATAGCTGTCTCTCCTG-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Developed an electrochemical aptasensor based on MWCNT-doped PEDOT nano-composite for the detection of Mycobacterium tuberculosis. | Exhibits a LOD of 0.5 fg/mL within 15 min for the detection of M. tb antigenic protein with recovery in between (88–95)%. | N/A | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | The stability of the aptasensor is 27 days at 4°C, and the reusability is 7 times after repeated regeneration with 50 mM NaOH. | N/A | N/A | N/A |
| ABdb_0948 | 28414975 | 2017 | Fullerene-doped polyaniline as new redox nanoprobe and catalyst in electrochemical aptasensor for ultrasensitive detection of Mycobacterium tuberculosis MPT64 antigen in human serum | MBA I | TGGGAGCTGATGTCGCATGGGTTTTGATCACATGA | 35 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Electrochemical aptasensor based on GNPs-C60-PAn labelled with signal aptamer for the determination of MTB antigen. | A wide linear detection range of 0.02 to 1000 pg/mL was obtained, with a detection limit of 20 fg/mL for MPT64. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0949 | 28414975 | 2017 | Fullerene-doped polyaniline as new redox nanoprobe and catalyst in electrochemical aptasensor for ultrasensitive detection of Mycobacterium tuberculosis MPT64 antigen in human serum | MBA II | TTCGGGAATGATTATCAAATTTATGCCCTCTGAT | 34 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Electrochemical aptasensor based on GNPs-C60-PAn labelled with signal aptamer for the determination of MTB antigen. | A wide linear detection range of 0.02 to 1000 pg/mL was obtained, with a detection limit of 20 fg/mL for MPT64. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0964 | 28987879 | 2017 | Thioaptamer targeted discoidal microparticles increase self immunity and reduce Mycobacterium tuberculosis burden in mice | CD44 Thioaptamer (CD44TA) | GAGATTCATCACGCGCATAGTCTTGGGA*CGGTGTTA*A*A*CGA*A*A*GGGGA*CGA*CCCGA*CTA*TGCGA*TGA*TGTCTTC | 74 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | CD44 receptor (Mtb-infected murine macrophages) | Develop a targeting system using CD44 thioaptamers (TA)-conjugated discoidal silicon mesoporous microparticles (SMP) to enhance accumulation of these agents/carriers in the infected macrophages in the lungs. | CD44TA-SMP treatment increased IP-10 (CXCL-10), MCP-1, MCP-2, and RANTES, with no change in IL-6 release compared to the control. | N/A | N/A | N/A | Therapeutics | N/A | *= 5'-monothio-dA and 5'-Cyanine5 (Cy5) Labeled | In uninfected murine and human macrophages, SMP and CD44TA-SMP did not affect the cell viability. | N/A | N/A | N/A | N/A |
| ABdb_0979 | https://doi.org/10.1007/s00604-017-2174-7 | 2017 | Aptamer based voltammetric biosensor for the detection of Mycobacterium tuberculosis antigen MPT64 | Aptamer 3 | GTACAAACGACGGCCAGT-CCTTGGGATGATTCAAGCAAAGCCTCACGCCTACGGCTAA-GTCATAGCTGTCTCTCCTG | 77 | 5'-GTACAAACGACGGCCAGT-N40-GTCATAGCTGTCTCTCCTG-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Develop an aptaelectrode based on graphene modified iron-oxide chitosan hybrid (CHIT-IO-GR) nanocomposite film deposited on fluorine tin oxide (FTO) for the detection of the M. tb. specific antigen MPT64. | Exhibited a limit of detection (LOD) of 0.9 fg/mL within 20 min and a linear range from 1.0 × 10(5) fg/mL to 1.0 fg/mL. | 10 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | The biosensor retained about 80% of its initial activity after 10 uses and good stability of 17 day. | Best Candidate | N/A | N/A |
| ABdb_1003 | 30205966 | 2018 | Generation and application of DNA aptamers against HspX for accurate diagnosis of tuberculous meningitis | H63 | GTCTTGACTAGTTACGCC-GGGAACAATATGTTCAAGGGCTCTTTAAAGTTTTAGTTCGTTTG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | HspX antigen | Identify an aptamer that binds to HspX and develop an assay to diagnose TBM in CSF samples. | LOD was 32 ng for H63. | 8 | Isothermal Titration Calorimetry (ITC) | 3.71 x 10-7 ± 2.12 x 10-11 M | Diagnostic | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | Indian Patent application no. 201611001550 |
| ABdb_1004 | 30205966 | 2018 | Generation and application of DNA aptamers against HspX for accurate diagnosis of tuberculous meningitis | H63 SL-2 M6 | AGGGCTTTTTTTTTTTTTAGTTCGTTTG | 28 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | HspX antigen | Identify an aptamer that binds to HspX and develop an assay to diagnose TBM in CSF samples. | Exhibited 2.5-fold higher binding with respect to the parent H63, and H63 SL-2 M6 has an LOD of 16 ng. | 8 | Isothermal Titration Calorimetry (ITC) | 9 x 10-8 ± 2 x 10-14 M | Diagnostic | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | Indian Patent application no. 201611001550 |
| ABdb_1005 | 30205966 | 2018 | Generation and application of DNA aptamers against HspX for accurate diagnosis of tuberculous meningitis | H33 | GTCTTGACTAGTTACGCC-ACACTAGAAGGTATTTACTATTCTGTGTTAACATGTACTAGCCA-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | HspX antigen | Identify an aptamer that binds to HspX and develop an assay to diagnose TBM in CSF samples. | N/A | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Diagnostic | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Indian Patent application no. 201611001550 |
| ABdb_1006 | 30205966 | 2018 | Generation and application of DNA aptamers against HspX for accurate diagnosis of tuberculous meningitis | H66 | GTCTTGACTAGTTACGCC-AAGTTTTAATACAACTCACATTAGGGAAAGCTTGCATCCAGGCC-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | HspX antigen | Identify an aptamer that binds to HspX and develop an assay to diagnose TBM in CSF samples. | N/A | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Diagnostic | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Indian Patent application no. 201611001550 |
| ABdb_1007 | 30205966 | 2018 | Generation and application of DNA aptamers against HspX for accurate diagnosis of tuberculous meningitis | H70 | GTCTTGACTAGTTACGCC-CAGGACAGGTTAAAATTTTTCTGGATCCCTTTTCATTCTCCATGG-TCATTCAGTTGGCGCCTC | 81 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | HspX antigen | Identify an aptamer that binds to HspX and develop an assay to diagnose TBM in CSF samples. | N/A | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Diagnostic | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Indian Patent application no. 201611001550 |
| ABdb_1008 | 30205966 | 2018 | Generation and application of DNA aptamers against HspX for accurate diagnosis of tuberculous meningitis | H3 | GTCTTGACTAGTTACGCC-CATACACGGTTACACGTACTGGATAATGTTGATTATGCTTCTGC-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | HspX antigen | Identify an aptamer that binds to HspX and develop an assay to diagnose TBM in CSF samples. | N/A | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Diagnostic | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Indian Patent application no. 201611001550 |
| ABdb_1009 | 30205966 | 2018 | Generation and application of DNA aptamers against HspX for accurate diagnosis of tuberculous meningitis | H18 | GTCTTGACTAGTTACGCC-TAGAACCAAACCTTGTGTAGAAGGGCTTCTCCCGTGTGCTTTGA-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | HspX antigen | Identify an aptamer that binds to HspX and develop an assay to diagnose TBM in CSF samples. | N/A | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Diagnostic | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Indian Patent application no. 201611001550 |
| ABdb_1010 | 30205966 | 2018 | Generation and application of DNA aptamers against HspX for accurate diagnosis of tuberculous meningitis | H47 | GTCTTGACTAGTTACGCC-GGATGAACTGTTCCGCTGTGTATCACGCCAAAAGTCCTTATTTG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | HspX antigen | Identify an aptamer that binds to HspX and develop an assay to diagnose TBM in CSF samples. | N/A | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Diagnostic | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Indian Patent application no. 201611001550 |
| ABdb_1011 | 30205966 | 2018 | Generation and application of DNA aptamers against HspX for accurate diagnosis of tuberculous meningitis | H48 | GTCTTGACTAGTTACGCC-CATGAAACCATCTGGTCCGCAATGGGCGCTTGGAATATTCGTCA-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | HspX antigen | Identify an aptamer that binds to HspX and develop an assay to diagnose TBM in CSF samples. | N/A | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Diagnostic | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Indian Patent application no. 201611001550 |
| ABdb_1085 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-1 | GTCTTGACTAGTTACGCC-TAGGAAGGGAAGGAAGATAGAGAGTAGGTCGTCGGAGGCAGGGG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | Displayed the highest binding to HupB (≥5 fold relative to RDL). | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Patent application no. 20171100124 |
| ABdb_1086 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-2 | GTCTTGACTAGTTACGCC-TAGTAAAGGGGGTAAGAATCAATTGCGAGGTGGAGTGGGAGTGG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | Displayed the highest binding to HupB (≥5 fold relative to RDL). | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Patent application no. 20171100124 |
| ABdb_1087 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-4 | GTCTTGACTAGTTACGCC-TAGGTGATTGCTGGAGTGGGTAGCAGATGGGGGGGGGGTTCTTGG-TCATTCAGTTGGCGCCTC | 81 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | Displayed the highest binding to HupB (≥5 fold relative to RDL). | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Patent application no. 20171100124 |
| ABdb_1088 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-13 | GTCTTGACTAGTTACGCC-TTTGGGAAGGGGGGGGAGGAAGTTCGATGGTGTTGTGGACCGGG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | Displayed the highest binding to HupB (≥5 fold relative to RDL). | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Patent application no. 20171100124 |
| ABdb_1089 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-1T | TAGGAAGGGAAGGAAGATAGAGAGTAGGTCGTCGGAGGCAGGGG | 44 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | N/A | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Patent application no. 20171100124 |
| ABdb_1090 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-2T | TAGTAAAGGGGGTAAGAATCAATTGCGAGGTGGAGTGGGAGTGG | 44 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | N/A | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Patent application no. 20171100124 |
| ABdb_1091 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-4T | TAGGTGATTGCTGGAGTGGGTAGCAGATGGGGGGGGGGTTCTTGG | 45 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | HupB-4T treated bacteria yielded reduced intracellular CFU by ∼57.8%. | 8 | Isothermal Titration Calorimetry (ITC) | 1.72 ± 0.00002 μM, | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | No loss in the viability of THP-1 cells was observed on exposure to aptamers. | In fetal bovine serum (FBS) for 3 hr at 37°C, no change was observed in the integrity of aptamer bands. | Best Candidate | N/A | Patent application no. 20171100124 |
| ABdb_1092 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-13T | TTTGGGAAGGGGGGGGAGGAAGTTCGATGGTGTTGTGGACCGGG | 44 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | HupB-13T treated bacteria yielded reduced intracellular CFU by ∼45.5%. | 8 | Isothermal Titration Calorimetry (ITC) | 0.17 ± 0.00000005 μM | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | No loss in the viability of THP-1 cells was observed on exposure to aptamers. | In fetal bovine serum (FBS) for 3 hr at 37°C, no change was observed in the integrity of aptamer bands. | Best Candidate | N/A | Patent application no. 20171100124 |
| ABdb_1093 | 30350564 | 2018 | Aptamer-Based TB Antigen Tests for the Rapid Diagnosis of Pulmonary Tuberculosis: Potential Utility in Screening for Tuberculosis | H63 SL-2-M6 | AGGGCTTTTTTTTTTTTTAGTTCGTTTG | 28 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | HspX antigen | Developed an Aptamer ALISA and an electrochemical sensor (ECS) for the direct detection of HspX in sputum. | Aptamer ALISA demonstrated excellent sensitivity of 94.1% (95% CI, 86.8–98%) and specificity of 100% (95% CI, 98.4–100%). Aptamer-based ECS detected HspX at ∼13 pM. | N/A | N/A | N/A | Biosensor | N/A | ALISA: 5′-Biotinylated and ECS: 5'-Methylene Blue (MB) and 3'-Thiolated | N/A | N/A | N/A | N/A | Indian Patent application no. 201611001550 |
| ABdb_1191 | 30421038 | 2018 | Dual-aptamer-based voltammetric biosensor for the Mycobacterium tuberculosis antigen MPT64 by using a gold electrode modified with a peroxidase loaded composite consisting of gold nanoparticles and a Zr(IV)/terephthalate metal-organic framework | APT-I | TGGGAGCTGATGTCGCATGGGTTTTGATCACATGA | 35 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | A sandwich-like dual-aptamer strategy employing an ultrasensitive aptasensor for the voltammetric determination of M. tuberculosis. antigen MPT64 in human serum. | Achieved an ultrasensitive detection limit of 10 fg/mL and a wide linear response range from 0.02 to 1000 pg/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1192 | 30421038 | 2018 | Dual-aptamer-based voltammetric biosensor for the Mycobacterium tuberculosis antigen MPT64 by using a gold electrode modified with a peroxidase loaded composite consisting of gold nanoparticles and a Zr(IV)/terephthalate metal-organic framework | APT-II | TTCGGGAATGATTATCAAATTTATGCCCTCTGAT | 34 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | A sandwich-like dual-aptamer strategy where two different aptamers are immobilized on a gold electrode to synergistically bind the target MPT64 protein | Achieved an ultrasensitive detection limit of 10 fg/mL and a wide linear response range from 0.02 to 1000 pg/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1195 | 30019137 | 2018 | Aptamer based voltammetric biosensor for Mycobacterium tuberculosis antigen ESAT-6 using a nanohybrid material composed of reduced graphene oxide and a metal-organic framework | ESAT-6 binding aptamer (EBA) | GGGAGCTCAGAATAAACGCTCAACCTCCCTGGGTCACCATAGACTCCATCTAAGATGCTTCGACATGAGGCCCGGATC | 78 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | ESAT-6 (6-kDa early secretory antigenic target) | Develop a voltammetric aptasensor employing P-MOF-rGO nanohybrid as the sensitive sensing platform for ultrasensitive detection of ESAT-6. | Linear range: 1.0×10(−4) to 2.0×10(2) ng/mL and Limit of Detection (LOD): 3.3×10(−5) ng/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | Compared with the initial current response, the aptsensor response decreased only about 3.5% after 50 cycles’ continuous CV scans. | N/A | N/A | N/A |
| ABdb_1276 | 30352198 | 2019 | A novel aptamer-based test for the rapid and accurate diagnosis of pleural tuberculosis | H63 SL-2 M6 | AGGGCTTTTTTTTTTTTTAGTTCGTTTG | 28 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | HspX antigen | Aptamer-Linked Immobilized Sorbent Assay (ALISA) was developed to detect pleural TB (pTB). | Detects pTB with ~93% sensitivity and ~98% specificity. | N/A | N/A | N/A | Diagnostic | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | Indian Patent application no. 201611001550 |
| ABdb_1277 | 30988611 | 2019 | Structural switching electrochemical DNA aptasensor for the rapid diagnosis of tuberculous meningitis | H63 SL-2 M6 | AGGGCTTTTTTTTTTTTTAGTTCGTTTG | 28 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | HspX antigen | Developed a structural switching electrochemical aptasensor using methylene blue (MB) and an aptamer for the detection of HspX in CSF samples for the diagnosis of TBM. | Can detect as low as 10 pg HspX in CSF with ~95% sensitivity and ~97.5% specificity in ≤30 minutes. | N/A | N/A | N/A | Diagnostic | N/A | 5'-Methylene Blue (MB) and 3'-C6 thiol modification | N/A | N/A | N/A | N/A | Indian Patent application no. 201611001550 |
| ABdb_1325 | 31202103 | 2019 | A sandwich-type electrochemical aptasensor for Mycobacterium tuberculosis MPT64 antigen detection using C60NPs decorated N-CNTs/GO nanocomposite coupled with conductive PEI-functionalized metal-organic framework | MPT64 antigen aptamer Ⅰ (MAA Ⅰ) | TGGGAGCTGATGTCGCATGGGTTTTGATCACATGA | 35 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Develop a sandwich-type electrochemical aptasensor using (C60NPs-N-CNTs/GO) for the detection of MPT64 antigen. | Showed a wide linear range from 1 fg/mL to 1 ng/mL with a limit of detection (LOD) as low as 0.33 fg/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | Oxidation current remains 94.5% of the initial level after 80 cycles, and peak current remains approximately 98.7%, 93.5%, and 90.6% of the initial peak current after 7, 14, and 21 days, respectively. | N/A | N/A | N/A |
| ABdb_1326 | 31202103 | 2019 | A sandwich-type electrochemical aptasensor for Mycobacterium tuberculosis MPT64 antigen detection using C60NPs decorated N-CNTs/GO nanocomposite coupled with conductive PEI-functionalized metal-organic framework | MPT64 antigen aptamer Ⅱ (MAA Ⅱ) | TTCGGGAATGATTATCAAATTTATGCCCTCTGAT | 34 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Develop a sandwich-type electrochemical aptasensor using (C60NPs-N-CNTs/GO) for the detection of MPT64 antigen. | Showed a wide linear range from 1 fg/mL to 1 ng/mL with a limit of detection (LOD) as low as 0.33 fg/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | Oxidation current remains 94.5% of the initial level after 80 cycles, and peak current remains approximately 98.7%, 93.5%, and 90.6% of the initial peak current after 7, 14, and 21 days, respectively. | N/A | N/A | N/A |
