Target Organism : Enterococcus Faecalis

Total records found: 18

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_1374	32792573	2020	Electrical antimicrobial susceptibility testing based on aptamer-functionalized capacitance sensor array for clinical isolates	Aptamer 6	ATCCAGAGTGACGCAGCACGACACGTTAGGTTGGTTAGGTTGGTTAGTTTCTTGTGGACACGGTGGCTTA	70	N/A	ssDNA	Enterococcus Faecalis (R1238, U554, U5179, U4879, U5064)	Whole cell	Electrical AST (e-AST) chips composed of 60 aptamer-functionalized capacitance sensors to detect bacteria and measure the antibiotic susceptibility to 11 antibiotics at five different concentrations.	The discrepancies between e-AST and BMD tests were estimated to be 2.20% mE, 0.38% ME, and 0.38%, which are lower than the FDA requirements (mE ≤ 10%, ME ≤ 3%, and VME ≤ 1.5%).	N/A	N/A	N/A	Diagnostic	N/A	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1386	33262379	2020	DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing	EF501	TAGGGAAGAGAAGGACATATGAT-TTTCTCAACGGGACCATCACTTACCTCAAGTACTTGGACG-TTGACTAGTACATGACCACTTGA	86	5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3'	ssDNA	Enterococcus faecalis (E. faecalis) DSM-20478	Whole cell	Identify aptamers against E.faecalis and can discriminate them from other species.	N/A	11	Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)	N/A	Detection	Whole Cell-SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1387	33262379	2020	DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing	EF502	TAGGGAAGAGAAGGACATATGAT-CCGGCTATCTCCCTACCGTGGCCGAGTACCTCAAACGTTT-TTGACTAGTACATGACCACTTGA	86	5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3'	ssDNA	Enterococcus faecalis (E. faecalis) DSM-20478	Whole cell	Identify aptamers against E.faecalis and can discriminate them from other species.	N/A	11	Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)	N/A	Detection	Whole Cell-SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1388	33262379	2020	DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing	EF503	TAGGGAAGAGAAGGACATATGAT-GTCAACTCATTTATGGTGCTCCTCGTACCTCAGGTGGTTA-TTGACTAGTACATGACCACTTGA	86	5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3'	ssDNA	Enterococcus faecalis (E. faecalis) DSM-20478	Whole cell	Identify aptamers against E.faecalis and can discriminate them from other species.	N/A	11	Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)	N/A	Detection	Whole Cell-SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1389	33262379	2020	DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing	EF504	TAGGGAAGAGAAGGACATATGAT-GGCCATACCTCGTGCCTTCTGTGATCATCTCTATCAATTG-TTGACTAGTACATGACCACTTGA	86	5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3'	ssDNA	Enterococcus faecalis (E. faecalis) DSM-20478	Whole cell	Identify aptamers against E.faecalis and can discriminate them from other species.	N/A	11	Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)	N/A	Detection	Whole Cell-SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1390	33262379	2020	DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing	EF505	TAGGGAAGAGAAGGACATATGAT-CCTCTCTCTTACTGCTACTGGGCAGGGTACTCAATTACGT-TTGACTAGTACATGACCACTTGA	86	5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3'	ssDNA	Enterococcus faecalis (E. faecalis) DSM-20478	Whole cell	Identify aptamers against E.faecalis and can discriminate them from other species.	N/A	11	Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)	N/A	Detection	Whole Cell-SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1391	33262379	2020	DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing	EF506	TAGGGAAGAGAAGGACATATGAT-CGGTCCCGACTCAATATTGTTCCCTCCCCTTATCAGGCGG-TTGACTAGTACATGACCACTTGA	86	5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3'	ssDNA	Enterococcus faecalis (E. faecalis) DSM-20478	Whole cell	Identify aptamers against E.faecalis and can discriminate them from other species.	N/A	11	Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)	N/A	Detection	Whole Cell-SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1392	33262379	2020	DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing	EF507	TAGGGAAGAGAAGGACATATGAT-TCCTCTAATCAACTCTATGCCTTATCCCCTTGGTCAGGAC-TTGACTAGTACATGACCACTTGA	86	5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3'	ssDNA	Enterococcus faecalis (E. faecalis) DSM-20478	Whole cell	Identify aptamers against E.faecalis and can discriminate them from other species.	N/A	11	Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)	N/A	Detection	Whole Cell-SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1393	33262379	2020	DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing	EF508	TAGGGAAGAGAAGGACATATGAT-ACTGGCCTTGACACCCTGTTGTGGCTTGATGACAATAACA-TTGACTAGTACATGACCACTTGA	86	5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3'	ssDNA	Enterococcus faecalis (E. faecalis) DSM-20478	Whole cell	Identify aptamers against E.faecalis and can discriminate them from other species.	EF508 exhibited more than 20- to 800-fold higher binding to E. faecalis target cells than to non-target cells.	11	Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)	37 ± 4 nM	Detection	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	Best Candidate	N/A	N/A
ABdb_1394	33262379	2020	DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing	EF509	TAGGGAAGAGAAGGACATATGAT-CCTCACTCTTGACCCAAAGTGCATGCTCTATTCATTCGGA-TTGACTAGTACATGACCACTTGA	86	5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3'	ssDNA	Enterococcus faecalis (E. faecalis) DSM-20478	Whole cell	Identify aptamers against E.faecalis and can discriminate them from other species.	N/A	11	Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)	N/A	Detection	Whole Cell-SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1395	33262379	2020	DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing	EF510	TAGGGAAGAGAAGGACATATGAT-GCTTCTGTGCACATTAAGGCACTCGTCTTCACTGTGGTTC-TTGACTAGTACATGACCACTTGA	86	5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3'	ssDNA	Enterococcus faecalis (E. faecalis) DSM-20478	Whole cell	Identify aptamers against E.faecalis and can discriminate them from other species.	N/A	11	Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)	N/A	Detection	Whole Cell-SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1396	33262379	2020	DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing	EF511	TAGGGAAGAGAAGGACATATGAT-CCTAACTCACTTACCAGCACGAGGTGCCTGTACCATCAAT-TTGACTAGTACATGACCACTTGA	86	5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3'	ssDNA	Enterococcus faecalis (E. faecalis) DSM-20478	Whole cell	Identify aptamers against E.faecalis and can discriminate them from other species.	N/A	11	Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)	N/A	Detection	Whole Cell-SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1397	33262379	2020	DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing	EF512	TAGGGAAGAGAAGGACATATGAT-CTCTCATCACAGGAATTTGAATTTCCCTTGTGGACAGTAA-TTGACTAGTACATGACCACTTGA	86	5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3'	ssDNA	Enterococcus faecalis (E. faecalis) DSM-20478	Whole cell	Identify aptamers against E.faecalis and can discriminate them from other species.	N/A	11	Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)	N/A	Detection	Whole Cell-SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1398	33262379	2020	DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing	EF513	TAGGGAAGAGAAGGACATATGAT-GATGTGAATTCCGTCCCTTGGTCAGACACTTCAACACCGG-TTGACTAGTACATGACCACTTGA	86	5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3'	ssDNA	Enterococcus faecalis (E. faecalis) DSM-20478	Whole cell	Identify aptamers against E.faecalis and can discriminate them from other species.	N/A	11	Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)	N/A	Detection	Whole Cell-SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1399	33262379	2020	DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing	EF514	TAGGGAAGAGAAGGACATATGAT-TCTCGACGCTATGATCAAGACGCAGTATGATGGCACATCA-TTGACTAGTACATGACCACTTGA	86	5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3'	ssDNA	Enterococcus faecalis (E. faecalis) DSM-20478	Whole cell	Identify aptamers against E.faecalis and can discriminate them from other species.	N/A	11	Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)	N/A	Detection	Whole Cell-SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1400	33262379	2020	DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing	EF515	TAGGGAAGAGAAGGACATATGAT-TTAACCCTCATTTAATGGCCGCGTCAATCCGCAAAGGGTC-TTGACTAGTACATGACCACTTGA	86	5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3'	ssDNA	Enterococcus faecalis (E. faecalis) DSM-20478	Whole cell	Identify aptamers against E.faecalis and can discriminate them from other species.	N/A	11	Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)	N/A	Detection	Whole Cell-SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1401	33262379	2020	DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing	EF516	TAGGGAAGAGAAGGACATATGAT-TTCCTTCGCAGGACACCGATGGCCAGGCGCGAGTCAATAT-TTGACTAGTACATGACCACTTGA	86	5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3'	ssDNA	Enterococcus faecalis (E. faecalis) DSM-20478	Whole cell	Identify aptamers against E.faecalis and can discriminate them from other species.	N/A	11	Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)	N/A	Detection	Whole Cell-SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1672	35850461	2022	Aptamer decorated emodin nanoparticles-assisted delivery of dermcidin-derived peptide DCD-1L: Photoactive bio-theragnostic agent for Enterococcus faecalis biofilm destruction	Aptamer	TAGGGAAGAGAAGGACATATGATACTGGCCTTGACACCCTGTTGTGGCTTGATGACAATAACATTGACTAGTACATGACCACTTGA	86	N/A	ssDNA	Enterococcus Faecalis	Whole cell	Apt@EmoNp-DCD-1L that binds E. faecalis, enabling targeted delivery of emodin nanoparticles and DCD-1L for anti-biofilm activity.	aPDT using Apt@EmoNp-DCD-1L caused ≈99.99% reduction of E. faecalis viability and strong biofilm disruption at sub-MIC concentrations (7.8 and 15.6 µM).	N/A	N/A	N/A	Targeted Delivery/Therapeutics	N/A	5'-FAM Labeled and 5'-Amidation (NH₂)	N/A	N/A	N/A	N/A	N/A