AptBacterialDB

Target Organism : Clostridium Difficile

Total records found: 29

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_0499 242874072014Aptamer biosensor for sensitive detection of toxin A of Clostridium difficile using gold nanoparticles synthesized by Bacillus stearothermophilusAptamerTAGTGATGCCTTTGTTGAGA-AGACTTGGGGGCAGGGTCGTGAGGACGTACGTGCGAGTGT-TCTTCATCGTCCACTAAATT805'-TAGTGATGCCTTTGTTGAGA-N40-TCTTCATCGTCCACTAAATT-3'ssDNAClostridium DifficileToxin A (TOA)Developed an electrochemical biosensor to detect TOA based on Nafion-thionine-GNPS-modified screen-printed electrode (SPE).Shows a linear range of 0–200 ng/mL with the detection limit of 1 nM for TOA.N/AN/AN/ABiosensorN/A5'-FITC LabeledN/A87.6% of its original response remaining after storage for 2 weeks at 4°C in PBS (pH 7.0).N/AN/AN/A
ABdb_1203 288826272018Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficileanti-G1CAGGTCCATCGAGTGGTA-GGAGGTATTTAGTGCCAAGCCATCTCAAACGACGTCTGAG-TCGCACTGCTCCTGAACGTAC795'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3'ssDNAClostridium DifficileGlutamate dehydrogenase (GDH)Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection.N/A10Electrophoretic Mobility Shift Assay (EMSA)3.1 ± 1.2 nMDetectionSELEX5'-Radiolabelled ([γ-32P]-ATP-labeled)N/AN/AN/AN/AN/A
ABdb_1204 288826272018Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficileanti-G3CAGGTCCATCGAGTGGTA-TGCAGCGGACAGTGTGGGACCATCGCTGCGGATGTATGAA-TCGCACTGCTCCTGAACGTAC795'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3'ssDNAClostridium DifficileGlutamate dehydrogenase (GDH)Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection.N/A10Electrophoretic Mobility Shift Assay (EMSA)5.6 ± 2.4 nMDetectionSELEX5'-Radiolabelled ([γ-32P]-ATP-labeled)N/AN/AN/AN/AN/A
ABdb_1205 288826272018Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficileanti-G7CAGGTCCATCGAGTGGTA-CCCAACCCACGATGCGCAAGAGGAATGCAGCCTACCAGCA-TCGCACTGCTCCTGAACGTAC795'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3'ssDNAClostridium DifficileGlutamate dehydrogenase (GDH)Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection.N/A10Electrophoretic Mobility Shift Assay (EMSA)4.6 ± 1.6 nMDetectionSELEX5'-Radiolabelled ([γ-32P]-ATP-labeled)N/AN/ABest CandidateN/AN/A
ABdb_1206 288826272018Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficileanti-G1-T1TAGGAGGAGGTATTTAGTGCCAAGCCATCTCAAACGACGTCTGAGTCGCACTGCTCCTG595'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3'ssDNAClostridium DifficileGlutamate dehydrogenase (GDH)Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection.Achieved a detection limit of 1 nM.10Electrophoretic Mobility Shift Assay (EMSA)4.5 ± 2.2 nMDetectionSELEX5'-Radiolabelled ([γ-32P]-ATP-labeled) and 5'-FAM LabeledN/AN/ABest CandidateN/AN/A
ABdb_1207 288826272018Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficileanti-G2CAGGTCCATCGAGTGGTA-CCGAGTTCCCAATATTATGGCTATGCAGGATACTTCACCT-TCGCACTGCTCCTGAACGTAC795'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3'ssDNAClostridium DifficileGlutamate dehydrogenase (GDH)Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection.N/A10Electrophoretic Mobility Shift Assay (EMSA)N/ADetectionSELEX5'-Radiolabelled ([γ-32P]-ATP-labeled)N/AN/AN/AN/AN/A
ABdb_1208 288826272018Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficileanti-G4CAGGTCCATCGAGTGGTA-TGAGTACTAGTTCCCCAGGAGAAAGCAGATCCCCAGGTAC-TCGCACTGCTCCTGAACGTAC795'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3'ssDNAClostridium DifficileGlutamate dehydrogenase (GDH)Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection.N/A10Electrophoretic Mobility Shift Assay (EMSA)N/ADetectionSELEX5'-Radiolabelled ([γ-32P]-ATP-labeled)N/AN/AN/AN/AN/A
ABdb_1209 288826272018Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficileanti-G5CAGGTCCATCGAGTGGTA-GCACAGGACGCAAGATGAATGCAGCATACCAGTCCCTAGA-TCGCACTGCTCCTGAACGTAC795'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3'ssDNAClostridium DifficileGlutamate dehydrogenase (GDH)Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection.N/A10Electrophoretic Mobility Shift Assay (EMSA)N/ADetectionSELEX5'-Radiolabelled ([γ-32P]-ATP-labeled)N/AN/AN/AN/AN/A