| ABdb_1340 | 30078622 | 2019 | Electrochemical aptasensor using optimized surface chemistry for the detection of Mycobacterium tuberculosis secreted protein MPT64 in human serum | Aptamer | TCACTTCAAATGTGCGCTTC-GTCAACAGTCCAGTTGGGAGGTCGCTTATAGCTGCTTGTC-CGTCAAAACAGGGGGTAGAA | 80 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Developed an electrochemical aptasensor using thiol PEGylated aptamer HS-(CH2)6-OP(O)2O-(CH2CH2O)6-TTTTT-aptamer and 6-mercaptohexanol for the detection of MPT64. | A spiked human serum sample displays a limit of detection of 81 pM in 30 minutes with the long linker aptamer/MCH. | N/A | N/A | 8.92 nM | Biosensor | N/A | HS-(CH2)6-OP(O)2O-(CH2CH2O)6-5'-TTTTT-aptamer-3' and HS-(CH2)6-5'-TTTTT-aptamer-3' | N/A | N/A | N/A | N/A | N/A |
| ABdb_1553 | 34578762 | 2021 | Aptasensor for the Detection of Mycobacterium tuberculosis in Sputum Utilising CFP10-ESAT6 Protein as a Selective Biomarker | Aptamer | GCCTGTTGTGAGCCTCCTAACCCCATCTTATACGTATATGGACTCATCTCGACCCCCGATAGGCTTGGTACATGCTTATTCTTGTCTCCC | 90 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | ESAT6/CFP10 fusion proteins (EC proteins) | Developed a portable electrochemical aptamer-antibody-based sandwich biosensor via CapApt/GP/PANI-modified SPGE surface for M. tb. detection in clinical sputum samples. | Detection of the CFP10-ESAT6 antigen ranged from 5 to 500 ng/mL, with a detection limit of 1.5 ng/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1566 | 34731314 | 2021 | An electrochemical aptasensor for Mycobacterium tuberculosis ESAT-6 antigen detection using bimetallic organic framework | EBA | GGGAGCTCAGAATAAACGCTCAACCTCCCTGGGTCACCATAGACTCCATCTAAGATGCTTCGACATGAGGCCCGGATC | 78 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | ESAT-6 (6-kDa early secretory antigenic target) | A label-free electrochemical aptasensor was developed using NG@Zr-MOF-on-Ce-MOF@Tb nanohybrid for sensitive detection of ESAT-6. | Displayed a wide linear range from 100 fg/mL to 10 ng/mL with a limit of detection (LOD) of 12 fg/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Phosphate (PO4(-3)) | N/A | The current remained at 95.77% and 88.72% of the initial current after storing at at 4℃ for 8 days and 16 days, respectively. | N/A | N/A | N/A |
| ABdb_1664 | 36332135 | 2022 | DNA Aptamer Targets Mycobacterium tuberculosis DevR/DosR Response Regulator Function by Inhibiting Its Dimerization and DNA Binding Activity | R6DevR22 (APT-1) | GTCTTGACTAGTTACGCC-CTGCTGGTCTTTAGTCTCTATTGAGTGGCTAAAGTTGAGGCAG-TCATTCAGTTGGCGCCTC | 79 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | DevR protein | Identify an aptamer against DevR and inhibit DevR-dependent transcription by blocking DevR dimerisation and DNA-binding activity in Mycobacterium smegmatis. | APT-1, APT-2, APT-5, and APT-7 exhibited a maximum of ∼40% inhibition of Rv1738 promoter activity. | 8 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Therapeutics | Subtractive Nitrocellulose Membrane (NCM)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1665 | 36332135 | 2022 | DNA Aptamer Targets Mycobacterium tuberculosis DevR/DosR Response Regulator Function by Inhibiting Its Dimerization and DNA Binding Activity | R6DevR25 (APT-2) | GTCTTGACTAGTTACGCC-CTGCCTTTTCAAAAGTTTATTGGGATGTACTTTTGTTCAGGCAG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | DevR protein | By targeting DevR dimerization, it blocks the essential step in DevR activation, thus intercepting dormancy pathways in mycobacteria. | APT-1, APT-2, APT-5, and APT-7 exhibited a maximum of ∼40% inhibition of Rv1738 promoter activity. | 8 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Therapeutics | Subtractive Nitrocellulose Membrane (NCM)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1666 | 36332135 | 2022 | DNA Aptamer Targets Mycobacterium tuberculosis DevR/DosR Response Regulator Function by Inhibiting Its Dimerization and DNA Binding Activity | R6DevR28 (APT-3) | GTCTTGACTAGTTACGCC-CATAAACGCAGTGACGTTCCCAGAATTGTGGCTGATGATTTTGG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | DevR protein | By targeting DevR dimerization, it blocks the essential step in DevR activation, thus intercepting dormancy pathways in mycobacteria. | N/A | 8 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Therapeutics | Subtractive Nitrocellulose Membrane (NCM)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1667 | 36332135 | 2022 | DNA Aptamer Targets Mycobacterium tuberculosis DevR/DosR Response Regulator Function by Inhibiting Its Dimerization and DNA Binding Activity | R6DevR10 (APT-4) | GTCTTGACTAGTTACGCC-GCGAGAATGTGCGCAAAGTCTCATGTCAGTATGTGGTCTTTTCG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | DevR protein | By targeting DevR dimerization, it blocks the essential step in DevR activation, thus intercepting dormancy pathways in mycobacteria. | APT-4 inhibited Rv1738 promoter activity in a time-dependent manner, with an inhibition value of 61% at 96 hours and inhibited DevR–DevR interaction in vivo by ∼35%. | 8 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Therapeutics | Subtractive Nitrocellulose Membrane (NCM)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1668 | 36332135 | 2022 | DNA Aptamer Targets Mycobacterium tuberculosis DevR/DosR Response Regulator Function by Inhibiting Its Dimerization and DNA Binding Activity | R7DevR16 (APT-5) | GTCTTGACTAGTTACGCC-CTGCCTTGGCTCGAAGGGGTGATGAGAAGTAGGCGGGAAGGCAG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | DevR protein | By targeting DevR dimerization, it blocks the essential step in DevR activation, thus intercepting dormancy pathways in mycobacteria. | APT-1, APT-2, APT-5, and APT-7 exhibited a maximum of ∼40% inhibition of Rv1738 promoter activity. | 8 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Therapeutics | Subtractive Nitrocellulose Membrane (NCM)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1669 | 36332135 | 2022 | DNA Aptamer Targets Mycobacterium tuberculosis DevR/DosR Response Regulator Function by Inhibiting Its Dimerization and DNA Binding Activity | R7DevR28 (APT-6) | GTCTTGACTAGTTACGCC-CGAGGGGAAGGATGGGGTGGAGGGAGGTGGGGGAGGGTTGGTGG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | DevR protein | By targeting DevR dimerization, it blocks the essential step in DevR activation, thus intercepting dormancy pathways in mycobacteria. | APT-6 inhibited Rv1738 promoter activity in a time-dependent manner, with an inhibition value of 66% at 96 hours and inhibited DevR–DevR interaction in vivo by ∼35%. | 8 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | 4.724 nM | Therapeutics | Subtractive Nitrocellulose Membrane (NCM)-based SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1670 | 36332135 | 2022 | DNA Aptamer Targets Mycobacterium tuberculosis DevR/DosR Response Regulator Function by Inhibiting Its Dimerization and DNA Binding Activity | R7DevR29 (APT-7) | GTCTTGACTAGTTACGCC-CCCAAGAACCCGCTCGCCGTGGTGACGTCGATCATGCCTTTTGG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | DevR protein | By targeting DevR dimerization, it blocks the essential step in DevR activation, thus intercepting dormancy pathways in mycobacteria. | APT-1, APT-2, APT-5, and APT-7 exhibited a maximum of ∼40% inhibition of Rv1738 promoter activity. | 8 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Therapeutics | Subtractive Nitrocellulose Membrane (NCM)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1713 | 36354505 | 2022 | Simultaneous Amperometric Aptasensor Based on Diazonium Grafted Screen-Printed Carbon Electrode for Detection of CFP10 and MPT64 Biomarkers for Early Tuberculosis Diagnosis | MPT64 aptamer | TTTTTTTTTTGGGAGCTGATGTCGCATGGGTTTTGATCACATGA | 44 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Amperometric dual aptasensor for the simultaneous detection of M. tb. secreted antigens CFP10 and MPT64 for the diagnosis of TB. | Achieved a detection limit of 1.82 ng/mL and a linear range of 0.75–250 ng/mL for MPT64 antigen within 2.5 h. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1714 | 36354505 | 2022 | Simultaneous Amperometric Aptasensor Based on Diazonium Grafted Screen-Printed Carbon Electrode for Detection of CFP10 and MPT64 Biomarkers for Early Tuberculosis Diagnosis | CFP10 aptamer | N/A | N/A | N/A | N/A | Mycobacterium Tuberculosis (M.Tb.) | CFP10 antigen | Amperometric dual aptasensor for the simultaneous detection of M. tb. secreted antigens CFP10 and MPT64 for the diagnosis of TB. | Achieved a detection limit of 1.68 ng/mL and a linear range of 0.5–100 ng/mL for CFP10 antigen within 2.5 h. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1893 | 41245639 | 2025 | Simultaneous and sensitive detection of Mycobacterium tuberculosis and SARS-CoV-2 antigens employing an electrochemical impedance spectroscopy aptasensor | MPT64 aptamer sequence (17) | GTCAACAGTCCAGTTGGGAGGTCGCTTATAGCTGCTTGTC | 40 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Develop an EIS-based aptasensor fabricated to detect MPT64 and S-glycoprotein simultaneously, employing a dual-platform approach on a screen-printed gold electrode (SPGE). | Achieved detection limits of 0.053 pg/mL in buffer and in human serum of 0.085 pg/mL with a linear range of 0.01 pg/mL to 10 pg/mL in both buffer and human serum. | N/A | N/A | 8.92 nM | Biosensor | N/A | 5'-Thiolated (HS(CH2)6-(CH2CH2O)6-TTTTT) | N/A | The aptasensor maintained good storage stability for up to 22 days. | N/A | N/A | N/A |
| ABdb_1903 | 41339596 | 2025 | Self-reduced Pd nanoparticles on NiMn-LDHs with superior catalytic activity for signal amplification in electrochemical aptasensing of Mycobacterium tuberculosis ESAT-6 antigen | Apt | GGGAGCTCAGAATAAACGCTCAACCTCCCTGGGTCACCATAGACTCCATCTAAGATGCTTCGACATGAGGCCCGGATC | 78 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | ESAT-6 (6-kDa early secretory antigenic target) | Developed an electrochemical aptasensor using NiMn-layered double hydroxides@palladium nanoparticles (NiMn-LDHs@PdNPs) for detecting the ESAT-6 antigen in human serum. | The aptasensor exhibited a wide linear detection range of 75 pg/mL to 10 ng/mL with a low limit of detection (LOD) of 0.629 pg/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) and 5'-Biotinylated | N/A | Aptasensor was stored at 4°C for and after 30 days, the current remained approximately 80% of the initial value. | N/A | N/A | N/A |
| ABdb_1959 | 23056492 | 2012 | Selection and application of ssDNA aptamers to detect active TB from sputum samples | CSIR 2.11 | N/A | N/A | 5'-GCCTGTTGTGAGCCTCCTAAC-N49-CATGCTTATTCTTGTCTCCC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | CFP-10 and ESAT-6 monomer and heterodimer | Identify aptamers against the CFP-10.ESAT-6 heterodimer and active TB from human sputum samples. | CSIR 2.11 achieved 100% sensitivity and 68.75% specificity in detecting antigen in sputum samples. | 6 | Surface Plasmon Resonance (SPR) | 8 ± 1.07 nM | Detection | SELEX | Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1960 | 23056492 | 2012 | Selection and application of ssDNA aptamers to detect active TB from sputum samples | CSIR 2.19 | N/A | N/A | 5'-GCCTGTTGTGAGCCTCCTAAC-N49-CATGCTTATTCTTGTCTCCC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | CFP-10 and ESAT-6 monomer and heterodimer | Identify aptamers against the CFP-10.ESAT-6 heterodimer and active TB from human sputum samples. | N/A | 6 | Surface Plasmon Resonance (SPR) | 1.6 ± 0.5 nM | Detection | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1961 | 23056492 | 2012 | Selection and application of ssDNA aptamers to detect active TB from sputum samples | CSIR 2.2 | N/A | N/A | 5'-GCCTGTTGTGAGCCTCCTAAC-N49-CATGCTTATTCTTGTCTCCC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | CFP-10 and ESAT-6 monomer and heterodimer | Identify aptamers against the CFP-10.ESAT-6 heterodimer and active TB from human sputum samples. | N/A | 6 | Surface Plasmon Resonance (SPR) | 21.5 ± 4.3 nM | Detection | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1962 | 23056492 | 2012 | Selection and application of ssDNA aptamers to detect active TB from sputum samples | CSIR 2.15 | N/A | N/A | 5'-GCCTGTTGTGAGCCTCCTAAC-N49-CATGCTTATTCTTGTCTCCC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | CFP-10 and ESAT-6 monomer and heterodimer | Identify aptamers against the CFP-10.ESAT-6 heterodimer and active TB from human sputum samples. | N/A | 6 | Surface Plasmon Resonance (SPR) | 12 ± 1.6 nM | Detection | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1963 | 23056492 | 2012 | Selection and application of ssDNA aptamers to detect active TB from sputum samples | CSIR 2.21 | N/A | N/A | 5'-GCCTGTTGTGAGCCTCCTAAC-N49-CATGCTTATTCTTGTCTCCC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | CFP-10 and ESAT-6 monomer and heterodimer | Identify aptamers against the CFP-10.ESAT-6 heterodimer and active TB from human sputum samples. | N/A | 6 | Surface Plasmon Resonance (SPR) | 10.2 ± 3.4 nM | Detection | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_2010 | 24968239 | 2014 | CFP10 and ESAT6 aptamers as effective Mycobacterial antigen diagnostic reagents | CE24 | N/A | N/A | 5'-GCGGAATTCTAATACGACTCACTATAGGGA ACAGTCCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | CE (Culture filtrate protein (CFP10) and Early secreted antigenic target (ESAT6)) proteins | Identify aptamers against CE proteins and develop an aptamer-based ELONA assay for detection in serum samples. | Sensitivity and specificity using CE24 aptamer-based ELONA) were 100% and 94.1%. | 15 | Enzyme-Linked Immunosorbent Assay (ELISA) | 3.75 × 10(−7) M | Detection | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_2011 | 24968239 | 2014 | CFP10 and ESAT6 aptamers as effective Mycobacterial antigen diagnostic reagents | CE15 | N/A | N/A | 5'-GCGGAATTCTAATACGACTCACTATAGGGA ACAGTCCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | CE (Culture filtrate protein (CFP10) and Early secreted antigenic target (ESAT6)) proteins | Identify aptamers against CE proteins and develop an aptamer-based ELONA assay for detection in serum samples. | Sensitivity and specificity using CE15 aptamer-based ELONA) were 89.6% and 94.1%. | 15 | Enzyme-Linked Immunosorbent Assay (ELISA) | 1.6 × 10(−7) M | Detection | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_2018 | 26850356 | 2016 | Generation and application of ssDNA aptamers against glycolipid antigen ManLAM of Mycobacterium tuberculosis for TB diagnosis | T9 | N/A | N/A | 5'-GCGGAATTCAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) Beijing genotype strains | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify an aptamer against ManLAM and develop an ELONA-based assay for the diagnosis of TB antigens using serum or sputum samples. | Specificity and sensitivity were 95.31% and 83.00% (for 100 aPTB serum samples), 98.70% and 92.71% (for 96 aPTB sputum samples), and 94.44% and 88.71% (for 62 EPTB serum samples), respectively. | 13 | Enzyme-Linked Oligonucleotide Assay (ELONA) | 668 ± 159 nM | Detection | SELEX | Biotinylated or FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_2019 | 26850356 | 2016 | Generation and application of ssDNA aptamers against glycolipid antigen ManLAM of Mycobacterium tuberculosis for TB diagnosis | T25 | N/A | N/A | 5'-GCGGAATTCAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) Beijing genotype strains | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify an aptamer against ManLAM and develop an ELONA-based assay for the diagnosis of TB antigens using serum or sputum samples. | N/A | 13 | Enzyme-Linked Oligonucleotide Assay (ELONA) | 685 ± 131 nM | Detection | SELEX | Biotinylated or FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_2020 | 26850356 | 2016 | Generation and application of ssDNA aptamers against glycolipid antigen ManLAM of Mycobacterium tuberculosis for TB diagnosis | T14 | N/A | N/A | 5'-GCGGAATTCAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) Beijing genotype strains | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify an aptamer against ManLAM and develop an ELONA-based assay for the diagnosis of TB antigens using serum or sputum samples. | N/A | 13 | Enzyme-Linked Oligonucleotide Assay (ELONA) | 815 ± 144 nM | Detection | SELEX | Biotinylated or FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_2021 | 26850356 | 2016 | Generation and application of ssDNA aptamers against glycolipid antigen ManLAM of Mycobacterium tuberculosis for TB diagnosis | T15 | N/A | N/A | 5'-GCGGAATTCAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) Beijing genotype strains | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify an aptamer against ManLAM and develop an ELONA-based assay for the diagnosis of TB antigens using serum or sputum samples. | N/A | 13 | Enzyme-Linked Oligonucleotide Assay (ELONA) | 736 ± 207 nM | Detection | SELEX | Biotinylated or FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_2022 | 26850356 | 2016 | Generation and application of ssDNA aptamers against glycolipid antigen ManLAM of Mycobacterium tuberculosis for TB diagnosis | T6 | N/A | N/A | 5'-GCGGAATTCAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) Beijing genotype strains | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify an aptamer against ManLAM and develop an ELONA-based assay for the diagnosis of TB antigens using serum or sputum samples. | N/A | 13 | Enzyme-Linked Oligonucleotide Assay (ELONA) | 998 ± 207 nM | Detection | SELEX | Biotinylated or FAM Labeled | N/A | N/A | N/A | N/A | N/A |