Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 1330
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0026 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L1F | ATCCGTCACCCCTGCTCTCGTCGCTATGAAGTAACAAAGATAGGAGCAATCGGGTGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0027 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L3F | ATCCGTCACACCTGCTCTAACGAAGACTGAAACCAAAGCAGTGACAGTGCTGAATGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0028 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L4F | ATCCGTCACACCTGCTCTCGGTGACAATAGCTCGATCAGCCCAAAGTCGTCAGATGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0029 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L6F | ATCCGTCACACCTGCTCTAACGAAATAGACCACAAATCGATACTTTATGTTATTGGTGTTGGCTCCCGTAT | 71 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0030 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L7F | ATCCGTCACACCTGCTCTGTCGAATGCTCTGCCTGGAAGAGTTGTTAGCAGGGATGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0031 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L8F | ATCCGTCACACCTGCTCTTAAGCCGAGGGGTAAATCTAGGACAGGGGTCCATGATGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0032 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L9F | ATCCGTCACACCTGCTCTACTGGCCGGCTCAGCATGACTAAGAAGGAAGTTATGTGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0033 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L10F | ATCCGTCACACCTGCTCTGGTACGAATCACAGGGGATGCTGGAAGCTTGGCTCTTGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0034 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L1R | ATACGGGAGCCAACACCACCCGATTGCTCCTATCTTTGTTACTTCATAGCGACGAGAGCAGGGGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0035 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L3R | ATACGGGAGCCAACACCATTCAGCACTGTCACTGCTTTGGTTTCAGTCTTCGTTAGAGCAGGTGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0036 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L4R | ATACGGGAGCCAACACCATCTGACGACTTTGGGCTGATCGAGCTATTGTCACCGAGAGCAGGTGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0037 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L6R | ATACGGGAGCCAACACCAATAACATAAAGTATCGATTTGTGGTCTATTTCGTTAGAGCAGGTGTGACGGAT | 71 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0038 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L7R | ATACGGGAGCCAACACCATCCCTGCTAACAACTCTTCCAGGCAGAGCATTCGACAGAGCAGGTGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0039 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L8R | ATACGGGAGCCAACACCATCATGGACCCCTGTCCTAGATTTACCCCTCGGCTTAAGAGCAGGTGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0040 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L9R | ATACGGGAGCCAACACCACATAACTTCCTTCTTAGTCATGCTGAGCCGGCCAGTAGAGCAGGTGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0041 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L10R | ATACGGGAGCCAACACCAAGAGCCAAGCTTCCAGCATCCCCTGTGATTCGTACCAGAGCAGGTGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0048 | 18214875 | 2008 | Detection and titer estimation of Escherichia coli using aptamer-functionalized single-walled carbon-nanotube field-effect transistors | Aptamer | GGGAGAGCGGAAGCGUGCUGGGUCGCAGUUUGCGCGCGUUCCAAGUUCUCUCAUCACGGAAUACAUAACCCAGAGGUCGAU | 81 | N/A | ssRNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Develop aptamer-functionalized SWNT-FET sensors for the detection of E. coli. | The SWNT-FETs showed a conductance decrease of more than 50% after binding with E. coli in less than 20 min. | N/A | N/A | N/A | Detection | SELEX | 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0049 | 19498077 | 2009 | Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus | SA20 | GCAATGGTACGGTACTTCC-GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Identify aptamers that bind to S. aureus strains, including 8325-4, 196, and 04018, and develop a probe to distinguish them from S. epidermidis, Streptococcus, and E. coli. | EC50 = 70.86 ± 39.22nM and with Multiple aptamers: 479.98 ± 209.94nM. | 5 | Flow Cytometry | N/A | Detection | Subtractive SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0050 | 19498077 | 2009 | Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus | SA23 | GCAATGGTACGGTACTTCC-GGGCTGGCCAGATCAGACCCCGGATGATCATCCTTGTGAGAACCA-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Recognition of different S. aureus strains and mixed aptamer probes distinguishes S. aureus strains, including 8325-4, 196 and 04018, from S. epidermidis, Streptococcus and E. coli. | EC50 = 61.50 ± 22.43nM and with Multiple aptamers: 479.98 ± 209.94nM. | 5 | Flow Cytometry | N/A | Detection | Subtractive SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0051 | 19498077 | 2009 | Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus | SA31 | GCAATGGTACGGTACTTCC-TCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGA-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Recognition of different S. aureus strains and mixed aptamer probes distinguishes S. aureus strains, including 8325-4, 196 and 04018, from S. epidermidis, Streptococcus and E. coli. | EC50=82.86 ± 33.20nM and with Multiple aptamers: 479.98 ± 209.94nM. | 5 | Flow Cytometry | N/A | Detection | Subtractive SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0052 | 19498077 | 2009 | Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus | SA34 | GCAATGGTACGGTACTTCC-CACAGTCACTCAGACGGCCGCTATTGTTGCCAGATTGCCTTTGGC-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Recognition of different S. aureus strains and mixed aptamer probes distinguishes S. aureus strains, including 8325-4, 196 and 04018, from S. epidermidis, Streptococcus and E. coli. | EC50 =72.42 ± 35.23nM and with Multiple aptamers: 479.98 ± 209.94nM. | 5 | Flow Cytometry | N/A | Detection | Subtractive SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0053 | 19498077 | 2009 | Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus | SA43 | GCAATGGTACGGTACTTCC-TCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGT-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Recognition of different S. aureus strains and mixed aptamer probes distinguishes S. aureus strains, including 8325-4, 196 and 04018, from S. epidermidis, Streptococcus and E. coli. | EC50 = 210.70 ± 135.91nM and with Multiple aptamers: 479.98 ± 209.94nM. | 5 | Flow Cytometry | N/A | Detection | Subtractive SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0073 | 19505816 | 2009 | A sensitive method to detect Escherichia coli based on immunomagnetic separation and real-time PCR amplification of aptamers | E. coli specific RNA aptamer | GGGAGAGCGGAAGCGUGCUGGGUCGCAGUUUGCGCGCGUUCCAAGUUCUCUCAUCACGGAAUACAUAACCCAGAGGUCGAU | 81 | N/A | ssRNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Develop an aptamer-based, antibody-conjugated magnetic-bead sandwich assay to detect E. coli. | Showed a wide dynamic range from 10¹ to 10(7) E. coli per ml and achieved a detection limit of 10 E. coli in a 1 ml sample. | N/A | N/A | N/A | Biosensor | N/A | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0079 | 20961052 | 2010 | Real-time potentiometric detection of bacteria in complex samples | Aptamer | GGGAGAGCGGAAGCGUGCUGGGUCGCAGUUUGCGCGCGUUCCAAGUUCUCUCAUCACGGAAUACAUAACCCAGAGGUCGAU | 81 | N/A | ssRNA | Escherichia Coli (E. Coli) CECT 675 cells | Whole cell | Potentiometric aptamer-based biosensor to detect E. coli CECT 675 as a nonpathogenic surrogate for pathogenic E. coli O157:H7 in complex liquid samples. | Display LOD of 10(4) CFU/mL with a linear range from 4 to ∼10(4) CFU/mL. The lowest bacterial count detected in complex matrices was 12 CFU in 2 mL of milk (6 CFU/mL) and 26 CFU in 1 mL of apple juice. | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation ((CH2)5-NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0083 | https://doi.org/10.4028/www.scientific.net/KEM.439-440.1456 | 2010 | In Vitro Selection of Oligonucleotide Acid Aptamers against Pathogenic Vibrio Alginolyticus by SELEX | Sequence A | GCCCAATCGCCGTCTTCTACA-TGTGCGTGTGTCAGCGAATATCACCTAGAGGTCGG-AGTGCCAACGCCCTCCTGAT | 76 | 5'-GCCCAATCGCCGTCTTCTACA-N35-AGTGCCAACGCCCTCCTGAT-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify a high-affinity aptamer against Vibrio alginolyticus. | Bind to different sites of the V. alginolyticus surface. | 15 | N/A | N/A | Detection | SELEX | 5'-DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0084 | https://doi.org/10.4028/www.scientific.net/KEM.439-440.1456 | 2010 | In Vitro Selection of Oligonucleotide Acid Aptamers against Pathogenic Vibrio Alginolyticus by SELEX | Sequence B | CCCAATCGCCGTCTTCTACA-TGTATGCTGCCGAGGTTGGCCTCTTAGTCAGCTGAGAGTGCCAACGCCCTCCTGATATGCCCAATCGCCGTCTTCTACATTGTGGTCGTGGGAATGCATTCATCCGTTGCCGG-AGTGCCAACGCCCTCC | 149 | 5'-GCCCAATCGCCGTCTTCTACA-N35-AGTGCCAACGCCCTCCTGAT-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify a high-affinity aptamer against Vibrio alginolyticus. | Bind to different sites of the V. alginolyticus surface. | 15 | N/A | N/A | Detection | SELEX | 5'-DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0090 | 22166202 | 2011 | In vitro selection of Escherichia coli O157:H7-specific RNA aptamer | Two Arm ( from clone I-1) | GGGUCUUCCUGGACUGUCGAAAAUUCAGUAUCGGGAGGUUACGUAUUUGGUUUAUAGAUAGUAA | 64 | 5'-GGGAUACCAGCUUAUUCAAUU-N60-AGAUAGUAAGUGCAAUCU-3' | ssRNA | Escherichia Coli (E. Coli) O157:H7(ATCC 43895) | Whole cell | Identify aptamers that bind to and distinguish between the virulent serotype and the nonpathogenic strain of E.coli. | Specifically bound to the lipopolysaccharide, which includes the O antigen from the O157:H7 strain, but not to the LPS from the K12 strain. | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | ~110 nM | Detection | Subtractive SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) and A(16) extended on the 3' | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0091 | 22166202 | 2011 | In vitro selection of Escherichia coli O157:H7-specific RNA aptamer | Clone I-1 | GGGAUACCAGCUUAUUCAAUU-UGAUUCCAUCUUCCUGGACUGUCGAAAAUUCAGUAUCGGGAGGUUACGUAUUUGGUUUAU-AGAUAGUAAGUGCAAUCU | 99 | 5'-GGGAUACCAGCUUAUUCAAUU-N60-AGAUAGUAAGUGCAAUCU-3' | ssRNA | Escherichia Coli (E. Coli) O157:H7(ATCC 43895) | Whole cell | Identify aptamers that bind to and distinguish between the virulent serotype and the nonpathogenic strain of E.coli. | Bound to the E. coli O157:H7 strain 2.8-fold better than the control. | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Subtractive SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) and A(16) extended on the 3' | N/A | N/A | N/A | N/A | N/A |
| ABdb_0092 | 22166202 | 2011 | In vitro selection of Escherichia coli O157:H7-specific RNA aptamer | Clone III-2 | GGGAUACCAGCUUAUUCAAUU-CGCACUGUUUUGCCCAGCCGUGUGAAAUUGAUUAGACGUUUUGUAUGCGAUUUCGCCUUG-AGAUAGUAAGUGCAAUCU | 99 | 5'-GGGAUACCAGCUUAUUCAAUU-N60-AGAUAGUAAGUGCAAUCU-3' | ssRNA | Escherichia Coli (E. Coli) O157:H7(ATCC 43895) | Whole cell | Identify aptamers that bind to and distinguish between the virulent serotype and the nonpathogenic strain of E.coli. | Bound to the E. coli O157:H7 strain 2.3-fold better than the control. | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Subtractive SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) and A(16) extended on the 3' | N/A | N/A | N/A | N/A | N/A |
| ABdb_0093 | 21504182 | 2011 | DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes | 20A24P | AGCAGCACAGAGGTCAGATG-GGGGGAAGACACAGAGAAAGGCCGGGGTGAAGTGTAGAGG-CCTATGCGTGCTACCGTGAA | 80 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | Whole cell | Identify aptamers against the various M-types of S. pyogenes. | 20A24P forms a branched structure with high affinity for the target cell mixture (gated fluorescence intensity above library of 64%). | 20 | Flow Cytometry | 9.1 ± 0.8 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0094 | 21504182 | 2011 | DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes | 15A3P | TTCACGGTAGCACGCATAGG-GACAGCAAGCCCAAGCTGGGTGTGCAAGGTGAGGAGTGGG-CATCTGACCTCTGTGCTGCT | 80 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | Whole cell | Identify aptamers against the various M-types of S. pyogenes. | Show a gated fluorescence above the background of 48%. | 20 | Flow Cytometry | 9.6 ± 0.3 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0095 | 21504182 | 2011 | DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes | 20A1 | CAGAACGCACCCGCACACCTCCATCACTCGCATGCACCCC | 40 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | Whole cell | Identify aptamers against the various M-types of S. pyogenes. | 72% gated fluorescence intensity above the library. | 20 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0096 | 21504182 | 2011 | DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes | 20A1P | TTCACGGTAGCACGCATAGG-CAGAACGCACCCGCACACCTCCATCACTCGCATGCACCCC-CATCTGACCTCTGTGCTGCT | 80 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | Whole cell | Identify aptamers against the various M-types of S. pyogenes. | 72% gated fluorescence intensity above the library. | 20 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0097 | 21504182 | 2011 | DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes | 20A8 | CCCCACGAATCGTTACTCTGGTCCTCTATTTCTCCTCCCC | 40 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | Whole cell | Identify aptamers against the various M-types of S. pyogenes. | 20A8 binding to the target GAS cells yielded 72% gated fluorescence above background. | 20 | Flow Cytometry | 4 ± 1 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0098 | 21504182 | 2011 | DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes | 20A8P | AGCAGCACAGAGGTCAGATG-CCCCACGAATCGTTACTCTGGTCCTCTATTTCTCCTCCCC-CCTATGCGTGCTACCGTGAA | 80 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | Whole cell | Identify aptamers against the various M-types of S. pyogenes. | 20A8P binding to the target GAS cells yielded 68% gated fluorescence above background. | 20 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0099 | 21504182 | 2011 | DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes | 20A9 | CACACGCTGAAGAAACTGAGGTCGTAGGTTTTCTTCGGG | 39 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | Whole cell | Identify aptamers against the various M-types of S. pyogenes. | 65% gated fluorescence intensity above the library. | 20 | Flow Cytometry | 9 ± 1 