AptBacterialDB

Target Organism : Legionella Pneumophila

Total records found: 9

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_1367 324995572020Identification of two aptamers binding to Legionella pneumophila with high affinity and specificityR10C5GCAATGGTACGGTACTTCCGGACAGTGCTGAAAACTGTGACCCCCCAAAAGTGCACGCTACTTTGCTAA695'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3'ssDNALegionella Pneumophila (Lp 120292)Whole cellIdentify an aptamer against Lp and utilise it as a biorecognition element in a biosensor to detect Lp in real-time and in situ.Around 60% of lp120292 cells are stained by R10C5 and 20% of Pseudomonas strains.10Flow Cytometry116 nMBiosensorWhole Cell-SELEX5'-FITC LabeledN/AN/AN/AN/APatent application no US 16/850,355
ABdb_1368 324995572020Identification of two aptamers binding to Legionella pneumophila with high affinity and specificityR10C1GCAATGGTACGGTACTTCCCCACCCCACGCTGCTCCCAAAAGTGCACGCTACTTTGCTAA605'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3'ssDNALegionella Pneumophila (Lp 120292)Whole cellIdentify an aptamer against Lp and utilise it as a biorecognition element in a biosensor to detect Lp in real-time and in situ.R10C1 shows significantly more binding to Lp than to Pseudomonas.10Flow Cytometry135 nMBiosensorWhole Cell-SELEX5'-FITC LabeledN/AN/AN/AN/APatent application no US 16/850,355
ABdb_1739 https://doi.org/10.1016/j.snb.2021.1309332022Introducing an SPRi-based titration assay using aptamers for the detection of Legionella pneumophilaR10C5GCAATGGTACGGTACTTCCGGACAGTGCTGAAAACTGTGACCCCCCAAAAGTGCACGCTACTTTGCTAA69N/AssDNALegionella Pneumophila (Lp) strain Lp02Whole cellSPRi-based titration assay using Lp aptamer for detecting L. pneumophila.The limit of detection for this system was 10(4.4) cells/ml, with a linear dynamic range of 10(4.3) –10(7.7) cells/ml.N/AN/AN/ABiosensorWhole Cell-SELEX5'-BiotinylatedN/AN/AN/AN/APatent application no US 16/850,355
ABdb_1832 388981152024Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1AY-19TCCCTACGGCGCTAAC-GACATGATGGTGCCAAACAACATTCGGAAAGCCTGACCGT-CCACCGTGCTACAAC715'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3'ssDNALegionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152)Whole cellIdentify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection.Limit of Detection (LOD): 4.6 CFU/mL and linear trend ranging from 10 to 10(8) CFU/mL.10Fluorescence Binding Assay14.19 nMDetectionWhole Cell-SELEX5'-Thiolated and 5'-FITC LabeledN/AN/ABest CandidateN/AN/A
ABdb_1833 388981152024Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1AY-3TCCCTACGGCGCTAAC-TGGCAAATAATGCAATTGAAGAAAGCCCCCCCCTGCCCGA-CCACCGTGCTACAAC715'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3'ssDNALegionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152)Whole cellIdentify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection.N/A10Fluorescence Binding Assay15.61 nMDetectionWhole Cell-SELEX5'-Thiolated and 5'-FITC LabeledN/AN/AN/AN/AN/A
ABdb_1834 388981152024Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1AY-29TCCCTACGGCGCTAAC-TGTGAAACAAGGCAAGGGAACTGACGTCATAAGGATAGCA-CCACCGTGCTACAAC715'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3'ssDNALegionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152)Whole cellIdentify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection.N/A10Fluorescence Binding Assay17.38 nMDetectionWhole Cell-SELEX5'-Thiolated and 5'-FITC LabeledN/AN/AN/AN/AN/A
ABdb_1835 388981152024Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1AY-37TCCCTACGGCGCTAAC-AAGATGAAAGACGACCGGACAGTACATATAGCGCTCTCGC-CCACCGTGCTACAAC715'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3'ssDNALegionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152)Whole cellIdentify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection.N/A10Fluorescence Binding Assay17.96 nMDetectionWhole Cell-SELEX5'-Thiolated and 5'-FITC LabeledN/AN/AN/AN/AN/A
ABdb_1836 388981152024Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1AY-31TCCCTACGGCGCTAAC-ACCTGCAGTAGGGAATGCGAATGATGAGACGCCTGATTGG-CCACCGTGCTACAAC715'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3'ssDNALegionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152)Whole cellIdentify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection.N/A10Fluorescence Binding Assay68.83 nMDetectionWhole Cell-SELEX5'-Thiolated and 5'-FITC LabeledN/AN/AN/AN/AN/A
ABdb_1837 388981152024Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1AY-24TCCCTACGGCGCTAAC-ACAGACAGAATGAGTGAACATAGGCCAATAACGCACGTCC-CCACCGTGCTACAAC715'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3'ssDNALegionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152)Whole cellIdentify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection.N/A10Fluorescence Binding Assay75.24 nMDetectionWhole Cell-SELEX5'-Thiolated and 5'-FITC LabeledN/AN/AN/AN/AN/A