Target Organism : Klebsiella Pneumoniae

Total records found: 21

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_0918	28119514	2017	High Efficiency Binding Aptamers for a Wide Range of Bacterial Sepsis Agents	Antibac1	TCGCGCGAGTCGTCTG-GGGACAGGGAGTGCGCTGCTCCCC-CCGCATCGTCCTCCC	55	N/A	ssDNA	Escherichia Coli (E. Coli) (ATCC 25922), Klebsiella Pneumoniae (ATCC 27853), Proteus Mirabilis (ATCC 00557), Pseudomonas Aeruginosa (ATCC 700603), Staphylococcus aureus (S. aureus) (ATCC 29213), Streptococcus Pneumoniae (ATCC 23855), and Enterococcus Faecium (ATCC 29212), and Proteus Vulgaris, Morganella Morganii, Citrobacter Freundii, and Acinetobacter Baumannii	Peptidoglycan	Develop generic probes as biological recognition elements in biosensors for sepsis diagnosis in the clinical setting.	Antibac1 bound with higher efficiency to both gram-positive (S. aureus, S. penumoniae, L. monocytogenes) and gram-negative (A. baumannii, C. freudii, K. pneumoniae, P. aeruginosa, P. mirabilis).	N/A	Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)	268.50 ± 54.34 nM (for A. baumannii); 51.74 ± 11.75 nM (for L. monocytogenes); 31.82 ± 4.38 nM (for E.coli); 170.10 ± 32.13 nM (for S.aureus) and 256.10 ± 47.89 nM (for K. pneumoniae)	Diagnostic	N/A	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_0919	28119514	2017	High Efficiency Binding Aptamers for a Wide Range of Bacterial Sepsis Agents	Antibac2	TCGCGCGAGTCGTCTG-GGGGACTAGAGGACTTGTGCGGCC-CCGCATCGTCCTCCC	55	N/A	ssDNA	Escherichia Coli (E. Coli) (ATCC 25922), Klebsiella Pneumoniae (ATCC 27853), Proteus Mirabilis (ATCC 00557), Pseudomonas Aeruginosa (ATCC 700603), Staphylococcus aureus (S. aureus) (ATCC 29213), Streptococcus Pneumoniae (ATCC 23855), and Enterococcus Faecium (ATCC 29212), and Proteus Vulgaris, Morganella Morganii, Citrobacter Freundii, and Acinetobacter Baumannii	Peptidoglycan	Develop generic probes as biological recognition elements in biosensors for sepsis diagnosis in the clinical setting.	Antibac2 bound with higher efficiency to the gram-positive species S. aureus and E. faecium and to the gram-negative species (A. baumannii, C. freudii, K. pneumoniae, M. moraganii, P. aeruginosa, P. mirabilis, and E. coli).	N/A	Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)	71.92 ± 9.74 nM (for A. baumannii); 54.19 ± 12.09 nM (for L. monocytogenes); 62.43 ± 11.97 nM (for E.coli); 194.90 ± 38.55 nM (for S.aureus) and 195.90 ± 42.91 nM (for K. pneumoniae)	Diagnostic	N/A	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_0982	28272554	2017	Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX	STC-01	CATATCCGCGTCGCTGCGCTCAGACCCACCACTACGCACC	40	5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'	ssDNA	Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)	Whole cell	Identify aptamers with broad affinity for bacteria across different genera.	N/A	18	N/A	N/A	Detection	Sequential Toggle Cell-SELEX (STC-SELEX)	3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0983	28272554	2017	Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX	STC-02	CATATCCGTGTCGCTGCGCTCAGACCCACCACCACGCACC	40	5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'	ssDNA	Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)	Whole cell	Identify aptamers with broad affinity for bacteria across different genera.	N/A	18	N/A	N/A	Detection	Sequential Toggle Cell-SELEX (STC-SELEX)	3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0984	28272554	2017	Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX	STC-03	CATATCCGCGTCGCTGCGCTCAGACCCACCACCACGCACC	40	5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'	ssDNA	Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)	Whole cell	Identify aptamers with broad affinity for bacteria across different genera.	STC-03 showed better affinity to E. aerogenes, K. pneumoniae, C. freundii, and B. subtilis.	18	Micro-Fluorospectrophotometer (Fluorescence Spectroscopy)	27.2 nM (for E. coli), 11.9 nM (for E. aerogenes), 9.22 nM (for K. pneumoniae), 15.9 nM (for C. freundii), 9.97 nM (for B. subtilis), and 16.4 nM (for S. epidermidis)	Detection	Sequential Toggle Cell-SELEX (STC-SELEX)	3'-FAM Labeled	N/A	N/A	Best Candidate	N/A	N/A
ABdb_0985	28272554	2017	Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX	STC-04	ATATCCGCGTCGCTGCGCTCAGACCCACCACCACGCACC	39	5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'	ssDNA	Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)	Whole cell	Identify aptamers with broad affinity for bacteria across different genera.	N/A	18	N/A	N/A	Detection	Sequential Toggle Cell-SELEX (STC-SELEX)	3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0986	28272554	2017	Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX	STC-05	CATATCCGCGTCGCTGCGCTCAGACCCACCACCCGCCC	38	5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'	ssDNA	Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)	Whole cell	Identify aptamers with broad affinity for bacteria across different genera.	N/A	18	N/A	N/A	Detection	Sequential Toggle Cell-SELEX (STC-SELEX)	3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0987	28272554	2017	Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX	STC-06	GGGCGGGGGTGCTGGGGGAATGGAGTGCTGCGTGCTGCGG	40	5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'	ssDNA	Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)	Whole cell	Identify aptamers with broad affinity for bacteria across different genera.	N/A	18	N/A	N/A	Detection	Sequential Toggle Cell-SELEX (STC-SELEX)	3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0988	28272554	2017	Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX	STC-07	GGGCGGGGGGTGCTGGGGGAATGGAGTGCTGCGTGCTGCG	40	5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'	ssDNA	Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)	Whole cell	Identify aptamers with broad affinity for bacteria across different genera.	N/A	18	N/A	N/A	Detection	Sequential Toggle Cell-SELEX (STC-SELEX)	3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0989	28272554	2017	Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX	STC-08	GGGCGGGGGTGCTGGGAGAATGGAGTGCTGCGTGCTGCAG	40	5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'	ssDNA	Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)	Whole cell	Identify aptamers with broad affinity for bacteria across different genera.	N/A	18	N/A	N/A	Detection	Sequential Toggle Cell-SELEX (STC-SELEX)	3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0990	28272554	2017	Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX	STC-09	GGGCAGGTGTGCTGGGGGAATGGAGTGCTGCGTGCTGCGG	40	5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'	ssDNA	Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)	Whole cell	Identify aptamers with broad affinity for bacteria across different genera.	N/A	18	N/A	N/A	Detection	Sequential Toggle Cell-SELEX (STC-SELEX)	3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0991	28272554	2017	Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX	STC-10	AGACCGCAGGTGCACCGGGCGACGTCTCTGGGTGTGGTGA	40	5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'	ssDNA	Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)	Whole cell	Identify aptamers with broad affinity for bacteria across different genera.	N/A	18	N/A	N/A	Detection	Sequential Toggle Cell-SELEX (STC-SELEX)	3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0992	28272554	2017	Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX	STC-11	AGACCGCAGGTGCACTGGGCGACGTCTCTGGGTGTGGTGT	40	5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'	ssDNA	Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)	Whole cell	Identify aptamers with broad affinity for bacteria across different genera.	N/A	18	N/A	N/A	Detection	Sequential Toggle Cell-SELEX (STC-SELEX)	3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0993	28272554	2017	Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX	STC-12	GGACCGCAGGTGCACTGGGCGACGTCTCTGGGTGTGGTGT	40	5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'	ssDNA	Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)	Whole cell	Identify aptamers with broad affinity for bacteria across different genera.	STC-12 showed better affinity to E. coli and S. epidermidis.	18	Micro-Fluorospectrophotometer (Fluorescence Spectroscopy)	38.5 nM (for E. coli), 33.7 nM (for E. aerogenes), 16.3 nM (for K. pneumoniae), 25.6 nM (for C. freundii), 18.9 nM (for B. subtilis), and 13.7 nM (for S. epidermidis)	Detection	Sequential Toggle Cell-SELEX (STC-SELEX)	3'-FAM Labeled	N/A	N/A	Best Candidate	N/A	N/A
ABdb_0994	28272554	2017	Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX	STC-13	GGACGCGCGTTGGTGGTGGATGGTGTGTTACACGTGTTGT	40	5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'	ssDNA	Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)	Whole cell	Identify aptamers with broad affinity for bacteria across different genera.	N/A	18	N/A	N/A	Detection	Sequential Toggle Cell-SELEX (STC-SELEX)	3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0995	28272554	2017	Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX	STC-14	CGGGGTGGGACCAGTCTTGCGCGGGTGAC	29	5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'	ssDNA	Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)	Whole cell	Identify aptamers with broad affinity for bacteria across different genera.	N/A	18	N/A	N/A	Detection	Sequential Toggle Cell-SELEX (STC-SELEX)	3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0996	28272554	2017	Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX	STC-15	GGACTGGAGTCTAGACCGGGTAGCTGTGGT	30	5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'	ssDNA	Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)	Whole cell	Identify aptamers with broad affinity for bacteria across different genera.	N/A	18	N/A	N/A	Detection	Sequential Toggle Cell-SELEX (STC-SELEX)	3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1371	32792573	2020	Electrical antimicrobial susceptibility testing based on aptamer-functionalized capacitance sensor array for clinical isolates	Aptamer 3	N/A	N/A	5'-GCAATGGTACGGTACTTCC-(N45)-CAAAAGTGCACGCTACTTTGCTAA-3'	ssDNA	Klebsiella Pneumoniae (PAE1, PAE2, PAE3, PAE4, PAE5)	Whole cell	Electrical AST (e-AST) chips composed of 60 aptamer-functionalized capacitance sensors to detect bacteria and measure the antibiotic susceptibility to 11 antibiotics at five different concentrations.	The discrepancies between e-AST and BMD tests were estimated to be 2.20% mE, 0.38% ME, and 0.38%, which are lower than the FDA requirements (mE ≤ 10%, ME ≤ 3%, and VME ≤ 1.5%).	N/A	N/A	N/A	Diagnostic	N/A	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1787	37196408	2023	A SERS bioassay based on vancomycin-modified PEI-interlayered nanocomposite and aptamer-functionalized SERS tags for synchronous detection of Acinetobacter baumannii and Klebsiella pneumoniae	K2	AATCAGGCTCAGCATGGAGTTGCGAGGCCAATATCCGGTTAAGCG	45	N/A	ssDNA	Klebsiella Pneumoniae (KP)	Whole cell	A double-edged sword SERS aptasensor was developed using SPION-PEI-Au-Van nanocomposites for synchronous detection of K. pneumoniae and A. baumannii in food and clinical samples.	Shows a limit of detection was 10 cells/mL with a linear range of 50-10(5) cells/mL for both KP and AB.	N/A	N/A	5.377 nM	Biosensor	N/A	5'-Amidation (NH₂-(CH2)6) and 5'-FITC Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1810	37437266	2023	Specific Instantaneous Detection of Klebsiella pneumoniae for UTI Diagnosis with a Plasmonic Gold Nanoparticle Conjugated Aptasensor	KPBA1	GGCTGGATGGGGCGTGT-GGAGCCCCGTTAGAATATCAGAGGTGGTGG-CAACGGTGCGGACAGCG	64	5'-GGCTGGATGGGGCGTGT-30N-CAACGGTGCGGACAGCG-3'	ssDNA	Klebsiella Pneumoniae (MTCC-7028)	Whole cell	Developed localized surface plasmon resonance (LSPR) aptasensor using a tailor-made plasmonic aptamer-gold nanoparticle (AuNP) for detection of Klebsiella pneumoniae.	LoD as low as 3.4 × 10(3) CFU/mL within 5 min.	10	Flow Cytometry	N/A	Biosensor	Whole Cell-SELEX	5′-Thiolated (5′-/5ThioMC6-D) and 5'-FAM Labeled	N/A	N/A	Best Candidate	N/A	N/A
ABdb_1908	40801776	2025	Ultrasensitive Aptamer-Based Metal-Organic Framework-on-Metal-Organic Framework Platform for Clinical Detection of KPC-2 Klebsiella pneumoniae and Multidrug-Resistant Acinetobacter baumannii	KPC-2 KP aptamer	GGCAGGACACCGTAACGGGTATGCAGCTATCCCGGGCGCTGTCTGAAGATCGTGTGCTGC	60	N/A	ssDNA	Klebsiella Pneumoniae carbapenemase 2-expressing K. Pneumoniae (KPC-2 KP)	Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase	Developed a dual nanozyme-powered colorimetric aptasensor leveraging a cascade amplification mechanism, a metal-organic framework (MOF)-on-MOF nanostructure with peroxidase-like activity for detection of KPC-2 K. pneumoniae and MDR-AB.	The system achieves selective bacterial capture within 40 min, quantifying 10–10(8) CFU/mL with a detection limit of 7 CFU/mL for KPC-2 KP.	N/A	N/A	N/A	Biosensor	N/A	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A