Target Organism : Brucella S2 vaccine strain

Total records found: 5

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_1884 404519602025Screening and characterization of nucleic acid aptamers targeting Brucella surface antigens: identification and analysis of their corresponding binding sitesWS-6GCTGCAATACTCATGGACAGCACGGCACGGGCTGTCGATCTCGAGGGAAACGGCACATGTGTCTGGAGTACGACCCTGAA80N/AssDNABrucella S2 vaccine strainOuter membrane protein BamA (β-barrel assembly machinery A)Identify aptamers against Brucella and conjugate them to liposomes for selective recognition and significantly reduced bacterial invasion of host cells.WS-6 significantly reduced Brucella invasion, as evidenced by a decrease in qPCR Ct from 22.34 to 20.64 (P < 0.05), confirming a reduced intracellular bacterial load.13Indirect Enzyme-Linked Aptamer Assay (i-ELAA)16.23 ± 5.84 nMTherapeuticsWhole Cell-SELEX5'-Biotinylated and 5'-FAM LabeledN/AThe aptamer demonstrated stable binding to the Brucella S2 vaccine across a temperature range of 16–50°C, with optimal binding observed between 16°C and 50°C and under neutral conditions (pH 7.6) in 2h.Best CandidateN/AN/A
ABdb_1885 404519602025Screening and characterization of nucleic acid aptamers targeting Brucella surface antigens: identification and analysis of their corresponding binding sitesWS-26GCTGCAATACTCATGGACAGCGGAACGCTGTCTCCTCATTCAATCTAGGAGTCTGCGTGAGTCTGGAGTACGACCCTGAA80N/AssDNABrucella S2 vaccine strainWhole cellBinds BamA β-barrel assembly protein → blocks/inhibits bacterial invasion into host cells.N/A13Indirect Enzyme-Linked Aptamer Assay (i-ELAA)20.33 ± 8.12 nMTherapeuticsWhole Cell-SELEX5'-Biotinylated and 5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1886 404519602025Screening and characterization of nucleic acid aptamers targeting Brucella surface antigens: identification and analysis of their corresponding binding sitesWS-17GCTGCAATACTCATGGACAGGACAACGTCCTGTACCAGCGCTACGCCAGATCAGTTTTAGGTCTGGAGTACGACCCTGAA80N/AssDNABrucella S2 vaccine strainWhole cellBinds BamA β-barrel assembly protein → blocks/inhibits bacterial invasion into host cells.N/A13Indirect Enzyme-Linked Aptamer Assay (i-ELAA)17.11 ± 6.35 nMTherapeuticsWhole Cell-SELEX5'-Biotinylated and 5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1887 404519602025Screening and characterization of nucleic acid aptamers targeting Brucella surface antigens: identification and analysis of their corresponding binding sitesWS-32GCTGCAATACTCATGGACAGGGGACTCAGGTCCCCGGGAGCGCAATGGTGGGGTTTTAATGTCTGGAGTACGACCCTGAA80N/AssDNABrucella S2 vaccine strainWhole cellBinds BamA β-barrel assembly protein → blocks/inhibits bacterial invasion into host cells.N/A13Indirect Enzyme-Linked Aptamer Assay (i-ELAA)13.08 ± 2.97 nMTherapeuticsWhole Cell-SELEX5'-Biotinylated and 5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1888 404519602025Screening and characterization of nucleic acid aptamers targeting Brucella surface antigens: identification and analysis of their corresponding binding sitesWS-44GCTGCAATACTCATGGACAGGGACCTGTCCCTGGCCTCTTAGGGTAAAATTTTGCCACAAGTCTGGAGTACGACCCTGAA80N/AssDNABrucella S2 vaccine strainWhole cellBinds BamA β-barrel assembly protein → blocks/inhibits bacterial invasion into host cells.N/A13Indirect Enzyme-Linked Aptamer Assay (i-ELAA)15.03 ± 4.2 nMTherapeuticsWhole Cell-SELEX5'-Biotinylated and 5'-FAM LabeledN/AN/AN/AN/AN/A