Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 1
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0025 | 17265180 | 2007 | Fluorescence assay based on aptamer-quantum dot binding to Bacillus thuringiensis spores | Aptamer | CATCCGTCACACCTGCTCTGGCCACTAACATGGGGACCAGGTGGTGTTGGCTCCCGTATC | 60 | N/A | ssDNA | Bacillus Thuringiensis (BT) | BT spores | Aptamer coupled to fluorescent zinc sulfide-capped, cadmium selenide quantum dots (QD) for detecting BT spores. | Limit of detection (LOD) between 10³ and 10(4) CFU. | N/A | N/A | N/A | Biosensor | SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |