Target Organism : Brucella Melitensis

Total records found: 6

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_1280	31036183	2019	Rapid and label-free detection of Brucella melitensis in milk and milk products using an aptasensor	B. melitensis aptamer	GAGAGTAAAGGCCATCGGCGGCCATTTATGTTGTACCC	38	N/A	ssDNA	Brucella Melitensis	Whole cell	A QCM-aptasensor [Fe3O4 @SiO2 @p(PEG-MA-GMA)] was developed for the determination of B. melitensis from food samples.	The detection limits of the QCM aptasensor were in the range 1.0(2)–1.0(7) CFU/mL, with recoveries up to 79% and LOD of 100 CFU/mL.	15	N/A	N/A	Biosensor	N/A	5'-Amidation (NH₂)	N/A	N/A	N/A	N/A	N/A
ABdb_1720	34809985	2022	Surface plasmon resonance aptasensor for Brucella detection in milk	B46	GGCGGCGATGAGGATGAC-GAGAGTAAAGGCCATCGGCGGCCATTTATGTTGTACCC-ACCACTGCGTGACTGCC	73	5'-GGCGGCGATGAGGATGAC-N38-ACCACTGCGTGACTGCC-3'	ssDNA	Brucella Melitensis	Whole cell	Developed a surface plasmon resonance (SPR) aptasensor for the detection of B. melitensis in milk samples.	LOD value as low as 27 ± 11 cells.	15	Fluorescence Binding Assay	616 ± 13 cells/ml	Biosensor	Whole Cell-SELEX	5'-Amidation (NH₂) and 5'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_1721	34809985	2022	Surface plasmon resonance aptasensor for Brucella detection in milk	B48	GGCGGCGATGAGGATGAC-ACTATTTACGTTGGAACTTAAGTCCCACATGCACTGCC-ACCACTGCGTGACTGCC	73	5'-GGCGGCGATGAGGATGAC-N38-ACCACTGCGTGACTGCC-3'	ssDNA	Brucella Melitensis	Whole cell	Developed a surface plasmon resonance (SPR) aptasensor for the detection of B. melitensis in milk samples.	N/A	15	Fluorescence Binding Assay	N/A	Biosensor	Whole Cell-SELEX	5'-Amidation (NH₂) and 5'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_1722	34809985	2022	Surface plasmon resonance aptasensor for Brucella detection in milk	B70	GGCGGCGATGAGGATGAC-CTATAGTGCTCAAGTGCGATGCCAAGCTGGCACGATAG-ACCACTGCGTGACTGCC	73	5'-GGCGGCGATGAGGATGAC-N38-ACCACTGCGTGACTGCC-3'	ssDNA	Brucella Melitensis	Whole cell	Developed a surface plasmon resonance (SPR) aptasensor for the detection of B. melitensis in milk samples.	B70 showed about 35% higher affinity for Brucella cells than the B46 aptamer, and the SPR sensor showed an LOD of 27 ± 11 cells.	15	Fluorescence Binding Assay	632 ± 132 cells/ml	Biosensor	Whole Cell-SELEX	5'-Amidation (NH₂) and 5'-Biotinylated	N/A	N/A	Best Candidate	N/A	N/A
ABdb_1723	34809985	2022	Surface plasmon resonance aptasensor for Brucella detection in milk	B72	GGCGGCGATGAGGATGAC-TCCGTGACAAGTGCGATGCCATTCCGCGTGACAGTGAT-ACCACTGCGTGACTGCC	73	5'-GGCGGCGATGAGGATGAC-N38-ACCACTGCGTGACTGCC-3'	ssDNA	Brucella Melitensis	Whole cell	Developed a surface plasmon resonance (SPR) aptasensor for the detection of B. melitensis in milk samples.	N/A	15	Fluorescence Binding Assay	N/A	Biosensor	Whole Cell-SELEX	5'-Amidation (NH₂) and 5'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_1842	39533298	2024	Rapid detection of Brucella cells using a gold nanoparticle-based aptasensor via a simple colorimetric method	B. melitensis-specific aptamer	GAGAGTAAAGGCCATCGGCGGCCATTTATGTTGTACCC	38	N/A	ssDNA	Brucella Melitensis strain Rev. 1 vaccine and Brucella Abortus strain RB51 vaccine	Whole cell	Detection of Brucella cells using a biosensor, based on gold nanoparticles (GNPs) and a specific aptamer, via a colorimetric reaction.	Able to detect 1.5 × 10(1) CFU/mL with a linear range of 1.5 × 10(1)-1.5 × 10(8) CFU/mL of the bacterial cells.	N/A	N/A	N/A	Biosensor	N/A	5'-Amidation (NH₂)	N/A	N/A	N/A	N/A	N/A