ABdb_1210 288826272018Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficileanti-G6CAGGTCCATCGAGTGGTA-CAGCTGTCGACGCGTTACCGTGAACGGAACACCGATGACG-TCGCACTGCTCCTGAACGTAC795'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3'ssDNAClostridium DifficileGlutamate dehydrogenase (GDH)Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection.N/A10Electrophoretic Mobility Shift Assay (EMSA)N/ADetectionSELEX5'-Radiolabelled ([γ-32P]-ATP-labeled)N/AN/AN/AN/AN/A
ABdb_1211 288826272018Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficileanti-G8CAGGTCCATCGAGTGGTA-TGCGTGATTGGACCAGGGAAAGATGCACCGCAAGACAAGA-TCGCACTGCTCCTGAACGTAC795'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3'ssDNAClostridium DifficileGlutamate dehydrogenase (GDH)Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection.N/A10Electrophoretic Mobility Shift Assay (EMSA)N/ADetectionSELEX5'-Radiolabelled ([γ-32P]-ATP-labeled)N/AN/AN/AN/AN/A
ABdb_1212 288826272018Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficileanti-G9CAGGTCCATCGAGTGGTA-AGGATAATCCGATACGCAAGAAGAAAGCAGATTACCAGGA-TCGCACTGCTCCTGAACGTAC795'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3'ssDNAClostridium DifficileGlutamate dehydrogenase (GDH)Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection.N/A10Electrophoretic Mobility Shift Assay (EMSA)N/ADetectionSELEX5'-Radiolabelled ([γ-32P]-ATP-labeled)N/AN/AN/AN/AN/A
ABdb_1213 288826272018Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficileanti-G10CAGGTCCATCGAGTGGTA-CAAAGTCGGCAAGGTGGAAAGCAGCCACACCACGACTAGT-TCGCACTGCTCCTGAACGTAC795'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3'ssDNAClostridium DifficileGlutamate dehydrogenase (GDH)Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection.N/A10Electrophoretic Mobility Shift Assay (EMSA)N/ADetectionSELEX5'-Radiolabelled ([γ-32P]-ATP-labeled)N/AN/AN/AN/AN/A
ABdb_1971 236802402013Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers4936–4N/AN/AN/AssDNAClostridium DifficileToxin A (TcdA)Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin.N/A8Equilibrium Binding Assay3.1 nMDetectionSELEX5-tyrosylaminocarbonyl-dU (TyrdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_1972 236802402013Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers4939–280N/AN/AN/AssDNAClostridium DifficileToxin A (TcdA)Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin.N/A8Equilibrium Binding Assay1.6 nMDetectionSELEX5-naphthylmethylaminocarbonyl-dU (NapdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_1973 236802402013Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers4943–51N/AN/AN/AssDNAClostridium DifficileToxin A (TcdA)Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin.Developed toxin assays show a limit of detection of 1 pmol/L (300 pg/mL) and a 3-log dynamic range.8Equilibrium Binding Assay1.3 nMDetectionSELEX5-tyrosylaminocarbonyl-dU (TyrdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT)N/AN/ABest CandidateN/AN/A
ABdb_1974 236802402013Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers5564–89N/AN/AN/AssDNAClostridium DifficileToxin A (TcdA)Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin.N/A8Equilibrium Binding Assay9.8 nMDetectionSELEX5-(2-naphthylmethyl)aminocarbonyl (2NapdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_1975 236802402013Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers5570–54N/AN/AN/AssDNAClostridium DifficileToxin A (TcdA)Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin.N/A8Equilibrium Binding Assay6.6 nMDetectionSELEX5-phenylethyl-1-aminocarbonyl (PEdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_1976 236802402013Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers4937–55N/AN/AN/AssDNAClostridium DifficileToxin B (TcdB)Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin.N/A8Equilibrium Binding Assay0.76 nMDetectionSELEX5-tyrosylaminocarbonyl-dU (TyrdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_1977 236802402013Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers4938–17N/AN/AN/AssDNAClostridium DifficileToxin B (TcdB)Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin.N/A8Equilibrium Binding Assay0.45 nMDetectionSELEX5-benzylaminocarbonyl-dU (BndU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_1978 236802402013Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers4940–23N/AN/AN/AssDNAClostridium DifficileToxin B (TcdB)Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin.Developed toxin assays show a limit of detection of 1 pmol/L (300 pg/mL) and a 3-log dynamic range.8Equilibrium Binding Assay0.07 nMDetectionSELEX5-naphthylmethylaminocarbonyl-dU (NapdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT)N/AN/ABest CandidateN/AN/A
ABdb_1979 236802402013Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers4944–30N/AN/AN/AssDNAClostridium DifficileToxin B (TcdB)Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin.N/A8Equilibrium Binding Assay0.08 nMDetectionSELEX5-tryptaminocarbonyl-dU (TrpdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_1980 236802402013Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers5566–74N/AN/AN/AssDNAClostridium DifficileToxin B (TcdB)Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin.N/A8Equilibrium Binding Assay0.04 nMDetectionSELEX5-(2-naphthylmethyl)aminocarbonyl (2NapdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_1981 236802402013Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers5573–4N/AN/AN/AssDNAClostridium DifficileToxin B (TcdB)Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin.N/A8Equilibrium Binding Assay0.07 nMDetectionSELEX5-phenylethyl-1-aminocarbonyl (PEdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_1982 236802402013Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers4758–6N/AN/AN/AssDNAClostridium DifficileBinary toxin, A chain (CdtA)Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin.N/A8Equilibrium Binding Assay0.22 nMDetectionSELEX5-tryptaminocarbonyl-dU (TrpdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_1983 236802402013Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers5574–49N/AN/AN/AssDNAClostridium DifficileBinary toxin, A chain (CdtA)Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin.N/A8Equilibrium Binding Assay1.1 nMDetectionSELEX5-phenylethyl-1-aminocarbonyl (PEdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_1984 236802402013Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers5579–11N/AN/AN/AssDNAClostridium DifficileBinary toxin, A chain (CdtA)Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin.N/A8Equilibrium Binding Assay0.05 nMDetectionSELEX5-(2-naphthylmethyl)aminocarbonyl (2NapdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_1985 236802402013Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers5579–12N/AN/AN/AssDNAClostridium DifficileBinary toxin, A chain (CdtA)Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin.Developed toxin assays show a limit of detection of 1 pmol/L (300 pg/mL) and a 3-log dynamic range.8Equilibrium Binding Assay0.69 nMDetectionSELEX5-(2-naphthylmethyl)aminocarbonyl (2NapdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT)N/AN/ABest CandidateN/AN/A
ABdb_1986 236802402013Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers5556–51N/AN/AN/AssDNAClostridium DifficileBinary toxin, B chain (CdtB)Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin.N/A8Equilibrium Binding Assay6.9 nMDetectionSELEX5-(2-naphthylmethyl)aminocarbonyl (2NapdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_1987 236802402013Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers5556–67N/AN/AN/AssDNAClostridium DifficileBinary toxin, B chain (CdtB)Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin.N/A8Equilibrium Binding Assay4.4 nMDetectionSELEX5-(2-naphthylmethyl)aminocarbonyl (2NapdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A