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0100 | 21504182 | 2011 | DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes | 20A9P | AGCAGCACAGAGGTCAGATG-CACACGCTGAAGAAACTGAGGTCGTAGGTTTTCTTCGGG-CCTATGCGTGCTACCGTGAA | 79 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | Whole cell | Identify aptamers against the various M-types of S. pyogenes. | 66% gated fluorescence intensity above the library. | 20 | Flow Cytometry | 9.1 ± 0.6 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0101 | 21504182 | 2011 | DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes | 20A12P | TTCACGGTAGCACGCATAGG-GCCCGACACTCGTCCACCCGATACCTCTCATGTGTCCC-CATCTGACCTCTGTGCTGCT | 78 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | Whole cell | Identify aptamers against the various M-types of S. pyogenes. | N/A | 20 | Flow Cytometry | 25 ± 3 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0102 | 21504182 | 2011 | DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes | 20A14P | AGCAGCACAGAGGTCAGATG-GGCATGGGGAAGAGAAAGCGGGATAACTTCGTTACCGGGC-CCTATGCGTGCTACCGTGAA | 80 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | Whole cell | Identify aptamers against the various M-types of S. pyogenes. | N/A | 20 | Flow Cytometry | 17 ± 1 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0105 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F23 | ATACCAGCTTATTCAATT-CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | F23 showed great specificity to P. aeruginosa and no cross-reactivity with other bacterial species. | 15 | Flow Cytometry | 17.27 ± 5.00 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0106 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F12 | ATACCAGCTTATTCAATT-CCCCCGTTGCTTTCGCTTTTCCTTTTGCTTTTGTTCGCTTCGTCCCTGCTTCCTTTCTTG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0107 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F8 | ATACCAGCTTATTCAATT-CCGTGGCGTTCTGTTTGTTCGTTGTTTTTTGGTTTTTCCTTCTTTTTTTGTTTTTGGTTG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0108 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F1 | ATACCAGCTTATTCAATT-GGCGCGCGTTGTGTGGTTTGGCTTTTTTCGTTTGTTTTTCTTGGGTGCTTGTCTTCGTTG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0109 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F20 | ATACCAGCTTATTCAATT-CCCTCGCCGTACGTTCTCCGTTTTGTCAGGTGTTGTTTTTTCCGTCCTCTTCTCGTGTGC-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0110 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F4 | ATACCAGCTTATTCAATT-CCACCGATTCCCTTCGATCGTATTCGTGTTGCTCTCGTGTTGTAATGCGTCCTGTGCTTG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0111 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F6 | ATACCAGCTTATTCAATT-GGCACCGGCTTGTCTGTTTCTCTTGGTTCGCCGCTGGACTTTGTTAGCTCCCTCCGCTTG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0112 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F7 | ATACCAGCTTATTCAATT-CCCCACAACCTGACCTTTCTATTCCGTTCCCCTTTTTTCAGCTTCTTTCCGGCCTCTGTT-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0113 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F18 | ATACCAGCTTATTCAATT-CCACCACCGGGTTGTTTTTCCTGCAGGCCTTTATCGTTTTCCGCGCTCGATTCGGTCATG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0114 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F5 | ATACCAGCTTATTCAATT-CCACCGTGCTTTATATTACCCGTCCACCCTTCGGTCTTTCTCCCCGTGTCGCTCCGCTTT-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0115 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F21 | ATACCAGCTTATTCAATT-CCACCGGGCCTCGTATTCGTACTGTTTGATTCTTTGGCTTTGTAGCGGACGTACTGGGTG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0116 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F2 | ATACCAGCTTATTCAATT-CCCCCGCGCCCGTCTCTCTCAATCTCCGCATTCTTTAGTTCTCATCCTCCCTGTGTGTTT-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0117 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F24 | ATACCAGCTTATTCAATT-GACACCCGGAGTAATTCCGTTTTAAGCGTCTTTCATGTGTTCCCTTTCGTTCCTCCCTTG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0118 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F15 | ATACCAGCTTATTCAATT-CCCAAGGTCGAGTTCCTAGTCTTACCGTATTTCACTTTCCTGGTTCTTACCTCCCCCTCA-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0119 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F22 | ATACCAGCTTATTCAATT-CGGCGCGAGTCGACTGCACAGGGTCCTATTGCTTATGGTCATGGTTTCGTTTCATCCTCG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0120 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F16 | ATACCAGCTTATTCAATT-CCCGCGATATGACCATCCAGCTGCTCCTCTGTTATTGTTGGTTTTCCTGTTTTCCTTTGT-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0121 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F17 | ATACCAGCTTATTCAATT-CCCCAGTGCTCAGCTTCTCCTCCGTCTCATTCTTCTGTAGGATCGTTCTGTTTTGGTACT-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | 57.63 ± 11.64 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0122 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F10 | ATACCAGCTTATTCAATT-CCCACCGTCCTCGTGCTTAGTCTTTATGTTTCGTCCTTTTCTTTCTTCGTTCTGTCGCCT-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0123 | 21875107 | 2011 | Identification of environmental reservoirs of nontyphoidal salmonellosis: aptamer-assisted bioconcentration and subsequent detection of salmonella typhimurium by quantitative polymerase chain reaction | Sal aptamer | CTCACCAGGAGATTACAACATGG-TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG-AGCTCAGACCAAAAGTGACCATC | 86 | 5'-CTCACCAGGAGATTACAACATGG-N40-AGCTCAGACCAAAAGTGACCATC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Detection of Salmonella Typhimurium by serovar-specific DNA aptamer-conjugated dynabeads in water samples. | Sediments from the selected sampling locations also exhibit Salmonella Typhimurium in the range of 3.37 × 10(4) to 3.08 × 10(9) cfu/100 g. | N/A | N/A | N/A | Detection | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0124 | 22310030 | 2012 | Development of RNA aptamers for detection of Salmonella Enteritidis | S25 | GGGUUCACUGCAGACUUGACGAAGCUU-GAGAGAUGCCCCCUGAUGTGCAUUCUUGUUGUGUUGCGGC-AAUGGAUCCACAUCTACGAAUUC | 90 | 5'-GGGUUCACUGCAGACUUGACGAAGCUU-N40-AAUGGAUCCACAUCUACGAAUUC-3' | ssRNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Identify an aptamer that binds to the outer membrane protein C and specifically recognizes S. enteritidis without any cross-reactivity to other Salmonella serovars. | Fluorescence intensity of S. Enteritidis enhanced as the concentration of the aptamer S25 increased from 5 to 30 μg. | 10 | Flow Cytometry | N/A | Detection | Magnetic Bead (MB)-based SELEX | 5'-Fluoro-labeled with Fluorescein-maleimide | N/A | N/A | N/A | N/A | N/A |
| ABdb_0125 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A3P | ATAGGAGTCACGACGACCAGAA-TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | Showed a high binding affinity of 76% for V. parahemolyticus and a low apparent binding affinity of 4% for other bacteria. | 9 | Flow Cytometry | 16.88 ± 1.92 | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0126 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A1 | TAGAGATATGACAGCGGGGAAGGTTAAGAGGCGCTAGGAG | 40 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | The gated fluorescence intensity above background for A1 was 64%. | 9 | Flow Cytometry | 22.92 ± 4.72 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0127 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A1P | ATAGGAGTCACGACGACCAGAA-TAGAGATATGACAGCGGGGAAGGTTAAGAGGCGCTAGGAG-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | The gated fluorescence intensity above background for A1P was 67%. | 9 | Flow Cytometry | 21.45 ± 2.62 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0128 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A3 | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | The gated fluorescence intensity above background for A3 was 75%. | 9 | Flow Cytometry | 24.03 ± 5.18 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0129 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A17P | ATAGGAGTCACGACGACCAGAA-AGGCCGGCCCCTCTGAACTAGATGCAGGGGAGGCGAGCGA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0130 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A18P | ATAGGAGTCACGACGACCAGAA-GCGGGCAGCTCCACCGGTAGGCTCCGAGTCATCACGGTCG-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | The gated fluorescence intensity above background for A18P was 62%. | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0131 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A21P | ATAGGAGTCACGACGACCAGAA-TTTTGACGAAGTCAGTGCGTCGAAGCGCAAGCATTACAGA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0136 | 23190695 | 2012 | Aptasensors for rapid detection of Escherichia coli O157:H7 and Salmonella typhimurium | A1 | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (CICC 21530) | Whole cell | Aptasensors based on label-free aptamers and gold nanoparticles (AuNPs) for the detection of E. coli O157:H7 and Salmonella typhimurium. | Detects as low as 10(5) CFU/ml of target bacteria within 20 min or less, with 100% specificity. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0137 | 23190695 | 2012 | Aptasensors for rapid detection of Escherichia coli O157:H7 and Salmonella typhimurium | A2 | CCAAAGGCTACGCGTTAACGTGGTGTTGG | 29 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (CMCC 50115) | Whole cell | Aptasensors based on label-free aptamers and gold nanoparticles (AuNPs) for the detection of E. coli O157:H7 and Salmonella typhimurium. | Detects as low as 10(5) CFU/ml of target bacteria within 20 min or less, with 100% specificity. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0139 | 22154169 | 2012 | Label-free detection of Staphylococcus aureus in skin using real-time potentiometric biosensors based on carbon nanotubes and aptamers | NH2-Aptamer | GCAATGGTACGGTACTTCCTCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGACAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | A single-walled carbon nanotube (SWCNT) functionalized with an aptamer-based biosensor to detect Staphylococcus aureus in real-time. | With covalent functionalization, the minimum concentration detected was 8 × 10(2) CFU/mL; with the non-covalent approach, it was 10(7) CFU/mL. | N/A | N/A | N/A | Detection | N/A | 3'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0140 | 22154169 | 2012 | Label-free detection of Staphylococcus aureus in skin using real-time potentiometric biosensors based on carbon nanotubes and aptamers | Pyr-Aptamer | GCAATGGTACGGTACTTCCGCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTATCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | A single-walled carbon nanotube (SWCNT) functionalized with an aptamer-based biosensor to detect Staphylococcus aureus in real-time. | With covalent functionalization, the minimum concentration detected was 8 × 10(2) CFU/mL; with the non-covalent approach, it was 10(7) CFU/mL. | N/A | N/A | N/A | Detection | N/A | 3'-C3-Pyr | N/A | N/A | N/A | N/A | N/A |
| ABdb_0141 | 22444566 | 2012 | Dual-color upconversion fluorescence and aptamer-functionalized magnetic nanoparticles-based bioassay for the simultaneous detection of Salmonella Typhimurium and Staphylococcus aureus | Aptamer1 | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 50761) | Whole cell | Developed a luminescent bioassay for the simultaneous detection of S. Typhimurium and S. aureus using aptamer-conjugated MNPs and UCNPs (NaY0.78F4:Yb0.2, Tm0.02 UCNPs modified aptamer 1 and NaY0.28F4:Yb0.70, Er0.02 UCNPs modified aptamer 2). | Display linear range of 10(1)-10(5) cfu/mL with a limit of detection of 5 cfu/mL for S. Typhimurium. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0142 | 22444566 | 2012 | Dual-color upconversion fluorescence and aptamer-functionalized magnetic nanoparticles-based bioassay for the simultaneous detection of Salmonella Typhimurium and Staphylococcus aureus | Aptamer2 | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed a luminescent bioassay for the simultaneous detection of S. Typhimurium and S. aureus using aptamer-conjugated MNPs and UCNPs (NaY0.78F4:Yb0.2, Tm0.02 UCNPs modified aptamer 1 and NaY0.28F4:Yb0.70, Er0.02 UCNPs modified aptamer 2). | Display linear range of 10(1)-10(5) cfu/mL with a limit of detection of 8 cfu/mL for S. aureus. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0157 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-1 | CTCCTCTGACTGTAACCACGGTGGTTTGATCACTATTGGGCCTTTG | 46 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0158 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-2 | ATTGTACACCATGTGCAGAGATTTTCGGCACGAGGATCAT | 40 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0159 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-3 | GAGTTAATCAATACAAGGCGGGAACATCCTTGGCGGTGC | 39 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | Successfully detect S. typhimurium down to 600 CFU/mL (equivalent to 18 live cells in 30 μL of assay volume) and distinguish it from other Salmonella species, including S. enteritidis and S. choleraesuis. | 12 | Flow Cytometry | 25 nM | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0160 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-4 | CTCCTCTGACTGTAACCACGGTGGGAGAGATGCTATACAATCTTGTAAGGCGATGGACCG | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0161 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-5 | GCCTCTAAGGCTCACCTTGAAGCGCCCGGACTAACCTGCTCGCATAGGTAGTCCAGAAGCC | 61 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0162 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-6 | CTCCTCTGACTGTAACCACG-GAGTTAATCAATACAAGGCGGGAACATCCTTGGCGGTGCC-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0163 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-7 | CTCCTCTGACTGTAACCACG-GTGGTTTGATCACTATTGGGCCTTTGTGATGTCGGTAGTC-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0164 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-8 | CTCCTCTGACTGTAACCACG-GCCTCTAAGGCTCACCTTGAAGCGCCCGGACTAACCTGCTC-GCATAGGTAGTCCAGAAGCC | 81 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0165 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-9 | CTCCTCTGACTGTAACCACG-ATTGTACACCATGTGCAGAGATTTTCGGCACGAGGATCATC-GCATAGGTAGTCCAGAAGCC | 81 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0166 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | E06 | TGATCCGGGCCTCATGTCGAACCCACACCCCACAACCACCCAGCCCCAGCCCGCTATTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0167 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | F04 | TGATCCGGGCCTCATGTCGAACACAACACCCAGCCAACGACCACAACTCCAACTCATTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0168 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | C10 | TGATCCGGGCCTCATGTCGAAACCACAACCCAACAACAAGAACCACAAAGAGCCCCTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0169 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | B06 | TGATCCGGGCCTCATGTCGAACACACACAGAACCACAACCACTAAACACGAGGGCCTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0170 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | B10 | GATCCGGGCCTCATGTCGAACACCCCCCAACTAAAACAACAAAACACCACCGCCATTGAGCGTTTATTCTGAGCTCCCA | 79 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | Digoxigenin-B10 bound to the Salmonella O8 target with high specificity, producing a clear fluorescent signal within 1.5–2 h. | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | 32.04 nM | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0171 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | C04 | TGATCCGGGCCTCATGTCGAACCAACAAGGCAGAAAGAAACCGACAAACCGCACTGTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0172 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | F05 | TGATCCGGGCCTCATGTCGAACCAACAAGGCAGAAAGAAACCGACAAACCGCACTGTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0173 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | B05 | TGATCCGGGCCTCATGTCGAACCGAACGACTCAAAGATCAAGCCAAGCCACGCCCGTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0174 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | G05 | TGATCCGGGCCTCATGTCGAACCAACCCAACACCAAAGAGACCACCACCACACGAGTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | 175.9 nM | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0175 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | D04 | TGATCCGGGCCTCATGTCGAACACGAGCCACCAACGCACCAAAACCCGTCCTCCACTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0176 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | E04 | TGATCCGGGCCTCATGTCGAAGGCACGCGCACCAAAACACAAACTCCCCCCGCACCTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0177 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | G06 | TGATCCGGGCCTCATGTCGAAGGGCCACCTAACCACCTCTGCCAATACCCCCCGCGTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0178 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | C05 | TGATCCGGGCCTCATGTCGAAGGGAAGTCATGGCATGGATGCGCTCCCCGCCCACCTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0179 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | C06 | TGATCCGGGCCTCATGTCGAAGGGAAGTCATGGCATGGATGCGCTCCCCGCCCACCTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0180 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | H05 | TGATCCGGGCCTCATGTCGAACGGCGCAGTGACACGGTAGGGAGTCGTGCCGCGGCTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0181 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | H06 | TGGGAGCTCAGAATAAACGCTCAAGGTGGGCGGGCGGCGTTGCTGTTCTTTTGCTGGTGTTCGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0182 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | F06 | TGGGAGCTCAGAATAAACGCTCAAGAGGCGGCCTGTTCGCTTGTTGTGGGTCCGCTTGGTTCGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0183 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | A05 | TGGGAGCTCAGAATAAACGCTCAAGGGCACTGGGTGGTGATGTTTTGTTTGTCTGGCGGTTCGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0184 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | D06 | TGGGAGCTCAGAATAAACGCTCAAGGGGGGGGTGGAGGGGTATGCAGTTTCGGTGGCCGTTCGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0185 | 22226327 | 2012 | Bio-capture of S. Typhimurium from surface water by aptamer for culture-free quantification | Sal aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Aptamer-based bio-capture assay for the detection of selective serovar species through molecular-beacon-based real-time PCR. | Achieved a detection limit of 1 CFU/PCR or 100 CFU/ml. | N/A | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0187 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-1 | CTCCTCTGACTGTAACCACG-CACAAAGGCTCGCGCATGGTGTGTACGTTCTTACAGAGGT-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0188 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-2 | CTCCTCTGACTGTAACCACG-TCGGCAACAAGGTCACCCGGAGAAGATCGGTGGTCAAACT-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0189 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-3 | CTCCTCTGACTGTAACCACG-TATACGCGCTTGCCCCTTAGTCATACGAACTGATTCAATC-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0190 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-4 | CTCCTCTGACTGTAACCACG-TGCCGCTAAACGCCGGCTCATCGTTATGCTTTTCATTGCA-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0191 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-5 | CTCCTCTGACTGTAACCACG-TAACGTACCAAAATGTTGGATTGGATGTTGTACTGGGTT-GCATAGGTAGTCCAGAAGCC | 79 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0192 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-6 | TCGGCAACAAGGTCACCCGGAGAAGATCGGTGGTCAAACTGCATAGGTAGTCCAGAAGCC | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0193 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-7 | CTCCTCTGACTGTAACCACGTATACGCGCTTGCCCCTTAGTCATACGAACTGATTCAATC | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0194 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-8 | CTCCTCTGACTGTAACCACGAACGATTCAAGAACTGTTGGTTGTCGGCTTATTTTCGCCA | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0195 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-9 | CTCCTCTGACTGTAACCACGCACAAAGGCTCGCGCATGGTGTGTACGTTCTTACAGAGGT | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | Can successfully detect S. enteritidis down to 600 CFU/mL (equivalent to 18 CFU in 30 μL assay volume) in 10 min and distinguish it from other Salmonella species, including S. typhimurium and S. choleraesuis. | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | 5'-6-hydroxyhexyl disulfide group (5'-/5ThioMC6) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0196 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-10 | TACCAAAATGTTGGATTGGATGTTGTACTGGGTTGCATAGGTAGTCCAGAAGCC | 54 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0197 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-3 (80nt) | CTCCTCTGACTGTAACCACG-TCGGCAACAAGGTCACCCGGAGAAGATCGGTGGTCAAACT-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | N/A | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0198 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-3 (60nt) | TCGGCAACAAGGTCACCCGGAGAAGATCGGTGGTCAAACTGCATAGGTAGTCCAGAAGCC | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 7.8 ± 6.1 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0199 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-6 (79nt) | CTCCTCTGACTGTAACCACG-TAACGTACCAAAATGTTGGATTGGATGTTGTACTGGGTT-GCATAGGTAGTCCAGAAGCC | 79 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 53 ± 7 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0200 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-6_54 | TACCAAAATGTTGGATTGGATGTTGTACTGGGTTGCATAGGTAGTCCAGAAGCC | 54 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 6.3 ± 0.58 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0201 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-20_80 | CTCCTCTGACTGTAACCACG-CACAAAGGCTCGCGCATGGTGTGTACGTTCTTACAGAGGT-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 28 ± 3.8 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0202 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-20_60 | CTCCTCTGACTGTAACCACGCACAAAGGCTCGCGCATGGTGTGTACGTTCTTACAGAGGT | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis and 43 ± 4% (SE-20, 60nt) in S. enteritidis. | 12 | Flow Cytometry | 7.1 ± 0.62 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0203 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-22_80 | CTCCTCTGACTGTAACCACG-TATACGCGCTTGCCCCTTAGTCATACGAACTGATTCAATC-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 30 ± 4.1 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0204 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-22_60 | CTCCTCTGACTGTAACCACGTATACGCGCTTGCCCCTTAGTCATACGAACTGATTCAATC | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 5.3 ± 0.7 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0205 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-11_60 | CTCCTCTGACTGTAACCACGAACGATTCAAGAACTGTTGGTTGTCGGCTTATTTTCGCCA | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 6.9 ± 0.4 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0206 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-34_80 | CTCCTCTGACTGTAACCACG-TGCCGCTAAACGCCGGCTCATCGTTATGCTTTTCATTGCA-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 56 ± 7.1 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0207 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-1_40 | GAGTTAATCAATACAAGGCGGGAACATCCTTGGCGGTGC | 39 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium. | 12 | Flow Cytometry | N/A | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0208 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-6_60 | GCCTCTAAGGCTCACCTTGAAGCGCCCGGACTAACCTGCTCGCATAGGTAGTCCAGAAGCC | 61 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium. | 12 | Flow Cytometry | N/A | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0209 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-12_80 | CTCCTCTGACTGTAACCACG-GTGGTTTGATCACTATTGGGCCTTTGTGATGTCGGTAGTC-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium. | 12 | Flow Cytometry | N/A | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0210 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-12_60 | CTCCTCTGACTGTAACCACGGTGGTTTGATCACTATTGGGCCTTTGTGATGTCGGTAGT | 59 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium and 62 ± 12% (ST-12, 60nt) in S. typhimurium. | 12 | Flow Cytometry | 4.5 ± 0.4 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0211 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-20_80 | CTCCTCTGACTGTAACCACG-ATTGTACACCATGTGCAGAGATTTTCGGCACGAGGATCATC-GCATAGGTAGTCCAGAAGCC | 81 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium. | 12 | Flow Cytometry | N/A | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0212 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-20_40 | ATTGTACACCATGTGCAGAGATTTTCGGCACGAGGATCAT | 40 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium. | 12 | Flow Cytometry | N/A | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0213 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-33_60 | CTCCTCTGACTGTAACCACGGTGGGAGAGATGCTATACAATCTTGTAAGGCGATGGACCG | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium. | 12 | Flow Cytometry | 51.0 ± 4.3 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0214 | 23473545 | 2013 | Selection and characterization of aptamers against Salmonella typhimurium using whole-bacterium SELEX | ST2P | ATAGGAGTCACGACGACCAGAA-AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (Lipopolysaccharide (LPS) or lipoprotein) of whole cell | Identify an aptamer that binds to and develop a fluorescent bioassay based on aptamer-MNPs conjugate to detect S. typhimurium. | The limit of detection (LOD) was 25 cfu/mL, and the percentage gated fluorescence intensity above library background was 20% when ST9P was incubated with L. monocytogenes cells and 72% when incubated with S. typhimurium. | 9 | Flow Cytometry | 6.33 ± 0.58 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0215 | 23473545 | 2013 | Selection and characterization of aptamers against Salmonella typhimurium using whole-bacterium SELEX | ST2 | AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA | 40 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (Lipopolysaccharide (LPS) or lipoprotein) of whole cell | Identify an aptamer that binds to and develop a fluorescent bioassay based on aptamer-MNPs conjugate to detect S. typhimurium. | Gated fluorescence intensity above background remained at 82 ± 2.34% for ST2. | 9 | Flow Cytometry | 16.34 ± 0.45 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0216 | 23473545 | 2013 | Selection and characterization of aptamers against Salmonella typhimurium using whole-bacterium SELEX | ST3P | ATAGGAGTCACGACGACCAGAA-TTTCGGCTAAGGACGGGTGAAATACATTTAATAGGGTGGA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (Lipopolysaccharide (LPS) or lipoprotein) of whole cell | Identify an aptamer that binds to and develop a fluorescent bioassay based on aptamer-MNPs conjugate to detect S. typhimurium. | N/A | 9 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0217 | 23473545 | 2013 | Selection and characterization of aptamers against Salmonella typhimurium using whole-bacterium SELEX | ST7P | ATAGGAGTCACGACGACCAGAA-TAAGTACAGGACTGGAGTATTAGCGGGGTCCATGCAAGGC-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (Lipopolysaccharide (LPS) or lipoprotein) of whole cell | Identify an aptamer that binds to and develop a fluorescent bioassay based on aptamer-MNPs conjugate to detect S. typhimurium. | N/A | 9 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0218 | 23473545 | 2013 | Selection and characterization of aptamers against Salmonella typhimurium using whole-bacterium SELEX | ST9 | AATCAATAGAAGACAAAGTCCGAAACAGGTGTGACGGTAA | 40 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (Lipopolysaccharide (LPS) or lipoprotein) of whole cell | Identify an aptamer that binds to and develop a fluorescent bioassay based on aptamer-MNPs conjugate to detect S. typhimurium. | Gated fluorescence intensity above background remained at 72 ± 1.57% for ST9. | 9 | Flow Cytometry | 9.45 ± 0.63 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0219 | 23473545 | 2013 | Selection and characterization of aptamers against Salmonella typhimurium using whole-bacterium SELEX | ST9P | ATAGGAGTCACGACGACCAGAA-AATCAATAGAAGACAAAGTCCGAAACAGGTGTGACGGTAA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (Lipopolysaccharide (LPS) or lipoprotein) of whole cell | Identify an aptamer that binds to and develop a fluorescent bioassay based on aptamer-MNPs conjugate to detect S. typhimurium. | Gated fluorescence intensity above background remained at 66 ± 1.45% for ST9P. | 9 | Flow Cytometry | 11.14 ± 0.12 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0220 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | C4 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-ACGGGCGTGGGGGCAATGCCTGCTTGTAGGCTTCCCCTGTGCGCG-GGTGGATCCATATTCCTACTCG | 105 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | C4 