Target Organism : Leptospira Interrogans

Total records found: 3

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_1789 375919002023Aptamer-based assay for rapid detection, surveillance, and screening of pathogenic Leptospira in water samplesLAP1GGGCGTTAAAGATACAGGAACCGGTGTCGAGGTCTGAAGAATCCT455'-GAGTATCCAGACGCAGCA-N45-TGGACAGGCTTAGTCGGT-3'ssDNALeptospira InterrogansOuter membrane protein (OMP)Development of an aptamer-gold nanoparticle-based colorimetric assay for pathogenic Leptospira detection.N/A10Fluorescence SpectroscopyN/ABiosensorModified Microtiter Plate-based Cell SELEX5'-FITC LabeledN/AN/AN/AN/APatent Application No. 202241038353
ABdb_1790 375919002023Aptamer-based assay for rapid detection, surveillance, and screening of pathogenic Leptospira in water samplesLAP2CGTACGTCTGTCTCTGCATCTTATTGCTATGGAATAATGTTGTTCTGG485'-GAGTATCCAGACGCAGCA-N45-TGGACAGGCTTAGTCGGT-3'ssDNALeptospira InterrogansOuter membrane protein (OMP)Development of an aptamer-gold nanoparticle-based colorimetric assay for pathogenic Leptospira detection.N/A10Fluorescence SpectroscopyN/ABiosensorModified Microtiter Plate-based Cell SELEX5'-FITC LabeledN/AN/AN/AN/APatent Application No. 202241038353
ABdb_1791 375919002023Aptamer-based assay for rapid detection, surveillance, and screening of pathogenic Leptospira in water samplesLAP3TGGCGTTAGAGATACCGGAACCGGTGTCGGGCGTCTGAAGAATCC455'-GAGTATCCAGACGCAGCA-N45-TGGACAGGCTTAGTCGGT-3'ssDNALeptospira InterrogansOuter membrane protein (OMP)Development of an aptamer-gold nanoparticle-based colorimetric assay for pathogenic Leptospira detection.Exhibited a detection limit of 57 CFU/mL and a linear response in the concentration range of 6 × 10(5) to 60 CFU/mL.10Fluorescence Spectroscopy133.13 ± 22 nMBiosensorModified Microtiter Plate-based Cell SELEX5'-FITC LabeledN/AN/ABest CandidateN/APatent Application No. 202241038353