Target Organism : Bacillus Cereus

Total records found: 17

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_0058	19751419	2009	Antibiotic resistance in bacteria: novel metalloenzyme inhibitors	Metallo-β-lactamase-targeting aptamers	CGCGAGCTCCGCGCG-AACCAAACTTGGATCGGTGCACATGTCGAA-CGCGCGCATATGGCGC	61	5'-CGCGAGCTCCGCGCG-N30-CGCGCGCATATGGCGC-3'	ssDNA	Bacillus Cereus 5/B/6 and Escherichia Coli (E. Coli) TAP56	Metallo-β-lactamase active sites	Identify aptamers that bind and inhibit the hydrolytic enzyme activity by interfering with the active-site metal ions of the β-lactamase enzyme.	LC50 values in the presence of 5 μM cephalexin: 75 μM and 32 μM for B. cereus 5/B/6 and E. coli TAP56, respectively.	21	Metallo-β-lactamase activity assays	Ki = 0.92 nM	Therapeutics	SELEX	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1339	30522085	2019	A label-free impedimetric aptasensor for the detection of Bacillus anthracis spore simulant	BAS-6R	ATCCGTCACACCTGCTCTGCACGGGCTCAGTTTGGCTTTGTATCCTAAGAGGATGGTGTTGGCTCCCGTAT	71	N/A	ssDNA	Bacillus Cereus (ATCC 11778 and ATCC 14579)	B. anthracis spore simulant (B. cereus spore 14579)	Developed an impedimetric DNA-based aptasensor based on an aptamer immolized on a gold screen-printed electrode for a single-step detection of B. cereus spores.	Spores were detected with a linear range between 10(4) CFU/ml and 5 × 10(6) CFU/ml and a detection limit of 3 × 10(3) CFU/ml.	N/A	N/A	N/A	Biosensor	N/A	5'-Thiolated	N/A	N/A	N/A	N/A	N/A
ABdb_1741	34802926	2022	Rapid and selective detection of Bacillus cereus in food using cDNA-based up-conversion fluorescence spectrum copy and aptamer modified magnetic separation	Aptamer	AGCAGCACAGAGGTCAGATGCCCCCCTTTTATCCGTCGGCATGATGTCTCCCGATCCGGTCCTATGCGTGCTA	73	N/A	ssDNA	Bacillus Cereus	Whole cell	Developed an aptansensor for Bacillus cereus detection based on up-conversion and magnetic nanomaterials (UCNPs-cDNA-Apt-MNPs complex).	Display a linear range of 49-49 × 10(6) cfu/mL under the optimal conditions with a detection limit of 22 cfu/mL.	N/A	N/A	N/A	Biosensor	N/A	5'-Amidation (NH₂)	N/A	N/A	N/A	N/A	N/A
ABdb_1775	37449120	2023	Colorimetric aptasensor for detection of Bacillus cytotoxicus spores in milk and ready-to-use food	BAS-6R	ATCCGTCACACCTGCTCTGCACGGGCTCAGTTTGGCTTTGTATCCTAAGAGGATGGTGTTGGCTCCCGTAT	71	N/A	ssDNA	Bacillus Cereus ssp. cytotoxicus (NVH 391-98A)	B. cytotoxicus spores	Develop a colorimetric assay employing AuNPs and magnetic particles (MPs) for the detection of Bacillus cytotoxicus spores in food.	Achieving the naked-eye limit of detection as low as 10(2) cfu/mL in water and milk, and 10(4) cfu/mL in mashed potatoes.	N/A	N/A	N/A	Biosensor	N/A	5′-Thiolated and 5'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_1786	https://doi.org/10.1016/j.snb.2023.133745	2023	Dual recognition strategy for the rapid and precise detection of Bacillus cereus using post-modified nano-MOF and aptamer	Aptamer	AGCAGCACAGAGGTCAGATGCCCCCCTTTTATCCGTCGGCATGATGTCTCCCGATCCGGTCCTATGCGTGCTA	73	N/A	ssDNA	Bacillus Cereus (CICC 10041)	Whole cell	A dual-recognition strategy using a fluorescent probe, FcMBL-coated nano-MIL-53(Al)-NH2, for detecting B. cereus was developed.	Shows a linear range of 20–2 × 10(8) CFU/mL with a limit of detection of 4 CFU/mL within 60 min.	N/A	N/A	N/A	Biosensor	N/A	5'-Biotinylated and 5'-FITC Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1801	https://doi.org/10.1016/j.aac.2023.07.005	2023	DNA aptamers selection and characterization for development of impedimetric aptasensor for Bacillus cereus at different growing stages	B3	AGCAGCACAGAGGTCAGATG-AGGCCCGGGTTTGGTTCTGGGGTTGGCGGGCTGCGTGAGC-CCTATGCGTGCTACCGTGAA	80	5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'	ssDNA	Bacillus Cereus (CICC 10041)	Whole cell	Identify aptamers against B. cereus across different growth phases and develop an impedance-based aptasensor immobilized on a GCE/Au surface for its detection.	N/A	16	Flow Cytometry	N/A	Biosensor	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1802	https://doi.org/10.1016/j.aac.2023.07.005	2023	DNA aptamers selection and characterization for development of impedimetric aptasensor for Bacillus cereus at different growing stages	B4	AGCAGCACAGAGGTCAGATG-GAAGGGTTTGGTGGTAAATTGCGTGGTTGGCTGTTGATGG-CCTATGCGTGCTACCGTGAA	80	5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'	ssDNA	Bacillus Cereus (CICC 10041)	Whole cell	Identify aptamers against B. cereus across different growth phases and develop an impedance-based aptasensor immobilized on a GCE/Au surface for its detection.	N/A	16	Flow Cytometry	N/A	Biosensor	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1803	https://doi.org/10.1016/j.aac.2023.07.005	2023	DNA aptamers selection and characterization for development of impedimetric aptasensor for Bacillus cereus at different growing stages	B6	AGCAGCACAGAGGTCAGATG-GGCGGGTTTGGATCTTTGGTTGGCGCTTGTTTCTTTATGA-CCTATGCGTGCTACCGTGAA	80	5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'	ssDNA	Bacillus Cereus (CICC 10041)	Whole cell	Identify aptamers against B. cereus across different growth phases and develop an impedance-based aptasensor immobilized on a GCE/Au surface for its detection.	N/A	16	Flow Cytometry	N/A	Biosensor	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1804	https://doi.org/10.1016/j.aac.2023.07.005	2023	DNA aptamers selection and characterization for development of impedimetric aptasensor for Bacillus cereus at different growing stages	B7	AGCAGCACAGAGGTCAGATG-TCGGTCGGGTTTGGGTGTTGGTTGGCGATAAAGATAACTG-CCTATGCGTGCTACCGTGAA	80	5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'	ssDNA	Bacillus Cereus (CICC 10041)	Whole cell	Identify aptamers against B. cereus across different growth phases and develop an impedance-based aptasensor immobilized on a GCE/Au surface for its detection.	N/A	16	Flow Cytometry	19.64 ± 4.11 nM	Biosensor	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1805	https://doi.org/10.1016/j.aac.2023.07.005	2023	DNA aptamers selection and characterization for development of impedimetric aptasensor for Bacillus cereus at different growing stages	B11	AGCAGCACAGAGGTCAGATG-GTGTAGGTCAATCGACGCCACCCATAGCAACCATCCTGCG-CCTATGCGTGCTACCGTGAA	80	5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'	ssDNA	Bacillus Cereus (CICC 10041)	Whole cell	Identify aptamers against B. cereus across different growth phases and develop an impedance-based aptasensor immobilized on a GCE/Au surface for its detection.	N/A	16	Flow Cytometry	N/A	Biosensor	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1806	https://doi.org/10.1016/j.aac.2023.07.005	2023	DNA aptamers selection and characterization for development of impedimetric aptasensor for Bacillus cereus at different growing stages	B14	AGCAGCACAGAGGTCAGATG-GTGGGCAGTGGGGGGAGGGGGAGGTGGAGGTTAGACGTGA-CCTATGCGTGCTACCGTGAA	80	5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'	ssDNA	Bacillus Cereus (CICC 10041)	Whole cell	Identify aptamers against B. cereus across different growth phases and develop an impedance-based aptasensor immobilized on a GCE/Au surface for its detection.	N/A	16	Flow Cytometry	28.64 ± 3.10 nM	Biosensor	Whole Cell-SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1807	https://doi.org/10.1016/j.aac.2023.07.005	2023	DNA aptamers selection and characterization for development of impedimetric aptasensor for Bacillus cereus at different growing stages	B15	AGCAGCACAGAGGTCAGATG-GGCGGGTTTGGATCTTTGGTTGGCGCCTGTTTCTTTATGA-CCTATGCGTGCTACCGTGAA	80	5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'	ssDNA	Bacillus Cereus (CICC 10041)	Whole cell	Identify aptamers against B. cereus across different growth phases and develop an impedance-based aptasensor immobilized on a GCE/Au surface for its detection.	Achieve highly sensitive detection of B. cereus as low as 10 cfu/mL.	16	Flow Cytometry	16.13 ± 4.98 nM	Biosensor	Whole Cell-SELEX	5'-Thiolated and 5'-FAM Labeled	N/A	N/A	Best Candidate	N/A	N/A
ABdb_1808	https://doi.org/10.1016/j.aac.2023.07.005	2023	DNA aptamers selection and characterization for development of impedimetric aptasensor for Bacillus cereus at different growing stages	B16	AGCAGCACAGAGGTCAGATG-ATATGTTTACGCCAGTGGTATTATTGGGGTTGATATGTCA-CCTATGCGTGCTACCGTGAA	80	5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3'	ssDNA	Bacillus Cereus (CICC 10041)	Whole cell	Identify aptamers against B. cereus across different growth phases and develop an impedance-based aptasensor immobilized on a GCE/Au surface for its detection.	Achieve highly sensitive detection of B. cereus as low as 10 cfu/mL.	16	Flow Cytometry	20.67 ± 5.23 nM	Biosensor	Whole Cell-SELEX	5'-Thiolated and 5'-FAM Labeled	N/A	N/A	Best Candidate	N/A	N/A
ABdb_1831	38250355	2024	Rapid Detection and Identification of Vancomycin-Sensitive Bacteria Using an Electrochemical Apta-Sensor	Sp14	AGCAGCACAGGGTCAGATGATATGTTTACGCCAGTGGTATTATTGGGGTTGATATGTCACCTATGCGTG	69	N/A	ssDNA	Bacillus Cereus (ATCC 14579)	Whole cell	A portable electrochemical biosensor was developed for the identification of Gram-positive bacteria based on a vancomycin-modified screen-printed carbon electrode.	Demonstrated that capture was achieved in 10 min, with a limit of detection of only 2.4 CFU/mL.	N/A	N/A	N/A	Biosensor	N/A	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1947	41289776	2026	Improving electrochemical aptasensor sensitivity for Bacillus cereus spore detection in food safety applications	Apt1	CATCCGTCACACCTGCTCGGTGCAGACCCATAGGGGGGGCGTGCGGATGTGCGGAGTAGGGTGTTCGCTCCCGTATC	77	N/A	ssDNA	Bacillus Cereus strain INRA-SV-S51	B. cereus spores	Developed an electrochemical aptasensor for the detection of B. cereus spores.	An aptasensor based on three aptamers exhibited a wide dynamic range (10(2)–10(7) CFU/mL) and a low limit of detection (∼1 CFU/mL) using only 15 μL of sample.	N/A	N/A	N/A	Biosensor	N/A	5′-HO(CH2)6SS(CH2)6(T)5 group, or 5'-TexasRed Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1948	41289776	2026	Improving electrochemical aptasensor sensitivity for Bacillus cereus spore detection in food safety applications	Apt2	CATCCGTCACACCTGCTCCCCAATGAAGCGAGATGGACGCCTAGCACCCCCCGCGTCCGGTGTTGGCTCCCGTATC	76	N/A	ssDNA	Bacillus Cereus strain INRA-SV-S51	B. cereus spores	Developed an electrochemical aptasensor for the detection of B. cereus spores.	An aptasensor based on three aptamers exhibited a wide dynamic range (10(2)–10(7) CFU/mL) and a low limit of detection (∼1 CFU/mL) using only 15 μL of sample.	N/A	N/A	N/A	Biosensor	N/A	5′-HO(CH2)6SS(CH2)6(T)5 group, or 5'-TexasRed Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1949	41289776	2026	Improving electrochemical aptasensor sensitivity for Bacillus cereus spore detection in food safety applications	BAS6	ATCCGTCACACCTGCTCTGCACGGGCTCAGTTTGGCTTTGTATCCTAAGAGGATGGTGTTGGCTCCCGTAT	71	N/A	ssDNA	Bacillus Cereus strain INRA-SV-S51	B. cereus spores	Developed an electrochemical aptasensor for the detection of B. cereus spores.	An aptasensor based on three aptamers exhibited a wide dynamic range (10(2)–10(7) CFU/mL) and a low limit of detection (∼1 CFU/mL) using only 15 μL of sample.	N/A	N/A	N/A	Biosensor	N/A	5′-HO(CH2)6SS(CH2)6(T)5 group, or 5'-TexasRed Labeled	N/A	N/A	N/A	N/A	N/A