showed strong specific binding to S. Typhimurium, and the increase in the fluorescence intensity of C4 was less than 30% against E. coli and S. aureus. | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0221 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | C1 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GCGTGCGTCGGAGCCAGGATGCGAGGTCTGTAGGTCTGCGGGCGG-GGTGGATCCATATTCCTACTCG | 105 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0222 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | C2 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-ACGGCGGGCGAGTTGACGGCGTAATCGTGCTGCCGCGTG-GGTGGATCCATATTCCTACTCG | 99 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0223 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | C3 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GCGGGCGTGGCTCAGAGTGGGGGTCGGTCAGTCTTGTGCGCG-GGTGGATCCATATTCCTACTCG | 102 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0224 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | C5 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GCGTGCGGACGCCTGCGTGGCTGAGGCTTCGGTCTGCGCCG-GGTGGATCCATATTCCTACTCG | 101 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0225 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | C6 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-CGTGCGGCGGGCAGGATGGGATGCTGTAGGTCTGCGGGCGCGCG-GGTGGATCCATATTCCTACTCG | 104 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0226 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | C7 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-CGTGCGGAGCCAGGATGGGAGGTCTGTAGGTCTGCGGGGCGCG-GGTGGATCCATATTCCTACTCG | 103 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0227 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | C8 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GCGTGGGACGGGTACCGGGCGTGTGGCGTGCCTGCCGCG-GGTGGATCCATATTCCTACTCG | 99 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0228 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | C9 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-ACGTGCGGGCCGGATGGGAGCTCTGTAGGTTGCGGGCGCGG-GGTGGATCCATATTCCTACTCG | 101 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0229 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | CA1/SA-1 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GCGTGCGGGGGCCAGGATGCGA-GGTGGATCCATATTCCTACTCG | 82 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0230 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | CA2/SA-2 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GGTCTGTAGGTCTGCGGCGCGCG-GGTGGATCCATATTCCTACTCG | 83 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0231 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | CA3/SA-3 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GCGTGCGGGGGCCAGGATGCGAGGTCTGTAGGTCTGCGGCGCGCG-GGTGGATCCATATTCCTACTCG | 105 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0232 | 23698275 | 2013 | Highly specific and cost-efficient detection of Salmonella Paratyphi A combining aptamers with single-walled carbon nanotubes | Apt22 | GAATTCAGTCGGACAGCG-ATGGACGAATATCGTCTCCCAGTGAATTCAGTCGGACAGCG-GATGGACGAATATCGTCTCCC | 80 | 5'-GAATTCAGTCGGACAGCG-N40-GATGGACGAATATCGTCTCCC-3' | ssDNA | Salmonella Paratyphi A | Whole cell | Identify aptamers that bind to and detect S. Paratyphi A based on the noncovalent self-assembly of individual SWNTs and DNAzyme-labelled aptamer detection probe. | LOD of the method was 10(3) cfu/mL with a range from 10(3) to 10(7) cfu/mL, and detection signals of target bacteria were 4.4-fold higher than S. Enteritidis, 4.3-fold higher than S. Arizonae, 56.3-fold higher than S. aureus, and 24.3-fold higher than E. coli K88. | 17 | Fluorescence Spectroscopy | 47 ± 3 nM | Biosensor | Whole Cell-SELEX | FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0233 | 23698275 | 2013 | Highly specific and cost-efficient detection of Salmonella Paratyphi A combining aptamers with single-walled carbon nanotubes | Apt10 | GAATTCAGTCGGACAGCG-GATGATGGACGTATATCGTCTCCCATGAATTCAGTCGGACAGCG-GATGGACGAATATCGTCTCCC | 83 | 5'-GAATTCAGTCGGACAGCG-N40-GATGGACGAATATCGTCTCCC-3' | ssDNA | Salmonella Paratyphi A | Whole cell | Identify aptamers that bind to and detect S. Paratyphi A based on the noncovalent self-assembly of individual SWNTs and DNAzyme-labelled aptamer detection probe. | N/A | 17 | Fluorescence Spectroscopy | 73 ± 9 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0234 | 23698275 | 2013 | Highly specific and cost-efficient detection of Salmonella Paratyphi A combining aptamers with single-walled carbon nanotubes | Apt 45 | GAATTCAGTCGGACAGCG-ATGGACGAATATCGTCTCCCAGTGAATTCAGTCGGACAGC-GATGGACGAATATCGTCTCCC | 79 | 5'-GAATTCAGTCGGACAGCG-N40-GATGGACGAATATCGTCTCCC-3' | ssDNA | Salmonella Paratyphi A | Whole cell | Identify aptamers that bind to and detect S. Paratyphi A based on the noncovalent self-assembly of individual SWNTs and DNAzyme-labelled aptamer detection probe. | N/A | 17 | Fluorescence Spectroscopy | 68 ± 6 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0235 | 23698275 | 2013 | Highly specific and cost-efficient detection of Salmonella Paratyphi A combining aptamers with single-walled carbon nanotubes | Apt 60 | GAATTCAGTCGGACAGCG-CGCCCACCCATAATGGATCAGGGCGGGCACCACGATG-GATGGACGAATATCGTCTCCC | 76 | 5'-GAATTCAGTCGGACAGCG-N40-GATGGACGAATATCGTCTCCC-3' | ssDNA | Salmonella Paratyphi A | Whole cell | Identify aptamers that bind to and detect S. Paratyphi A based on the noncovalent self-assembly of individual SWNTs and DNAzyme-labelled aptamer detection probe. | N/A | 17 | Fluorescence Spectroscopy | 56 ± 9 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0236 | 23689505 | 2013 | Rapid single cell detection of Staphylococcus aureus by aptamer-conjugated gold nanoparticles | SA17 | TCCCTACGGCGCTAAC-CCCCCCAGTCCGTCCTCCCAGCCTCACACC-GCCACCGTGCTACAAC | 62 | 5'-TCCCTACGGCGCTAAC-N30-GCCACCGTGCTACAAC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC: 6538DR) | Whole cell | Identify aptamers that binds to and recognize strains of S.aureus using aptamer-conjugated gold nanoparticles. | LOD was 312 bacterial cells, and the lower limit of detection of the instrument was 63 ± 21 GNPs/μl for 100-nm particles and 508 ± 176 GNPs/μl for 60-nm particles. | 8 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 35 nM and 3.03 nM for SA17-GNPs | Biosensor | Whole Cell-SELEX | Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0237 | 23689505 | 2013 | Rapid single cell detection of Staphylococcus aureus by aptamer-conjugated gold nanoparticles | SA61 | TCCCTACGGCGCTAAC-CTCCCAACCGCTCCACCCTGCCTCCGCCTC-GCCACCGTGCTACAAC | 62 | 5'-TCCCTACGGCGCTAAC-N30-GCCACCGTGCTACAAC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC: 6538DR) | Whole cell | Identify aptamers that binds to and recognize strains of S.aureus using aptamer-conjugated gold nanoparticles. | LOD was 1250 bacterial cells, and the lower limit of detection of the instrument was 63 ± 21 GNPs/μl for 100-nm particles and 508 ± 176 GNPs/μl for 60-nm particles. | 8 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 129 nM and 9.9 nM for SA61-GNPs | Biosensor | Whole Cell-SELEX | Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0238 | 25436184 | 2013 | Molecular recognition of live methicillin-resistant staphylococcus aureus cells using DNA aptamers | DTMRSA1 | ATCCAGACGTGACGCAGC-ATGCGGTTGGTTGCGGTTGGGCATGATGTATTTCTGTG-TGGACACGGTGGCTTAGTA | 75 | 5'-ATCCAGAGTGACGCAGCA-N40-TGGACACGGTGGCTTAGT-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Whole cell | Identify aptamers against MRSA and conjugate them to AuNPs for their detection. | DTMRSA1 and DTMRSA3 showed the best specificity for MRSA. | 17 | Flow Cytometry | 1.6 ± 0.5 × 10(2) nM | Detection | Whole Cell-SELEX | 5'-Biotinylated or FITC Labeled or Thiolated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0239 | 25436184 | 2013 | Molecular recognition of live methicillin-resistant staphylococcus aureus cells using DNA aptamers | DTMRSA2 | ATCCAGAGTGACGCAGCA-CGACACGTTAGGTTGGTTAGGTTGGTTAGTTTCTTG-TGGACACGGTGGCTTA | 70 | 5'-ATCCAGAGTGACGCAGCA-N40-TGGACACGGTGGCTTAGT-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Whole cell | Identify aptamers against MRSA and conjugate them to AuNPs for their detection. | DTMRSA2 and DTMRSA4 bound to all three types of clinical bacterial strains. | 17 | Flow Cytometry | 2.0 ± 0.6 × 10(2) nM | Detection | Whole Cell-SELEX | 5'-Biotinylated or FITC Labeled or Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0240 | 25436184 | 2013 | Molecular recognition of live methicillin-resistant staphylococcus aureus cells using DNA aptamers | DTMRSA3 | ATCCAGAGTGACGCAGCA-GTAGATGGTTTGGTTGGTGTGGTTTCCTACTGATGTTGGG-TGGACACGGTGGCTTAGTA | 77 | 5'-ATCCAGAGTGACGCAGCA-N40-TGGACACGGTGGCTTAGT-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Whole cell | Identify aptamers against MRSA and conjugate them to AuNPs for their detection. | DTMRSA1 and DTMRSA3 showed the best specificity for MRSA. | 17 | Flow Cytometry | 1.3 ± 0.5 × 10(2) nM | Detection | Whole Cell-SELEX | 5'-Biotinylated or FITC Labeled or Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0241 | 25436184 | 2013 | Molecular recognition of live methicillin-resistant staphylococcus aureus cells using DNA aptamers | DTMRSA4 | ATCCAGAGTGACGCAGCA-TTATGGGGTGTGGTGGGGGGTTAATGCGTTGGTTATCCG-TGTGGACACGGTGGCTTA | 75 | 5'-ATCCAGAGTGACGCAGCA-N40-TGGACACGGTGGCTTAGT-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Whole cell | Identify aptamers against MRSA and conjugate them to AuNPs for their detection. | DTMRSA2 and DTMRSA4 bound to all three types of clinical bacterial strains. | 17 | Flow Cytometry | 9.5 ± 2 × 10(1) nM | Detection | Whole Cell-SELEX | 5'-Biotinylated or FITC Labeled or Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0250 | 23942378 | 2013 | Nucleic acid aptamers for capture and detection of Listeria spp | Lbi-17 | AGTATACGTATTACCTGCAGC-GAGGGAAGAAGGGCCAGCACAGATCAGATCAATCGCTCCG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers against Listeria spp. and develop aptamer-mediated magnetic capture (AMC) for detecting these bacteria. | Lbi-17 showed maximum binding of 78.7 ± 12.38% with an LOD of the combined AMC-qPCR method of 1.8 log10 CFU/500μl L.monocytogenes and ranged from 26% to 77%. | 6 | Flow Cytometry | 35.7 ± 8.02 μM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0251 | 23942378 | 2013 | Nucleic acid aptamers for capture and detection of Listeria spp | Lbi-16 | AGTATACGTATTACCTGCAGC-AAATACTTTAGATCTAAGAGTGTTTCGAAAAGACAACAGA-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers against Listeria spp. and develop aptamer-mediated magnetic capture (AMC) for detecting these bacteria. | N/A | 6 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0252 | 23942378 | 2013 | Nucleic acid aptamers for capture and detection of Listeria spp | Lbi-118 | AGTATACGTATTACCTGCAGC-TTGAATTAATAGATTAGTATACTTGGGAATCGTCCTAATA-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers against Listeria spp. and develop aptamer-mediated magnetic capture (AMC) for detecting these bacteria. | N/A | 6 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0253 | 23942378 | 2013 | Nucleic acid aptamers for capture and detection of Listeria spp | Lbi-200 | AGTATACGTATTACCTGCAGC-AGGAAGACAAATTCCGCCAAAAAGTGGATATAACCAATAA-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers against Listeria spp. and develop aptamer-mediated magnetic capture (AMC) for detecting these bacteria. | N/A | 6 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0254 | 23942378 | 2013 | Nucleic acid aptamers for capture and detection of Listeria spp | Lbi-203 | AGTATACGTATTACCTGCAGC-ATAGAGTAGAAGCTACACTACGTAATCACAGACAGATCCA-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers against Listeria spp. and develop aptamer-mediated magnetic capture (AMC) for detecting these bacteria. | N/A | 6 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0255 | https:doi.org10.1016j.foodcont.2013.03.011 | 2013 | Selection, identification and application of a DNA aptamer against Listeria monocytogenes | A15 | GGGAGCTCAGAATAAACGCTCAA-TACTATCGCGGAGACAGCGCGGGAGGCACCGGGGA-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to recognise Listeria monocytogenes. | Display a LOD of 75 CFU/mL and a wide linear range from 10(2) to 10(7). | 8 | Fluorescence Spectroscopy | 48.74 ± 3.11 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0256 | https:doi.org10.1016j.foodcont.2013.03.011 | 2013 | Selection, identification and application of a DNA aptamer against Listeria monocytogenes | A1 | GGGAGCTCAGAATAAACGCTCAA-GGGGGGCCTAGACTAGGGGGAGAGGGTGGGACGGT-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to recognise Listeria monocytogenes. | N/A | 8 | Fluorescence Spectroscopy | 86.41 ± 3.34 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0257 | https:doi.org10.1016j.foodcont.2013.03.011 | 2013 | Selection, identification and application of a DNA aptamer against Listeria monocytogenes | A10 | GGGAGCTCAGAATAAACGCTCAA-GGGGCGGCGGCGGTGGTACGGGGTTGGGAGCGGGC-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to recognise Listeria monocytogenes. | N/A | 8 | Fluorescence Spectroscopy | 203.12 ± 1.86 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0258 | https:doi.org10.1016j.foodcont.2013.03.011 | 2013 | Selection, identification and application of a DNA aptamer against Listeria monocytogenes | A9 | GGGAGCTCAGAATAAACGCTCAA-GGCGTATGCGCAGCGAGGGCGGCCGGGCGACGTCG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to recognise Listeria monocytogenes. | N/A | 8 | Fluorescence Spectroscopy | 88.36 ± 3.60 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0259 | https:doi.org10.1016j.foodcont.2013.03.011 | 2013 | Selection, identification and application of a DNA aptamer against Listeria monocytogenes | A8 | GGGAGCTCAGAATAAACGCTCAA-CCACGGGAACAACATCGTGGCAGGGACGAGCGTCCT-TTCGACATGAGGCCCGGATC | 79 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to recognise Listeria monocytogenes. | N/A | 8 | Fluorescence Spectroscopy | 120.91 ± 2.85 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0260 | https:doi.org10.1016j.foodcont.2013.03.011 | 2013 | Selection, identification and application of a DNA aptamer against Listeria monocytogenes | A4 | GGGAGCTCAGAATAAACGCTCAA-GCGCGCTGCCGACGCGGGGGGGCTGATTAGCGTGG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to recognise Listeria monocytogenes. | N/A | 8 | Fluorescence Spectroscopy | 205.83 ± 1.65 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0261 | https:doi.org10.1016j.foodcont.2013.03.011 | 2013 | Selection, identification and application of a DNA aptamer against Listeria monocytogenes | A13 | GGGAGCTCAGAATAAACGCTCAA-ACTGAGGGGCGGCGGACGGGATGGGAAATGTAGG-TTCGACATGAGGCCCGGATC | 77 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to recognise Listeria monocytogenes. | N/A | 8 | Fluorescence Spectroscopy | 299.94 ± 1.67 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0262 | https:doi.org10.1016j.foodcont.2013.03.011 | 2013 | Selection, identification and application of a DNA aptamer against Listeria monocytogenes | A12 | GGGAGCTCAGAATAAACGCTCAA-TAGCGTGGGTAACCGTGTTGGGGGGTGCCACGGTC-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to recognise Listeria monocytogenes. | N/A | 8 | Fluorescence Spectroscopy | 63.41 ± 3.39 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0289 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA101 | ATTACTTACGCTATCTAAttt-GGGGGGTGGGTTGTTTGGGATGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0290 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA102 | ATTACTTACGCTATCTAAttt-GGGGGGGGAACATGTTTGGGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | 3.5 nM (for B4) and 1.4 nM (for DL1d-A6) | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0291 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA103 | ATTACTTACGCTATCTAAttt-GGGGCGGGACTTATTTGGGGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0292 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA104 | ATTACTTACGCTATCTAAttt-GGGGGTGGGTGCTTTTGTGGTGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0293 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA105 | ATTACTTACGCTATCTAAttt-TAGGGGTGGGTTCAATTGGGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0294 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA106 | ATTACTTACGCTATCTAAttt-GGGGGGCGGGTATTAATGGGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0295 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA107 | ATTACTTACGCTATCTAAttt-GTTTTCGTGGGGGGGTGGGTGGTC-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0296 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA108 | ATTACTTACGCTATCTAAttt-GCACTAAAGGGGAGGTGGGTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0297 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA109 | ATTACTTACGCTATCTAAttt-TTGCTTTAGGGGAGGTTGGGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | 7.7 nM (for B4) and 4.1 nM (for DL1d-A6) | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0298 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA110 | ATTACTTACGCTATCTAAttt-TCGCTGATGGGGAGGAGGGTGGGT-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0299 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA111 | ATTACTTACGCTATCTAAttt-GCCCGATGGGGGTGGCGGGTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0300 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA2G02 | ATTACTTACGCTATCTAAttt-TTGCTGTAGGGGAGGAGGGTGGGT-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Displayed the highest specificity, exhibiting a 36% higher specificity index than that of the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0301 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G19 | ATTACTTACGCTATCTAAttt-TTTTTCGGGGGGTGGTGGGTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0302 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G14 | ATTACTTACGCTATCTAAttt-TTGCTTTAGAGGAGGCGGGTGGAG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0303 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G11 | ATTACTTACGCTATCTAAttt-TCGGTGATGGGGAGGAGGCGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0304 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G03 | ATTACTTACGCTATCTAAttt-GTTTTATGGGGGTGGCGTGTGGCG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0305 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G06 | ATTACTTACGCTATCTAAttt-TCGCTGATGGGGAGGAGCGTGGGT-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0306 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G10 | ATTACTTACGCTATCTAAttt-TTACTTTTGGGGGGGCGGGTGGTC-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0307 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G02 | ATTACTTACGCTATCTAAttt-GCACGTTTGGGGAGGTTGGGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0308 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G09 | ATTACTTACGCTATCTAAttt-TTTTTCGAGGGGAGATTGGGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0309 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G20 | ATTACTTACGCTATCTAAttt-GCGCGAGTGGGGGGGTGGGTGGTC-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0310 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G04 | ATTACTTACGCTATCTAAttt-GCCCGCGTCGGGGGGTGGGGGGTC-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0311 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G01 | ATTACTTACGCTATCTAAttt-TCGCTATGGGGGTGGCGGCTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0312 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA2G17 | ATTACTTACGCTATCTAAttt-TAGCTTTAGGGGTCGTGGGTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0313 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA2G08 | ATTACTTACGCTATCTAAttt-GAGCTTTAGAGGTGGTGGGTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0314 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA2G04 | ATTACTTACGCTATCTAAttt-TTCCTTGGGGAGTGGTGGGTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0315 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA2G06 | ATTACTTACGCTATCTAAttt-GTTTTCGGGGGCTGGTGGTTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0316 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA2G09 | ATTACTTACGCTATCTAAttt-TGGCTCGGGGGGTGTTGGGTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0317 | 23357235 | 2013 | Isolation and characterization of DNA aptamers against Escherichia coli using a bacterial cell-systematic evolution of ligands by exponential enrichment approach | E1 | GCAATGGTACGGTACTTCC-ACTTAGGTCGAGGTTAGTTTGTCTTGCTGGCGCATCCACTGAGCG-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolated and characterized aptamers against Escherichia coli. | Display binding ranging from 42.6% to 131.8% to E. coli. | 10 | Fluorescence Spectroscopy | 12.4 nM | Detection | Whole Cell-SELEX | 3'-Fluorescein Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0318 | 23357235 | 2013 | Isolation and characterization of DNA aptamers against Escherichia coli using a bacterial cell-systematic evolution of ligands by exponential enrichment approach | E2 | GCAATGGTACGGTACTTCC-CCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCG-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolated and characterized aptamers against Escherichia coli. | Display binding ranging from 42.6% to 131.8% to E. coli. | 10 | Fluorescence Spectroscopy | 25.2 nM | Detection | Whole Cell-SELEX | 3'-Fluorescein Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0319 | 23357235 | 2013 | Isolation and characterization of DNA aptamers against Escherichia coli using a bacterial cell-systematic evolution of ligands by exponential enrichment approach | E10 | GCAATGGTACGGTACTTCC-GTTGCACTGTGCGGCCGAGCTGCCCCCTGGTTTGTGAATACCCTGGG-CAAAAGTGCACGCTACTTTGCTAA | 90 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolated and characterized aptamers against Escherichia coli. | Display binding ranging from 42.6% to 131.8% to E. coli. | 10 | Fluorescence Spectroscopy | 14.2 nM | Detection | Whole Cell-SELEX | 3'-Fluorescein Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0320 | 23357235 | 2013 | Isolation and characterization of DNA aptamers against Escherichia coli using a bacterial cell-systematic evolution of ligands by exponential enrichment approach | E12 | GCAATGGTACGGTACTTCC-GCGAGGGCCAACGGTGGTTACGTCGCTACGGCGCTACTGGTTGAT-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolated and characterized aptamers against Escherichia coli. | Display binding ranging from 42.6% to 131.8% to E. coli. | 10 | Fluorescence Spectroscopy | 16.8 nM | Detection | Whole Cell-SELEX | 3'-Fluorescein Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0321 | https:doi.org10.1007s13765-013-3019-7 | 2013 | Potential of fluorophore labeled aptamers for Pseudomonas aeruginosa detection in drinking water | P.aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 10145) | Whole cell | Develop a fluorophore-labelled aptamer to detect P. aeruginosa in drinking water. | The limit of detection for P. aeruginosa was 5.07 cells/mL, with a linear dynamic range of 5.64 to 100 cells/mL. | N/A | N/A | N/A | Biosensor | N/A | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0322 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S 1 | ATAGGAGTCACGACGACCAGAA-CGGAACTAGCGTTTAAATGCCAGGACTGAAGTAGGCAGGG-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Identify an aptamer targeted against Shigella dysenteriae and develop a sandwich-type fluorescent bioassay for quantification. | Obtained linear range between 10(2)-10(7) cfu/mL of S. dysenteriae, and the limit of detection was 50 cfu/mL | 8 | Fluorescence Binding Assay | 23.47 ± 2.48 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled and Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0323 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S12 | ATAGGAGTCACGACGACCAGAA-CCTGGCGGGTCCCGGGGTAAACGGCACAAACGATAAAGAA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0324 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S2 | ATAGGAGTCACGACGACCAGAA-AAGATGACACTTGGCAGCCGCCTCGAGTGTCCTACACGCA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0325 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S8 | ATAGGAGTCACGACGACCAGAA-GCCAGATGAGGCCGGCAGGGCCCAAGTGTTGCTCGGGCTA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0326 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S21 | ATAGGAGTCACGACGACCAGAA-TGCACGGGACAAGAGTACACGCCGATTGCCAGGCACAGTG-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | 75.49 ± 3.74 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0327 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S10 | ATAGGAGTCACGACGACCAGAA-GGGGAAGCCGATCAGGCCAATCATTGAGGGTGAACTAGCT-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0328 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S19 | ATAGGAGTCACGACGACCAGAA-TTATCGGCTGGCAAAACTGCGGCTGGAGCTCACAACTAGA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0329 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S13 | ATAGGAGTCACGACGACCAGAA-TCAGCGAGGGCCAATTAGAAGGGTACTCATGTCTGTGGAC-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0330 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S24 | ATAGGAGTCACGACGACCAGAA-CCAGGCGGAATGTGTCTTCGTTTTGCGAGTGTTAAGGGCG-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0331 | 23494620 | 2013 | Selection of DNA aptamers for capture and detection of Salmonella Typhimurium using a whole-cell SELEX approach in conjunction with cell sorting | S8-7 | GTATACGTATTACCTGCAGC-CTGATGTGTGGGTAGGTGTCGTTGATTTCTTCTGGTGGGG-CGATATCTCGGAGATCTTGC | 80 | 5'-GTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) (Strain S913) | Whole cell | Identifying aptamers selected by whole-cell SELEX and developing a qPCR-based capture-detection platform for Salmonella Typhimurium. | N/A | 10 | Flow Cytometry | 1.73±0.54 μM | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0332 | 23494620 | 2013 | Selection of DNA aptamers for capture and detection of Salmonella Typhimurium using a whole-cell SELEX approach in conjunction with cell sorting | S8-46 | GTATACGTATTACCTGCAGC-CTTGGGCGGTTGGTGTGATGGGCTTTTTTCGTTGGGCCGG-CGATATCTCGGAGATCTTGC | 80 | 5'-GTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) (Strain S913) | Whole cell | Identifying aptamers selected by whole-cell SELEX and developing a qPCR-based capture-detection platform for Salmonella Typhimurium. | Achieved a Lower Limit of Detection (LOD) of 10(2)-10(3) CFU in a 290-μl sample, and the mean capture efficiency ranged from 3.6% to 12.6%. | 10 | Flow Cytometry | 0.74±0.20 μM | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0336 | 24267076 | 2013 | A dual-color flow cytometry protocol for the simultaneous detection of Vibrio parahaemolyticus and Salmonella typhimurium using aptamer conjugated quantum dots as labels | Apt1 | ATAGGAGTCACGACGACCAGAATCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACTTATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Aptamer-modified QDs (QD-apt) were developed to selectively capture and simultaneously detect the target bacteria. | For V. parahaemolyticus cells, a linear range of 3.4 × 10(4) to 3.4 × 10(7) cfu/mL was obtained with QD 535-apt 1-FCM, and a detection limit of 5 × 10³ cfu/mL was achieved. | N/A | N/A | N/A | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0337 | 24267076 | 2013 | A dual-color flow cytometry protocol for the simultaneous detection of Vibrio parahaemolyticus and Salmonella typhimurium using aptamer conjugated quantum dots as labels | Apt2 | ATAGGAGTCACGACGACCAGAAAGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGATATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Aptamer-modified Quantum Dots (QD-apt) were developed for selective bacterial capture. | For S. typhimurium, a linear range obtained between the concentrations 3.8 × 10(4) to 3.8 × 10(7) cfu/mL was obtained with QD 585-apt 2-FCM, and a detection limit of 5 × 10³ cfu/mL was achieved. | N/A | N/A | N/A | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0338 | 23929394 | 2013 | A PDMS/paper/glass hybrid microfluidic biochip integrated with aptamer-functionalized graphene oxide nano-biosensors for one-step multiplexed pathogen detection | L. acidophilus (FALA) | ATCCGTCACACCTGCTCTACGGCGCTCCCAACAGGCCTCTCCTTACGGCATATTATGGTGTTGGCTCCCGTAT | 73 | N/A | ssDNA | Lactobacillum Acidophilius (ATCC 4356) | Whole cell | Developed an aptamer-functionalized graphene oxide (GO) nano-biosensor for multiplexed pathogen detection. | Detection limits (LOD) of 11.0 cfu/mL (L. acidophilus). | N/A | N/A | 13 nM | Biosensor | N/A | 5'-Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0339 | 23929394 | 2013 | A PDMS/paper/glass hybrid microfluidic biochip integrated with aptamer-functionalized graphene oxide nano-biosensors for one-step multiplexed pathogen detection | S. aureus (FASA) | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed an aptamer-functionalized graphene oxide (GO) nano-biosensor for multiplexed pathogen detection. | Detection limits (LOD) of 800.0 cfu/mL (S. aureus) and linear ranges of 10(4)–10(6) cfu/mL. | N/A | N/A | 35 nM | Biosensor | N/A | 5'-Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0340 | 23929394 | 2013 | A PDMS/paper/glass hybrid microfluidic biochip integrated with aptamer-functionalized graphene oxide nano-biosensors for one-step multiplexed pathogen detection | S. enterica (FASE) | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed an aptamer-functionalized graphene oxide (GO) nano-biosensor for multiplexed pathogen detection. | Detection limits (LOD) of 61.0 cfu/mL (S. enterica) and linear ranges of 42.2–675.0 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0358 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-27 | ACGGCTCGCACTCTCTGATTT-GGCATAGCTGCCGGGAGGGGGGGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | The binding signal of EcA5-27 for E. coli NSM59 was notably higher (~ 1.5-fold) than for laboratory strains of E. coli, and 8.5- and 56-fold to additional uropathogenic isolates compared with laboratory strains. | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 110 nM | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0359 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-01 | ACGGCTCGCACTCTCTGATTT-CGGCACCCCGTCGCTATGTTGACC-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0360 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-02 | ACGGCTCGCACTCTCTGATTT-GGGGAGGTGGCGACCGCTTCTCAG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0361 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-03 | ACGGCTCGCACTCTCTGATTT-GGGGTCAGATATTAAACCGTGGGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0362 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-04 | ACGGCTCGCACTCTCTGATTT-GGGAGAGGGAGTGGTCTGGGAGAG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0363 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-05 | ACGGCTCGCACTCTCTGATTT-GCGGGCTTCGACACAGTGGGGGGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0364 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-06 | ACGGCTCGCACTCTCTGATTT-GGGAGGGGCGGCGAAGGAGTGGCG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0365 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-07 | ACGGCTCGCACTCTCTGATTT-GGAAGCGGTGGGGATCGTGTGTGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0366 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-08 | ACGGCTCGCACTCTCTGATTT-GGGAGCAAATCCGGAATGTGGGGC-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0367 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-09 | ACGGCTCGCACTCTCTGATTT-GGCGGAGGGGTTCGGGGTTGGCGC-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0368 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-10 | ACGGCTCGCACTCTCTGATTT-GGCGGGGCGTGGGGGATGTGTGTG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0369 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-11 | ACGGCTCGCACTCTCTGATTT-GGAATGCGAAGTGTGGCCTAGGGC-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0370 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-12 | ACGGCTCGCACTCTCTGATTT-GGGCGGGGGGGGATTCCGAGGCGC-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0371 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-13 | ACGGCTCGCACTCTCTGATTT-GGGGGGGTGGCATTTTGGGGTGGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0372 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-14 | ACGGCTCGCACTCTCTGATTT-GCGGGGAAAGAGAAGGAAGCGTCG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0373 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-15 | ACGGCTCGCACTCTCTGATTT-GGGCCCGAGTGGCGGTAGTTTCAG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0374 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-16 | ACGGCTCGCACTCTCTGATTT-GGGGGGTGGTGAAGGCCTGGGGGA-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0375 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-17 | ACGGCTCGCACTCTCTGATTT-GGGCCGGAGGGGCGCCTGCACCCA-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0376 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-18 | ACGGCTCGCACTCTCTGATTT-GGGGTTAGGCGAGGGGGGTGGGTG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0377 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-19 | ACGGCTCGCACTCTCTGATTT-CGGACGGTAGGGAAGGGGGGGGCG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0378 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-20 | ACGGCTCGCACTCTCTGATTT-GGCGAGGCAGGGTGCGGGGGCCCG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0379 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-21 | ACGGCTCGCACTCTCTGATTT-GCGTGTGGTGGGTGAGGGGTCTGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0380 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-22 | ACGGCTCGCACTCTCTGATTT-GGGGATAGCAGGACAATGAGGGGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0381 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-23 | ACGGCTCGCACTCTCTGATTT-GGCCGCGTGTGTGTCCGACTGGTG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0382 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-24 | ACGGCTCGCACTCTCTGATTT-GGGCGAGGAGAGAGGCGGAGGGCG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0383 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-25 | ACGGCTCGCACTCTCTGATTT-GCCGTGGTGTGTGTGATGGTCGGT-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0384 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-26 | ACGGCTCGCACTCTCTGATTT-GGCTTGGCTCCTCACGGGGGGTGA-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0385 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-28 | ACGGCTCGCACTCTCTGATTT-GGAGGGGTTGACCATGACCGGGGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0386 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-29 | ACGGCTCGCACTCTCTGATTT-GGGGGAAGGGCCAATGGATTGTGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0396 | 24018905 | 2014 | Simultaneous improvement of specificity and affinity of aptamers against Streptococcus mutans by in silico maturation for biosensor development | SMa#G6-25 | GGATCTGGTTAGTGAAGAGGGGGGAGGGGGGGTTGGGCTGTGGGGCGGTTAGTCGT | 56 | N/A | ssDNA | Streptococcus Mutans (ATCC 25175 and JCM 5175) | Whole cell | Improvement of affinity and specificity of aptamers against S. mutans using ISM and detection by aptamer-immobilised gold colloids. | N/A | 6 | Flow Cytometry | N/A | Detection | In Silico Maturation (ISM) | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0399 | 24018905 | 2014 | Simultaneous improvement of specificity and affinity of aptamers against Streptococcus mutans by in silico maturation for biosensor development | SMa#3-6-P1 | ATACCAGCTTATTCAATTGGGGGGAGGGGGGGTTGGGCTGTGGGGCGGTTAGCCGC | 56 | N/A | ssDNA | Streptococcus Mutans (ATCC 25175 and JCM 5175) | Whole cell | Improvement of affinity and specificity of aptamers against S. mutans using ISM and detection by aptamer-immobilised gold colloids. | N/A | 3 | Flow Cytometry | N/A | Detection | In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0400 | 24018905 | 2014 | Simultaneous improvement of specificity and affinity of aptamers against Streptococcus mutans by in silico maturation for biosensor development | SMa#G11-20 | CTACGTCTAGATTCCAGTCGAGGGGGGAGGGGGGGTTTTGGATCGGT | 47 | N/A | ssDNA | Streptococcus Mutans (ATCC 25175 and JCM 5175) | Whole cell | Improvement of affinity and specificity of aptamers against S. mutans using ISM and detection by aptamer-immobilised gold colloids. | N/A | 11 | Flow Cytometry | N/A | Detection | In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0401 | 24018905 | 2014 | Simultaneous improvement of specificity and affinity of aptamers against Streptococcus mutans by in silico maturation for biosensor development | SMa#G10-11 | CAACCTGCTTATCTAAGGGGGGGAGGGGGGGTTGTGGGTAGGT | 43 | N/A | ssDNA | Streptococcus Mutans (ATCC 25175 and JCM 5175) | Whole cell | Improvement of affinity and specificity of aptamers against S. mutans using ISM and detection by aptamer-immobilised gold colloids. | N/A | 10 | Flow Cytometry | N/A | Detection | In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0402 | 24018905 | 2014 | Simultaneous improvement of specificity and affinity of aptamers against Streptococcus mutans by in silico maturation for biosensor development | SMa#G2-1 | CTAGCAGTTCATTCAATAGGGGGGACGGGGGGTTAGGCTAGACTATGTCTAATCA | 55 | N/A | ssDNA | Streptococcus Mutans (ATCC 25175 and JCM 5175) | Whole cell | Improvement of affinity and specificity of aptamers against S. mutans using ISM and detection by aptamer-immobilised gold colloids. | N/A | 2 | Flow Cytometry | N/A | Detection | In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0403 | 24018905 | 2014 | Simultaneous improvement of specificity and affinity of aptamers against Streptococcus mutans by in silico maturation for biosensor development | SMa#G5-5 | ATACACGTAAGTACCATTGGGCGGGGGGGGTGTTGTTTTCTACTATGTGCAATCG | 55 | N/A | ssDNA | Streptococcus Mutans (ATCC 25175 and JCM 5175) | Whole cell | Improvement of affinity and specificity of aptamers against S. mutans using ISM and detection by aptamer-immobilised gold colloids. | N/A | 5 | Flow Cytometry | N/A | Detection | In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0404 | 24018905 | 2014 | Simultaneous improvement of specificity and affinity of aptamers against Streptococcus mutans by in silico maturation for biosensor development | SMa#G11-8 | ACACCACTTAATTCCATGCGAGGGGGGAGGGGGGGTTCGGGGACGGC | 47 | N/A | ssDNA | Streptococcus Mutans (ATCC 25175 and JCM 5175) | Whole cell | Improvement of affinity and specificity of aptamers against S. mutans using ISM and detection by aptamer-immobilised gold colloids. | N/A | 11 | Flow Cytometry | N/A | Detection | In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0409 | 24763818 | 2014 | Rapid fluorescent detection of Escherichia coli K88 based on DNA aptamer library as direct and specific reporter combined with immuno-magnetic separation | Apt B12 | TGGGAGCTCAGAATAAACGCTCAA-GGCACACAGGACTATACAGTGTTGCAGTGTTGCTG-TTCGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Escherichia Coli (E. Coli) ETEC K88 (CVCC 216) | Whole cell | DNA aptamer library for rapid detection of ETEC K88 combined with immuno-magnetic separation (IMS). | Exhibit detection limit of 1.1 × 10(3) CFU/ml in pure culture and 2.2 × 10(3) CFU/g in artificially contaminated faecal sample with aptamer library. | 13 | Fluorescence Binding Assay | 15 ± 4 nM | Diagnostic | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0410 | 24763818 | 2014 | Rapid fluorescent detection of Escherichia coli K88 based on DNA aptamer library as direct and specific reporter combined with immuno-magnetic separation | Apt H11 | TGGGAGCTCAGAATAAACGCTCAA-CCCTGCGGGGCTGCCCGATATGTGTCCAAGTGGTG-TTCGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Escherichia Coli (E. Coli) ETEC K88 (CVCC 216) | Whole cell | DNA aptamer library for rapid detection of ETEC K88 combined with immuno-magnetic separation (IMS). | Exhibit detection limit of 1.1 × 10(3) CFU/ml in pure culture and 2.2 × 10(3) CFU/g in artificially contaminated faecal sample with aptamer library. | 13 | Fluorescence Binding Assay | 66 ± 7 nM | Diagnostic | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0411 | 24763818 | 2014 | Rapid fluorescent detection of Escherichia coli K88 based on DNA aptamer library as direct and specific reporter combined with immuno-magnetic separation | Apt C09 | TGGGAGCTCAGAATAAACGCTCAA-TGGCCGTGTGGATAGAGGCGTGTTGTATGGGTGTG-TTCGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Escherichia Coli (E. Coli) ETEC K88 (CVCC 216) | Whole cell | DNA aptamer library for rapid detection of ETEC K88 combined with immuno-magnetic separation (IMS). | Exhibit detection limit of 1.1 × 10(3) CFU/ml in pure culture and 2.2 × 10(3) CFU/g in artificially contaminated faecal sample with aptamer library. | 13 | Fluorescence Binding Assay | 52 ± 8 nM | Diagnostic | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0412 | 24763818 | 2014 | Rapid fluorescent detection of Escherichia coli K88 based on DNA aptamer library as direct and specific reporter combined with immuno-magnetic separation | Apt H12 | TGGGAGCTCAGAATAAACGCTCAA-GGGGAGGCAGTGTGTTGTGCCGTGTGTATGCTTGG-TTCGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Escherichia Coli (E. Coli) ETEC K88 (CVCC 216) | Whole cell | DNA aptamer library for rapid detection of ETEC K88 combined with immuno-magnetic separation (IMS). | Exhibit detection limit of 1.1 × 10(3) CFU/ml in pure culture and 2.2 × 10(3) CFU/g in artificially contaminated faecal sample with aptamer library. | 13 | Fluorescence Binding Assay | 106 ± 12 nM | Diagnostic | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0413 | 24445115 | 2014 | An aptamer-based electrochemical biosensor for the detection of Salmonella | Aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Aptamer-based electrochemical biosensor for Salmonella detection. | A detection limit of 3 cfu/mL was achieved, with a linear range of 2.4 cfu/mL to 2.4 × 10^3 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0414 | 24325983 | 2014 | Graphene-based potentiometric biosensor for the immediate detection of living bacteria | SA20 | GCAATGGTACGGTACTTCCGCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTATCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CECT 4630) | Whole cell | Developed a potentiometric aptasensor based on graphene oxide (GO-covalently conjugated aptamer) and reduced graphene oxide (RGO-non-covalently conjugated aptamer) to detect S. aureus. | Able to detect 1 CFU/mL in a few minutes. | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0415 | 24325983 | 2014 | Graphene-based potentiometric biosensor for the immediate detection of living bacteria | SA31 | GCAATGGTACGGTACTTCCTCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGACAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CECT 4630) | Whole cell | Developed a potentiometric aptasensor based on graphene oxide (GO-covalently conjugated aptamer) and reduced graphene oxide (RGO-non-covalently conjugated aptamer) to detect S. aureus. | Able to detect 1 CFU/mL in a few minutes. | N/A | N/A | N/A | Biosensor | N/A | 3'-C3-Pyr | N/A | N/A | N/A | N/A | N/A |
| ABdb_0416 | 24804556 | 2014 | Aptamer-fluorescent silica nanoparticles bioconjugates based dual-color flow cytometry for specific detection of Staphylococcus aureus | Aptamer | GCAATGGTACGGTACTTCCTCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGACAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Develop aptamer recognition and FSiNPs label-based dual-colour flow cytometry assay (Aptamer/FSiNPs-DCFCM) for the detection of S. aureus. | Detects as low as 1.5×10(2) and 7.6×10(2) cells/mL S. aureus in buffer and spiked milk, respectively. | N/A | N/A | N/A | Biosensor | N/A | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0417 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT17 | CGCGTCAGAGGTGTGTCGGGGCTGTGTAGATCTACATGGG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0418 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT12 | CAGTCGCTTTCCGTTCTCCGGCAGGTTCATTGTGGTTTCG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0419 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT11 | CATATCAGGTCGTCACCGTAACAGAGCTCTCGCAATCACG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0420 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT9 | CAAAGGCAGCAGTAGCATGGCGATTTACATCAATTATTGG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0421 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT8 | CAATATCAGAAGTAGCGCGAAGGACGACATGTCAGGAAGG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0422 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT7 | CACACATCCTCGCAGCCTCGTACCTGATTCCAGTCTATTG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0423 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT6 | CCAGGAAGGCGAGAGCCGAGAAGCGATCCTTGGGTATAGG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0424 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT5 | CGGCATCCGTTCACGTACCTGTCCTAGTTATCACCGTTTG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0425 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT5.1 | CAAGCAGAGTTCCGAGACACAGTACCACACGCATATCCGG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0426 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT4 | CACACAGAGACGGTGAAGGCGCCGACCAGTTCCTAAAGAG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0430 | 24568625 | 2014 | Simultaneous aptasensor for multiplex pathogenic bacteria detection based on multicolor upconversion nanoparticles labels | Apt₁ | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed a multiplex method for the simultaneous detection of three pathogenic bacteria using multicolour upconversion nanoparticles (UCNPs) coupled with aptamers. | The linear range showed from 50-10(6) cfu/mL, and the limits of detection were 25 cfu/mL for S. aureus. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0431 | 24568625 | 2014 | Simultaneous aptasensor for multiplex pathogenic bacteria detection based on multicolor upconversion nanoparticles labels | Apt₂ | ATAGGAGTCACGACGACCAGAATCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACTTATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a multiplex method for the simultaneous detection of three pathogenic bacteria using multicolour upconversion nanoparticles (UCNPs) coupled with aptamers. | The linear range showed from 50-10(6) cfu/mL, and the limits of detection were 10 cfu/mL for V. parahemolyticus. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0432 | 24568625 | 2014 | Simultaneous aptasensor for multiplex pathogenic bacteria detection based on multicolor upconversion nanoparticles labels | Apt₃ | ATAGGAGTCACGACGACCAGAAAGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGATATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a multiplex method for the simultaneous detection of three pathogenic bacteria using multicolour upconversion nanoparticles (UCNPs) coupled with aptamers. | The linear range showed from 50-10(6) cfu/mL, and the limits of detection were 15 cfu/mL for S. typhimurium. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0433 | 24650583 | 2014 | A universal fluorescent aptasensor based on AccuBlue dye for the detection of pathogenic bacteria | ST-apt | AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | A universal fluorescent aptasensor based on the AccuBlue dye was developed for the detection of pathogenic bacteria. | Exhibit a linear concentration range of 50 to 10(6) cfu/mL, and the LOD was 25 cfu/mL in 1.5 h for S. typhimurium. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0434 | 24650583 | 2014 | A universal fluorescent aptasensor based on AccuBlue dye for the detection of pathogenic bacteria | VP-apt | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Aptamer is hybridized with complementary DNA (cDNA) to form fluorescent dsDNA. | Exhibit a linear concentration range of 50 to 10(6) cfu/mL, and the LOD was 35 cfu/mL in 1.5 h for V. parahaemolyticus. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0435 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM6-2 | AGTATACGTATTACCTGCAGC-TGGGGGGTGGTTGGGGGTAGTATATCGGGTCAGTGGTGCG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0436 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM6-103 | AGTATACGTATTACCTGCAGC-GGGAGGCGTGAAGTGTGATGGTGTGGGGGGTAGTGGCCGG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0437 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM6-109 | AGTATACGTATTACCTGCAGC-CCGCTCAACAAGGTGCTACAAAGATCCTGTGTCCCTTGGC-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0438 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM6-116 | AGTATACGTATTACCTGCAGC-TACTCGTTATTTCGTAGCACTTTTCCCCACCACCTTGGTG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | LM6-116 showed strong genus-specific binding affinity when screened against five different species within the Listeria genus. | 6 | Flow Cytometry | 74.4 ±52.69 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0439 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM6-118 | AGTATACGTATTACCTGCAGC-CTGGTATAGACGTTATTCGTCCGCTCTTGTATCCTTGTGG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0440 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM6-121 | AGTATACGTATTACCTGCAGC-TGTCGGTGGGGGGTGGCTTGAGTACGTGACGTGGTGTGGG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0441 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM12-2 | AGTATACGTATTACCTGCAGC-CCATTGTTCTATCGCTAGCTCGCTCTGGCCAGCTCCTTGG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0442 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM12-6 | AGTATACGTATTACCTGCAGC-TCTGTGTTCCGTTTTCGATTCTTACTGTGTTTTCGGGTGC-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | 106.4 ±43.91 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0443 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM12-13 | AGTATACGTATTACCTGCAGC-TGGGGGGGGGGGGAGGGGTCGGTGAGCGTGGGAGGAGGAG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0444 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM12-74 | AGTATACGTATTACCTGCAGC-CCGACCTTCTATCCTTCCAGTTTTTTGTAAACTCTTCTGG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0454 | https://doi.org/10.1016/j.foodcont.2013.09.046 | 2014 | A visual detection method for Salmonella Typhimurium based on aptamer recognition and nanogold labeling | Aptamer 1 | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) (ATCC 50761) | Whole cell | Developed a sandwich detection method based on the recognition of aptamers coupled with nanogold labelling and silver signal amplification for the detection of Salmonella Typhimurium. | Obtained a linear range of 10-10(6) cfu/mL, and the detection limit was observed to be 7 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0455 | https://doi.org/10.1016/j.foodcont.2013.09.046 | 2014 | A visual detection method for Salmonella Typhimurium based on aptamer recognition and nanogold labeling | Aptamer 2 | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) (ATCC 50761) | Whole cell | Developed a sandwich detection method based on the recognition of aptamers coupled with nanogold labelling and silver signal amplification for the detection of Salmonella Typhimurium. | Obtained a linear range of 10-10(6) cfu/mL, and the detection limit was observed to be 7 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0456 | https://doi.org/10.1007/s00604-014-1170-4 | 2014 | Fluorescent aptasensor for the determination of Salmonella typhimurium based on a graphene oxide platform | Aptamer | GGGAGCTCAGAATAAACGCTCAAGGGCAGGTGTTATGTGTACTGCTACAGTGTGGTTGTTCGACATGAGGCCCGGAC | 77 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) (CMCC 50115) | Whole cell | Developed a fluorescent aptasensor based on a graphene oxide platform for the determination of S. typhimurium. | Displays a linear response to bacteria in the concentration range from 1 × 10(3) to 1 × 10(8) CFU/mL, with a detection limit of 100 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0457 | 24913871 | 2014 | A sensitive gold nanoparticle-based colorimetric aptasensor for Staphylococcus aureus | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed a gold nanoparticle-based colorimetric aptasensor for S. aureus using tyramine signal amplification (TSA) technology. | Exhibited a linear detection range from 10 to 10⁶ cfu/mL with a limit of detection (LOD) of 9 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0458 | 25188392 | 2014 | Gold nanoparticle-based enzyme-linked antibody-aptamer sandwich assay for detection of Salmonella Typhimurium | STM-binding aptamer | ATCCGTCACACCTGCTCTGGAGCAATATGGTGGAGAAACGTGGTGTTGGCTCCCGTAT | 58 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) (CMCC 50115) | Whole cell | Develop a gold nanoparticle-based enzyme-linked antibody-aptamer sandwich (nano-ELAAS) method for quantitative detection of STM. | Quantitative detection range: 1 × 10³ to 1 × 10⁸ CFU/mL and LOD: 1 × 10³ CFU/mL, and a selectivity of >10-fold for STM in samples containing other bacteria at higher concentration, with an assay time of less than 3 h. | N/A | LPS-Aptamer Plate Binding Assay | 19.59 ± 0.35 nM | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) and 5'-FITC Labeled and 5'-Biotinylated | N/A | MMP-aptamers and nanoprobes were stored at 4°C for 2 weeks, no obvious change of the S/B was observed. | N/A | N/A | N/A |
| ABdb_0459 | 25437803 | 2014 | Application of DNA Aptamers and Quantum Dots to Lateral Flow Test Strips for Detection of Foodborne Pathogens with Improved Sensitivity versus Colloidal Gold | EcO 3R | CACACCTGCTCTGTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCGTGGTGTTGGCTC | 60 | N/A | ssDNA | Escherichia Coli (E. Coli) strain 8739 (Crooks strain) and Escherichia Coli (E. Coli) O157:H7 | Whole cell | Sandwich (EcO 3R/4F) Lateral Flow Assay (aptamer-Qdot LF strip) for the detection of E.coli. | Sandwich combination (EcO 3R-conjugate and EcO 4F-capture aptamer) yielded a visible limit of detection (LOD) of ~3,000 E. coli 8739 and ~6,000 E. coli O157:H7 in buffer. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated and 3′-DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | U.S. Patent Application 13/136,820 |
| ABdb_0460 | 25437803 | 2014 | Application of DNA Aptamers and Quantum Dots to Lateral Flow Test Strips for Detection of Foodborne Pathogens with Improved Sensitivity versus Colloidal Gold | EcO 4F | ATACGGGAGCCAACACCATAATATGCCGTAAGGAGAGGCCTGTTGGGAGCGCCGTAGAGCAGGTGTGACGGAT | 73 | N/A | ssDNA | Escherichia Coli (E. Coli) strain 8739 (Crooks strain) and Escherichia Coli (E. Coli) O157:H7 | Whole cell | Sandwich Lateral Flow Assay (aptamer-Qdot LF strip) for the detection of E.coli. | Sandwich combination (EcO 3R-conjugate and EcO 4F-capture aptamer) yielded a visible limit of detection (LOD) of ~3,000 E. coli 8739 and ~6,000 E. coli O157:H7 in buffer. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | U.S. Patent Application 13/136,820 |
| ABdb_0461 | https://doi.org/10.1007/s00604-014-1406-3 | 2014 | Simultaneous detection of pathogenic bacteria using an aptamer based biosensor and dual fluorescence resonance energy transfer from quantum dots to carbon nanoparticles. | Apt1 ( V. parahaemolyticus aptamer) | ATAGGAGTCACGACGACCAGAATCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACTTATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Develop a dual fluorescence resonance energy transfer (FRET) from gQDs and rQDs and amorphous carbon nanoparticles (CNPs) for simultaneous detection of V. parahaemolyticus and S. typhimurium. | LOD: 25 cfu/mL and linear range from 50 to 10(6) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0462 | https://doi.org/10.1007/s00604-014-1406-3 | 2014 | Simultaneous detection of pathogenic bacteria using an aptamer based biosensor and dual fluorescence resonance energy transfer from quantum dots to carbon nanoparticles. | Apt2 (S. typhimurium aptamer) | ATAGGAGTCACGACGACCAGAAAGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGATATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) (ATCC 14028) | Whole cell | Develop a dual fluorescence resonance energy transfer (FRET) from gQDs and rQDs and amorphous carbon nanoparticles (CNPs) for simultaneous detection of V. parahaemolyticus and S. typhimurium. | LOD: 35 cfu/mL and linear range from 50 to 10(6) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0463 | 25096391 | 2014 | Development of ssDNA aptamers for the sensitive detection of Salmonella typhimurium and Salmonella enteritidis | Se1 | CACACCGGAAGGGATGCCACCTAAACCCC | 29 | 5'-GCGCGGATCCCGCGC-N30-CGCGCGAAGCTTGCG-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Identify aptamers that can be used as detection probes in a polyvalent directed aptamer polymer (PDAP), which specifically bind to S. enteritidis and S. typhimurium. | The binding efficiency of the PDAP of Se1 was approximately 100-fold higher than that of the single aptamer. | 10 | Fluorescence Spectroscopy | 4.66 ± 0.35 μM (of single aptamer) and 57.86 ± 14.5 nM (of PDAP) | Detection | Whole Cell-SELEX | 5'-FAM Labeled, 3'-Thiolated and Poly-D-Lysine (PDL) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0464 | 25096391 | 2014 | Development of ssDNA aptamers for the sensitive detection of Salmonella typhimurium and Salmonella enteritidis | Se2 | CACAGATGACGTCTGGCACATAATTAACAC | 30 | 5'-GCGCGGATCCCGCGC-N30-CGCGCGAAGCTTGCG-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Identify aptamers that can be used as detection probes in a polyvalent directed aptamer polymer (PDAP), which specifically bind to S. enteritidis and S. typhimurium. | The binding efficiency of the PDAP for Se2 was approximately 80-fold higher than that of the single