Target Organism : Francisella Tularensis

Total records found: 11

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_0417	25536105	2014	A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices	FT17	CGCGTCAGAGGTGTGTCGGGGCTGTGTAGATCTACATGGG	40	WAP40m	ssDNA	Francisella Tularensis	Whole cell	Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil.	This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL.	11	N/A	N/A	Biosensor	SELEX	5'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0418	25536105	2014	A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices	FT12	CAGTCGCTTTCCGTTCTCCGGCAGGTTCATTGTGGTTTCG	40	WAP40m	ssDNA	Francisella Tularensis	Whole cell	Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil.	This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL.	11	N/A	N/A	Biosensor	SELEX	5'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0419	25536105	2014	A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices	FT11	CATATCAGGTCGTCACCGTAACAGAGCTCTCGCAATCACG	40	WAP40m	ssDNA	Francisella Tularensis	Whole cell	Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil.	This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL.	11	N/A	N/A	Biosensor	SELEX	5'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0420	25536105	2014	A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices	FT9	CAAAGGCAGCAGTAGCATGGCGATTTACATCAATTATTGG	40	WAP40m	ssDNA	Francisella Tularensis	Whole cell	Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil.	This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL.	11	N/A	N/A	Biosensor	SELEX	5'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0421	25536105	2014	A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices	FT8	CAATATCAGAAGTAGCGCGAAGGACGACATGTCAGGAAGG	40	WAP40m	ssDNA	Francisella Tularensis	Whole cell	Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil.	This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL.	11	N/A	N/A	Biosensor	SELEX	5'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0422	25536105	2014	A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices	FT7	CACACATCCTCGCAGCCTCGTACCTGATTCCAGTCTATTG	40	WAP40m	ssDNA	Francisella Tularensis	Whole cell	Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil.	This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL.	11	N/A	N/A	Biosensor	SELEX	5'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0423	25536105	2014	A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices	FT6	CCAGGAAGGCGAGAGCCGAGAAGCGATCCTTGGGTATAGG	40	WAP40m	ssDNA	Francisella Tularensis	Whole cell	Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil.	This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL.	11	N/A	N/A	Biosensor	SELEX	5'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0424	25536105	2014	A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices	FT5	CGGCATCCGTTCACGTACCTGTCCTAGTTATCACCGTTTG	40	WAP40m	ssDNA	Francisella Tularensis	Whole cell	Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil.	This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL.	11	N/A	N/A	Biosensor	SELEX	5'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0425	25536105	2014	A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices	FT5.1	CAAGCAGAGTTCCGAGACACAGTACCACACGCATATCCGG	40	WAP40m	ssDNA	Francisella Tularensis	Whole cell	Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil.	This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL.	11	N/A	N/A	Biosensor	SELEX	5'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0426	25536105	2014	A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices	FT4	CACACAGAGACGGTGAAGGCGCCGACCAGTTCCTAAAGAG	40	WAP40m	ssDNA	Francisella Tularensis	Whole cell	Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil.	This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL.	11	N/A	N/A	Biosensor	SELEX	5'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_1954	16550191	2006	Anti-Francisella tularensis DNA aptamers detect tularemia antigen from different subspecies by Aptamer-Linked Immobilized Sorbent Assay	Aptamer cocktail	N/A	N/A	5'-ACCCCTGCAGGATCCTTTGCTGGTACC-N42-AGTATCGCTAATCAGTCTAGAGGGCCCCAGAAT-3'	ssDNA	Francisella Tularensis subspecies (subsp) Japonica	Tularemia Bacterial Antigen	Identify aptamers that bind specifically to the tularemia bacterial antigen from the subspecies japonica or holarctica.	The detection limit for the aptamer cocktail is 25 ng (1.7 × 10^3/ml of bacteria).	10	Aptamer-Linked Immobilized Sorbent Assay (ALISA)	N/A	Biosensor	SELEX	5'-Biotinylated	N/A	N/A	N/A	N/A	N/A