Target : Whole live and biofilm derived PA692 P. aeruginosa cells

Total records found: 9

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_0834	28937998	2017	Selection of DNA aptamers specific for live Pseudomonas aeruginosa	JN08	ATGAGAGCGTCGGTGTGGTAACTTAATCCTCTAGTTTTAATTCTAGATACGGCGCATGCACTCTATGTAGGAGGGTGCGGAAGTA	85	5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3'	ssDNA	Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502)	Whole live and biofilm derived PA692 P. aeruginosa cells	Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells.	All aptamers were selective for P. aeruginosa with minimal cross-reactivity.	7	Flow Cytometry	54.9 ± 7.8 nM	Detection	Whole Cell-SELEX	N/A	Aptamers had no intrinsic bacteriostatic and/or bactericidal activity.	N/A	N/A	N/A	N/A
ABdb_0835	28937998	2017	Selection of DNA aptamers specific for live Pseudomonas aeruginosa	JN27	ATGAGAGCGTCGGTGTGGTAACTAGTCTGATTTCTATTTCCTTTAATTAGTCTGCACACATTGCATTGTAGGAGGGTGCGGAAGTA	86	5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3'	ssDNA	Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502)	Whole live and biofilm derived PA692 P. aeruginosa cells	Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells.	All aptamers were selective for P. aeruginosa with minimal cross-reactivity.	7	Flow Cytometry	28.5 ± 4.9 nM	Detection	Whole Cell-SELEX	N/A	Aptamers had no intrinsic bacteriostatic and/or bactericidal activity.	N/A	N/A	N/A	N/A
ABdb_0836	28937998	2017	Selection of DNA aptamers specific for live Pseudomonas aeruginosa	JN27.SH	TAATTAGTCTGCACACATTGCATTGTAGGAGGGTGCGGAAGTA	43	5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3'	ssDNA	Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502)	Whole live and biofilm derived PA692 P. aeruginosa cells	Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells.	All aptamers were selective for P. aeruginosa with minimal cross-reactivity.	7	Flow Cytometry	26.9 ± 5.6 nM	Detection	Whole Cell-SELEX	N/A	Aptamers had no intrinsic bacteriostatic and/or bactericidal activity.	N/A	N/A	N/A	N/A
ABdb_0837	28937998	2017	Selection of DNA aptamers specific for live Pseudomonas aeruginosa	JN08.SH	ATGCACTCTATGTAGGAGGGTGCGGA	26	5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3'	ssDNA	Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502)	Whole live and biofilm derived PA692 P. aeruginosa cells	Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells.	All aptamers were selective for P. aeruginosa with minimal cross-reactivity.	7	Flow Cytometry	52.9 ± 10.4 nM	Detection	Whole Cell-SELEX	N/A	Aptamers had no intrinsic bacteriostatic and/or bactericidal activity.	N/A	N/A	N/A	N/A
ABdb_0838	28937998	2017	Selection of DNA aptamers specific for live Pseudomonas aeruginosa	JN17.SH	ATCCTCCTATCTATCGGTAGTTGTAGGAGGGTGCGG	36	5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3'	ssDNA	Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502)	Whole live and biofilm derived PA692 P. aeruginosa cells	Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells.	All aptamers were selective for P. aeruginosa with minimal cross-reactivity.	7	Flow Cytometry	29 ± 7.3 nM	Detection	Whole Cell-SELEX	N/A	Aptamers had no intrinsic bacteriostatic and/or bactericidal activity.	N/A	N/A	N/A	N/A
ABdb_0839	28937998	2017	Selection of DNA aptamers specific for live Pseudomonas aeruginosa	JN21.SH	AGAGCGTCGGTGTGGTAACTGTTCAGGAGGATGACATTGTCGCCT	45	5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3'	ssDNA	Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502)	Whole live and biofilm derived PA692 P. aeruginosa cells	Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells.	All aptamers were selective for P. aeruginosa with minimal cross-reactivity.	7	Flow Cytometry	18.1 ± 3.4 nM	Detection	Whole Cell-SELEX	N/A	Aptamers had no intrinsic bacteriostatic and/or bactericidal activity.	N/A	N/A	N/A	N/A
ABdb_0840	28937998	2017	Selection of DNA aptamers specific for live Pseudomonas aeruginosa	St17Lp21	ATCCTCCTAGGTAACTGTTCAGGATGTAGGAGGGT	35	5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3'	ssDNA	Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502)	Whole live and biofilm derived PA692 P. aeruginosa cells	Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells.	All aptamers were selective for P. aeruginosa with minimal cross-reactivity.	7	Flow Cytometry	16.9 ± 3.9 nM	Detection	Whole Cell-SELEX	N/A	Aptamers had no intrinsic bacteriostatic and/or bactericidal activity.	N/A	N/A	N/A	N/A
ABdb_0841	28937998	2017	Selection of DNA aptamers specific for live Pseudomonas aeruginosa	St21Lp17	AAGCGTCGGTGTTCTATCGGTAGTTGACACCGACGCCT	38	5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3'	ssDNA	Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502)	Whole live and biofilm derived PA692 P. aeruginosa cells	Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells.	All aptamers were selective for P. aeruginosa with minimal cross-reactivity.	7	Flow Cytometry	13.5 ± 2 nM	Detection	Whole Cell-SELEX	N/A	Aptamers had no intrinsic bacteriostatic and/or bactericidal activity.	N/A	N/A	N/A	N/A
ABdb_0842	28937998	2017	Selection of DNA aptamers specific for live Pseudomonas aeruginosa	St08Lp17	ATGCACTCTTCTATCGGTAGTTGAGGGTGCGG	32	5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3'	ssDNA	Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502)	Whole live and biofilm derived PA692 P. aeruginosa cells	Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells.	All aptamers were selective for P. aeruginosa with minimal cross-reactivity.	7	Flow Cytometry	12.5 ± 2.4 nM	Detection	Whole Cell-SELEX	N/A	Aptamers had no intrinsic bacteriostatic and/or bactericidal activity.	N/A	N/A	N/A	N/A