Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 5
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_1884 | 40451960 | 2025 | Screening and characterization of nucleic acid aptamers targeting Brucella surface antigens: identification and analysis of their corresponding binding sites | WS-6 | GCTGCAATACTCATGGACAGCACGGCACGGGCTGTCGATCTCGAGGGAAACGGCACATGTGTCTGGAGTACGACCCTGAA | 80 | N/A | ssDNA | Brucella S2 vaccine strain | Outer membrane protein BamA (β-barrel assembly machinery A) | Identify aptamers against Brucella and conjugate them to liposomes for selective recognition and significantly reduced bacterial invasion of host cells. | WS-6 significantly reduced Brucella invasion, as evidenced by a decrease in qPCR Ct from 22.34 to 20.64 (P < 0.05), confirming a reduced intracellular bacterial load. | 13 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | 16.23 ± 5.84 nM | Therapeutics | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | The aptamer demonstrated stable binding to the Brucella S2 vaccine across a temperature range of 16–50°C, with optimal binding observed between 16°C and 50°C and under neutral conditions (pH 7.6) in 2h. | Best Candidate | N/A | N/A |
| ABdb_1885 | 40451960 | 2025 | Screening and characterization of nucleic acid aptamers targeting Brucella surface antigens: identification and analysis of their corresponding binding sites | WS-26 | GCTGCAATACTCATGGACAGCGGAACGCTGTCTCCTCATTCAATCTAGGAGTCTGCGTGAGTCTGGAGTACGACCCTGAA | 80 | N/A | ssDNA | Brucella S2 vaccine strain | Whole cell | Binds BamA β-barrel assembly protein → blocks/inhibits bacterial invasion into host cells. | N/A | 13 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | 20.33 ± 8.12 nM | Therapeutics | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1886 | 40451960 | 2025 | Screening and characterization of nucleic acid aptamers targeting Brucella surface antigens: identification and analysis of their corresponding binding sites | WS-17 | GCTGCAATACTCATGGACAGGACAACGTCCTGTACCAGCGCTACGCCAGATCAGTTTTAGGTCTGGAGTACGACCCTGAA | 80 | N/A | ssDNA | Brucella S2 vaccine strain | Whole cell | Binds BamA β-barrel assembly protein → blocks/inhibits bacterial invasion into host cells. | N/A | 13 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | 17.11 ± 6.35 nM | Therapeutics | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1887 | 40451960 | 2025 | Screening and characterization of nucleic acid aptamers targeting Brucella surface antigens: identification and analysis of their corresponding binding sites | WS-32 | GCTGCAATACTCATGGACAGGGGACTCAGGTCCCCGGGAGCGCAATGGTGGGGTTTTAATGTCTGGAGTACGACCCTGAA | 80 | N/A | ssDNA | Brucella S2 vaccine strain | Whole cell | Binds BamA β-barrel assembly protein → blocks/inhibits bacterial invasion into host cells. | N/A | 13 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | 13.08 ± 2.97 nM | Therapeutics | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1888 | 40451960 | 2025 | Screening and characterization of nucleic acid aptamers targeting Brucella surface antigens: identification and analysis of their corresponding binding sites | WS-44 | GCTGCAATACTCATGGACAGGGACCTGTCCCTGGCCTCTTAGGGTAAAATTTTGCCACAAGTCTGGAGTACGACCCTGAA | 80 | N/A | ssDNA | Brucella S2 vaccine strain | Whole cell | Binds BamA β-barrel assembly protein → blocks/inhibits bacterial invasion into host cells. | N/A | 13 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | 15.03 ± 4.2 nM | Therapeutics | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |