AptBacterialDB

Target Organism : Campylobacter Jejuni

Total records found: 17

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_1121 301871422018Colorimetric aptasensor for Campylobacter jejuni cells by exploiting the peroxidase like activity of Au@Pd nanoparticlesaptamerGCAAGATCTCCGAGATATCGTGCTGGGGGGTGGTTTGTTTGGGTCGGTTGTTTTGGTTGGGCTGCAGGTAATACGTATACT81N/AssDNACampylobacter JejuniSurface proteinDevelop a colorimetric aptasensor based on an aptamer and Au@Pd NPs peroxidase for the determination of C. jejuni in the milk sample.The Limit of Detection (LOD) achieved was 10 CFU/mL in phosphate-buffered saline and 100 CFU/mL in milk samples with a linear range from 10 to 10(6) CFU/mL.N/AN/AN/ABiosensorN/AN/AN/AN/AN/AN/AN/A
ABdb_1193 299072942018New colorimetric aptasensor for rapid on-site detection of Campylobacter jejuni and Campylobacter coli in chicken carcass samplesONS-23TAACAAGGGACAGTAGACCAACAGGAAATCAAAGGCCGTGGGAA42N/AssDNACampylobacter Jejuni (ATCC 33560, NCTC11168, 2 human isolates, and 3 food isolates)Whole cellA 2-stage label-free aptasensing platform was developed to detect C. jejuni and C. coli.Detection limit (LOD) of 7.2×10^5 CFU/mL and linear range from 10(5) to 10(8) CFU/mL for C. jejuni.N/AN/AN/ABiosensorN/AN/AN/AN/AN/AN/AN/A
ABdb_1462 326630062020Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in FoodCJA1CTGCGATCAAGTTACGCACCTCGCCATGTTCCCCGCCCGGCATGTGTTATGCCCCTGTG595'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3'ssDNACampylobacter JejuniWhole cellIdentify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples.C. jejuni can be detected from 1.7 × 10(1) to 1.7 × 10(6) CFU/mL. The limit of detection (LOD) is obtained as 10 CFU/mL in PBS and 13 CFU/mL in contaminated milk samples.12Fluorescence Binding Assay1.37 ± 0.28 nMDetectionWhole Cell-SELEX5'-Biotinylated and 5'-FAM LabeledN/AN/ABest CandidateN/AN/A
ABdb_1463 326630062020Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in FoodCJA2GTTGGGTGCGGCGGGAGGGTCCCATCGGAAACCAAGCTGTGCTGAGATTTTTCCGCGAT595'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3'ssDNACampylobacter JejuniWhole cellIdentify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples.N/A12Fluorescence Binding Assay1.78 ± 0.88 nMDetectionWhole Cell-SELEX5'-Biotinylated and 5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1464 326630062020Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in FoodCJA3CACGCAAGTTAATCAGCGTGACATCAGGTCTAGATTCCGGCTTATAGCGCCAGGTTTCC595'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3'ssDNACampylobacter JejuniWhole cellIdentify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples.N/A12Fluorescence Binding Assay2.01 ± 0.90 nMDetectionWhole Cell-SELEX5'-Biotinylated and 5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1465 326630062020Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in FoodCJA4GGTGGGCTCTGTTCGGGAGGGGTATTGTTAGGACCGAGAGGCTGCATTCCGCCAGCTGC595'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3'ssDNACampylobacter JejuniWhole cellIdentify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples.N/A12Fluorescence Binding Assay2.26 ± 0.91 nMDetectionWhole Cell-SELEX5'-Biotinylated and 5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1466 326630062020Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in FoodCJA5GCTCTGTCTTTTCAGCTTTATCCGGGTGTGGTGGGGGGGGGATTTGCTTGGTCGGTTCT595'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3'ssDNACampylobacter JejuniWhole cellIdentify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples.N/A12Fluorescence Binding Assay3.53 ± 1.38 nMDetectionWhole Cell-SELEX5'-Biotinylated and 5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1844 381509652024Colourimetric and SERS dual-mode aptasensor using Au@Ag and magnetic nanoparticles for the detection of Campylobacter jejuniONS-23GCAAGATCTCCGAGATATCGTGCTGGGGGGTGGTTTGTTTGGGTCGGTTGTTTTGGTTGGGCTGCAGGTAATACGTATACT81N/AssDNACampylobacter Jejuni (ATCC 33291)Whole cellDeveloped a dual-mode aptasensor using aptamer-conjugated Au@Ag NPs for the effective detection of C. jejuni.Exhibit a wider linear range (1.8 × 10(1)–10(8) CFU/mL and a lower limit of detection of 6 CFU/mL.N/AN/AN/ABiosensorN/A5'-Thiolated (for apt-1) and 5′–NH2 (for apt-2)N/AN/AN/AN/AN/A
ABdb_1864 376194712024A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and AliarcobacterC00GTCCTGAGACTCATGTCTGCTGTCAATCGCAAGGTCCATGTCCTGAGACTCATGTCTGCTGTCAATCGCAAGGTCCA77N/AssDNACampylobacter Jejuni (ATCC 33560)Whole cellDeveloped a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter.N/A12Fluorescence Binding Assay48.12 ± 6.15 nMBiosensorWhole Cell-SELEX with the High-Throughput Sequencing (HTS)5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1865 376194712024A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and AliarcobacterC01CGCGTGTCTGCTGTCAATCGCAAGGTCCATGTCCCGCG38N/AssDNACampylobacter Jejuni (ATCC 33560)Whole cellDeveloped a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter.Exhibited a wide detection range of up to 1 × 10(7) CFU/mL and the lowest limit of detection (LOD) of 1 CFU/mL, for each bacterium.12Fluorescence Binding Assay27.69 ± 5.66 nMBiosensorWhole Cell-SELEX with the High-Throughput Sequencing (HTS)5'-FAM LabeledN/AN/ABest CandidateN/AN/A
ABdb_1866 376194712024A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and AliarcobacterC02CGCGAGTCTGCTGTCAATCGCAAGGCGCG29N/AssDNACampylobacter Jejuni (ATCC 33560)Whole cellDeveloped a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter.N/A12Fluorescence Binding Assay61.58 ± 19.805 nMBiosensorWhole Cell-SELEX with the High-Throughput Sequencing (HTS)5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1867 376194712024A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and AliarcobacterC03CGCTGTCAATCGCG14N/AssDNACampylobacter Jejuni (ATCC 33560)Whole cellDeveloped a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter.N/A12Fluorescence Binding Assay240.2 ± 106.85 nMBiosensorWhole Cell-SELEX with the High-Throughput Sequencing (HTS)5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1868 376194712024A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and AliarcobacterC04GCGTCCATGTCGC13N/AssDNACampylobacter Jejuni (ATCC 33560)Whole cellDeveloped a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter.N/A12Fluorescence Binding Assay259.8 ± 55.1 nMBiosensorWhole Cell-SELEX with the High-Throughput Sequencing (HTS)5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1957 190528512009Plastic-adherent DNA aptamer-magnetic bead and quantum dot sandwich assay for Campylobacter detectionC2 and C3N/AN/AN/AssDNACampylobacter Jejuni (ATCC 29428)Surface proteinIdentify aptamers against surface proteins from C. jejuni and develop a sandwich assay ( (C2 aptamer-MB-bacteria-C3 aptamer-QD complexes) for its detection.Exhibits detection limits as low as an average of 2.5 cfu equivalents in buffer and 10–250 cfu in various food matrices.5N/AN/ABiosensorSELEX5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1958 205825872010Selection and characterization of DNA aptamers with binding selectivity to Campylobacter jejuni using whole-cell SELEXONS-23N/AN/A5'-GTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3'ssDNACampylobacter Jejuni (A9a)Whole cell (bind via proteinaceous nature for cell surface target)Identify aptamers against C. jejuni and detect them in a mixed cell population.ONS-23 showed high binding affinity (25–36%) for all other C. jejuni strains screened (inclusivity) and low apparent binding affinity (1–5%) with non-C. jejuni strains (exclusivity).10Flow Cytometry292.8 ± 53.1 nMDetectionWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AWO Patent WO/2011/097420
ABdb_2009 https://doi.org/10.1016/j.lwt.2013.12.0122014Development and evaluation of aptamer magnetic capture assay in conjunction with real-time PCR for detection of Campylobacter jejuniAptamer 229N/AN/AN/AssDNACampylobacter Jejuni (A9a)Whole cellDevelop an aptamer-based magnetic capture-qPCR (AMC-qPCR) assay for the detection of Campylobacter jejuni.Capture efficiency was 10–13% at the detection limit of 1.1 log10/300 μl C. jejuni cells and a range of 1.0–2.0 log10 CFU per sample (0.3-10 ml).N/AN/AN/ADetectionN/A5'-BiotinylatedN/AN/AN/AN/AWO Patent WO/2011/097420
ABdb_2117 283421482017Further characterization and independent validation of a DNA aptamer-quantum dot-based magnetic sandwich assay for CampylobacterAptamerN/AN/AN/AssDNACampylobacter Jejuni (ATCC 29428)Whole cellDeveloped an aptamer-MB and aptamer-QD sandwich assay for the detection of C.jejuni.Establishes a LOD between 5 and 10 C. jejuni cells/mL in sterile buffer (PBS) and chicken rinsate.N/AN/AN/ABiosensorN/A5'-BiotinylatedN/AN/AN/AN/AU.S. Patent No. 9562900