Target Organism : Lactobacillus CaseI

Total records found: 3

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_1321 315633152019Rapid identification and quantitation of the viable cells of Lactobacillus casei in fermented dairy products using an aptamer-based strategy powered by a novel cell-SELEX protocolApt-1ATCGTATACCTAGAAGATATGACCGGCAGTTGATGAGATAGAGGCGCTGGTGGGTAGATA605'-TCAGCACGT-N60-TCCACTGAGAGATCC-3'ssDNALactobacillus Casei (ATCC 393)Whole cellAn aptamer-based strategy using PEG and chitosan-modified graphene oxide, with complementary ring-mediated RCA, was developed for qualitative and quantitative detection of viable L. casei in dairy products.N/A8Flow Cytometry21.1 ± 2.7 nMDetectionWhole Cell-SELEXN/AN/AN/AN/AN/AN/A
ABdb_1322 315633152019Rapid identification and quantitation of the viable cells of Lactobacillus casei in fermented dairy products using an aptamer-based strategy powered by a novel cell-SELEX protocolApt-2GGCTCACCTACAGGCTGCGGAGTCATAGCATCGTGACAGAGTCGAGTGTCGACTATACGT605'-TCAGCACGT-N60-TCCACTGAGAGATCC-3'ssDNALactobacillus Casei (ATCC 393)Whole cellAn aptamer-based strategy using PEG and chitosan-modified graphene oxide, with complementary ring-mediated RCA, was developed for qualitative and quantitative detection of viable L. casei in dairy products.Achieved a detection limit of 10(5) cfu/mL and selective detection of L. casei in commercial dairy drinks, with a dynamic range of 10(5) to 10(9) cfu/mL.8Flow Cytometry19.3 ± 3.7 nMDetectionWhole Cell-SELEX3'-Biotinylated (biotin-AAAAAAAAAA)N/AN/AN/AN/AN/A
ABdb_1323 315633152019Rapid identification and quantitation of the viable cells of Lactobacillus casei in fermented dairy products using an aptamer-based strategy powered by a novel cell-SELEX protocolApt-3TCGAAGTGAGCGCGCGGTGTGGTGACTGTGTTGCAGATGGATGCATGGAGGTGATGATGA605'-TCAGCACGT-N60-TCCACTGAGAGATCC-3'ssDNALactobacillus Casei (ATCC 393)Whole cellAn aptamer-based strategy using PEG and chitosan-modified graphene oxide, with complementary ring-mediated RCA, was developed for qualitative and quantitative detection of viable L. casei in dairy products.Achieved a detection limit of 10(5) cfu/mL and selective detection of L. casei in commercial dairy drinks, with a dynamic range of 10(5) to 10(9) cfu/mL.8Flow Cytometry15.6 ± 4.1 nMDetectionWhole Cell-SELEX5'-FITC LabeledN/AN/ABest CandidateN/AN/A