aptamer. | 10 | Fluorescence Spectroscopy | 3.83 ± 0.10 μM (of single aptamer) and 55.84 ± 24.7 nM (of PDAP) | Detection | Whole Cell-SELEX | 5'-FAM Labeled, 3'-Thiolated and Poly-D-Lysine (PDL) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0465 | 25096391 | 2014 | Development of ssDNA aptamers for the sensitive detection of Salmonella typhimurium and Salmonella enteritidis | St1 | CCGATGTCCGTTAGGGCTCCTCCATAGAT | 29 | 5'-GCGCGGATCCCGCGC-N30-CGCGCGAAGCTTGCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that can be used as detection probes in a polyvalent directed aptamer polymer (PDAP), which specifically bind to S. enteritidis and S. typhimurium. | The binding efficiency of the PDAPs of St1 was approximately 20-fold higher than that of the single aptamer. | 10 | Fluorescence Spectroscopy | 0.530 ± 0.01 μM (of single aptamer) and 25 ± 5.6 nM (of PDAP) | Detection | Whole Cell-SELEX | 5'-FAM Labeled, 3'-Thiolated and Poly-D-Lysine (PDL) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0468 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | b03 | TGGGAGCTCAGAATAAACGCTCAA-TTTTCCTGTTGTTGTTGTTTTTGGGGTTTTTTGTTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0469 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | h03 | TGGGAGCTCAGAATAAACGCTCAA-ATTTGTTTTGTTGGTGTTGTTGGCAGGTTTTGTTTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0470 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | h04 | TGGGAGCTCAGAATAAACGCTCAA-TTTTTTGTTTTAGTTTTGTTTTGGTTTGTAGTGTTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0471 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | c04 | TGGGAGCTCAGAATAAACGCTCAA-TGTTTTTTTGTGGGTTTGTTTTTTTCTTCTTTTTTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0472 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | c01 | TGGGAGCTCAGAATAAACGCTCAA-TGTCGTTGTCGTTTTGTGTTTTTTTGGTGTTTTTGTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0473 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | a04 | TGGGAGCTCAGAATAAACGCTCAA-TTGTTTGTTTTGGTTTTTTCGTTTTTTTTTGTTTTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0474 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | b02 | TGGGAGCTCAGAATAAACGCTCAA-TATGTTGTCTTTTGTTTTGTGTTTTTTGTTGGTTTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0475 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | f01 | TGGGAGCTCAGAATAAACGCTCAA-GTGGTATAGTTCTTTTTTTTTGTTTTTTTGTTTTTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | 150.8 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0476 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | b04 | TGGGAGCTCAGAATAAACGCTCAA-TGGTCTTGTCGTTTTATTGTTTTTTTTTTTCTGTTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0477 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | e01 | TGGGAGCTCAGAATAAACGCTCAA-CTTTGTTCTTCTTTGCTTTTTTTTTCTTTTTTTGTT-CGACATGAGGCCCGGATCA | 79 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | Digoxigenin-aptamer could bind to the target L. monocytogenes with much higher specificity, resulting in a clear fluorescent signal. | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | 60.01 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0478 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | h02 | TGGGAGCTCAGAATAAACGCTCAA-TGTTTGTCTGTTTTCGTTTGTCTATTTGGTTCAGTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0479 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | e05 | TGGGAGCTCAGAATAAACGCTCAA-GCTGTTTTTTTCGTGTTGGGTTTTTTGTTTTGTTTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0480 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | d02 | TGGGAGCTCAGAATAAACGCTCAA-TTGTTTTTTTTTTTTGGTGTTTTTTTTTTATTTT-CGACATGAGGCCCGGATCA | 77 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0481 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | c03 | TGGGAGCTCAGAATAAACGCTCAA-TTGTTTGTTTTTTTTTTGGCTGTTATTTTGTTTTTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0482 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | d03 | TGGGAGCTCAGAATAAACGCTCAA-CTGTCTTTTGTTTTTGTTGTGTTTTTTTGTTTTTGTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0483 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | g02 | TGGGAGCTCAGAATAAACGCTCAA-TGTCACTAGGCTTTTGGGATTCTCTGTGCATTTTGTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0484 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | g01 | TGGGAGCTCAGAATAAACGCTCAA-TGTTGGTCTGTGTTATATTTTTTGTATCTCGTTCTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0485 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | g03 | TGGGAGCTCAGAATAAACGCTCAA-TTCCTGGTTTATGTTGGGTTTTTTTGTTTCCTGGTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0486 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | f04 | TGGGAGCTCAGAATAAACGCTCAA-GCCTTCTGCCTGTGTACGTTAGTGTTTGTGTCTATTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0487 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | d04 | TGGGAGCTCAGAATAAACGCTCAA-GGCTTTTTCGTCTTGTTCCTTGTTATTTGTTGTTTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0488 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | e03 | TGGGAGCTCAGAATAAACGCTCAA-GGTTGTGCTTTGTATTCTCTTTTCTGTTTGATTTTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0489 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | h01 | TGGGAGCTCAGAATAAACGCTCAA-TGTCTTTCCGTCGATATGCTGCTGACGCTTGGGGCTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0490 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | a02 | TGGGAGCTCAGAATAAACGCTCAA-TCACTGTTTGTCTGTTTGCTGGGTTTTTTGTTTTGTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0491 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | c02 | TGGGAGCTCAGAATAAACGCTCAA-CTCTCAATGTGTATCTTGTTGCCGTTGTTCTTGTGTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0492 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | d05 | TGGGAGCTCAGAATAAACGCTCAA-TGTAGTTTTTGTTTTGCGTGGTTTTAGATGCTGGCTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0493 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | e02 | TGGGAGCTCAGAATAAACGCTCAA-TGTACCGGTGGTATTGTTTATGGTTGGCTGTTCTGTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0494 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | c05 | TGGGAGCTCAGAATAAACGCTCAA-CAGCCGGGGTGCGGGGCAAGGAGAGCGCGGTCAATTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0495 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | f02 | TGGGAGCTCAGAATAAACGCTCAA-CGGGGTGGGACTTTTAGCGTATTTGTGCTGGCGTGTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0496 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | e04 | TGGGAGCTCAGAATAAACGCTCAA-GGGGGCGAGTGGAAGAGGCAGGGAAGGGAAATGCGTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0497 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | g04 | TGGGAGCTCAGAATAAACGCTCAA-GGGGGGGGGGTATTGGCAGAGGTGGTTAGGTGGCCCTT-CGACATGAGGCCCGGATCA | 81 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0498 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | a03 | TGGGAGCTCAGAATAAACGCTCAA-GGCGGGAGGAGACCGACCAGGCTCAGGGTGGGGCGTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0501 | https://doi.org/10.1039/C4RA01901F | 2014 | A simple aptamer biosensor for Salmonellae enteritidis based on fluorescence-switch signaling graphene oxide | S-aptamer | TCGGCAACAAGGTCACCCGGAGAAGATCGGTGGTCAAACTGCATAGGTAGTCCAGAAGCC | 60 | N/A | ssDNA | Salmonella Enteritidis (S. Enteritidis) (ATCC 13076) | Whole cell | Developed a fluorescent aptasensor with an aptamer functionalized into graphene oxide to detect S. enteritidis. | Can detect as low as 40 CFU/mL of S. enteritidis in 30 min. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0506 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 36 | CCGTCAGCCGAGGACCACAC-TTGGTTGCTGAATCCCCTCGTCTTGGCTTTCTTTGTCGGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | Mtb36 aptamer bound to M. tuberculosis H37Ra bacteria more than 4 times for M. bovis and 70 times for E. coli bacteria. | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 5.09 ±1.43 nM | Detection | Whole Cell-SELEX | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0507 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 17 | CCGTCAGCCGAGGACCACAC-GCGTCAATATGCTCGAGTCCCTTACTCCGTAATCTTGGGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0508 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 57 | CCGTCAGCCGAGGACCACAC-GAGGCGGGGCGTACATGATGGAGGTGTTGTGTTCTTGGGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0509 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 25 | CCGTCAGCCGAGGACCACAC-ATAGGAAGTATGCGGTCGTAGTTAATCGCCTGTCCTGGGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0510 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 32 | CCGTCAGCCGAGGACCACAC-CTGGGCTCACTCACTGGCGTATCATTCGTCCGCGGTGGGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0511 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 3 | CCGTCAGCCGAGGACCACAC-CGCTTCACGTGTCAGTGAATTTTCTCCATCGTTTGGTGGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0512 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 40 | CCGTCAGCCGAGGACCACAC-TGTAGCGCATCTACGGGCTCTTCATTACGTCTATATCGGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0513 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 33 | CCGTCAGCCGAGGACCACAC-TTCACACACGGGTATAAACGCTCTGGTATGTCAAGCCGGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0514 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 35 | CCGTCAGCCGAGGACCACAC-TCGGACCTAGTGCTAGGGTCTCTAAGAAGTATCGGGGTGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0515 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 49 | CCGTCAGCCGAGGACCACAC-TTCTCCGATCTTAGTCAACTTGGACCATGAATGCGGGTGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0516 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 46 | CCGTCAGCCGAGGACCACAC-TATTTACGCTGACCGACGATTTTCTATCAGAGTGCCGTGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0517 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 13 | CCGTCAGCCGAGGACCACAC-CGATCACTGTACAGTCCTGGATAAGCCGTTCTTTCCGTGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0518 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 11 | CCGTCAGCCGAGGACCACAC-CGCCGGCCTTCTTACAAGACCTGTTCAATTCCCAGTGTGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0519 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 50 | CCGTCAGCCGAGGACCACAC-AGGCTCACGCCCTGTCAATACTGCCTCTTGTCCTTCCTGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0520 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 38 | CCGTCAGCCGAGGACCACAC-ATTCGGCTGAAGACCCGAGCCGGTCATCCGGTGTTCCTGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0521 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 28 | CCGTCAGCCGAGGACCACAC-CTCCATCACGTGTAGTCAGCTGACCATTGATCGTGCCTGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0522 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 8 | CCGTCAGCCGAGGACCACAC-CTATCCCGTGGTCCATTGCTTTTCCCGGTCTCTTCTCTGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0523 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 52 | CCGTCAGCCGAGGACCACAC-CTTTGTGCCGGGAAAAGACTGGCCTGTGTTGACTTGCTGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0524 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 2 | CCGTCAGCCGAGGACCACAC-CGGCGCTTTTCTCATCCTACCTCCGCTCTTACCTGTATGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0525 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 9 | CCGTCAGCCGAGGACCACAC-GCCGTGCTGAGTCTGTCAGCAGTTTGCTAGTCTTCCCTGC-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0526 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 44 | CCGTCAGCCGAGGACCACAC-TTACACGAAGGCTCGGCCCATCTCTCTCGTGTCACTTCGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0540 | 25891472 | 2015 | Antibiotic loaded nanocapsules functionalized with aptamer gates for targeted destruction of pathogen | SA20hp | GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT | 45 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Aptamer-gated nanocapsules for the specific targeting of vancomycin to bacteria for the controlled release of vancomycin. | 15-fold increase of efficacy for vancomycin with MIC of 0.420 μg/mL. | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 5'-AlexaFluor 488 Labeled and 3'-(PEG)-AGGGCGC-BH1 | MICs of vancomycin-nanoparticles for S. epidermidis (control) were found to be 6.295 µg/mL. | N/A | N/A | N/A | N/A |
| ABdb_0566 | 25884791 | 2015 | Comparison of whole-cell SELEX methods for the identification of Staphylococcus aureus-specific DNA aptamers | A2 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-ACGGGCGTGGGAGGCAATGCCTTGCTTGTAGGCTTCCCCTGTGCGCG-GGTGGATCCATATTCCTACTCG | 107 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Staphylococcus aureus (S. aureus) (KCCM 12103) | Whole cell | Identify aptamers against bacterial surface molecules and live Staphylococcus aureus. | N/A | 16 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0567 | 25884791 | 2015 | Comparison of whole-cell SELEX methods for the identification of Staphylococcus aureus-specific DNA aptamers | A14 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-CACACCGCAGCAGTGGGAACGTTTCAGCCATGCAAGCATCACGCCCGT-GGTGGATCCATATTCCTACTCG | 108 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Staphylococcus aureus (S. aureus) (KCCM 12103) | Whole cell | Identify aptamers against bacterial surface molecules and live Staphylococcus aureus. | Showed specific binding to S. aureus. | 16 | Fluorescence Spectroscopy | 3.49 ± 1.43 nM | Detection | Whole Cell-SELEX | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0568 | 25884791 | 2015 | Comparison of whole-cell SELEX methods for the identification of Staphylococcus aureus-specific DNA aptamers | A15 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-CACGCGCAAACAGATTAACACTCCGCCTAAGTCTGCCGCACGC-GGTGGATCCATATTCCTACTCG | 103 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Staphylococcus aureus (S. aureus) (KCCM 12103) | Whole cell | Identify aptamers against bacterial surface molecules and live Staphylococcus aureus. | N/A | 16 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0569 | 25884791 | 2015 | Comparison of whole-cell SELEX methods for the identification of Staphylococcus aureus-specific DNA aptamers | A20 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GCGTGCAGCGGGGGCTGCGCGGTGGAGTGCTGTGGGCG-GGTGGATCCATATTCCTACTCG | 98 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Staphylococcus aureus (S. aureus) (KCCM 12103) | Whole cell | Identify aptamers against bacterial surface molecules and live Staphylococcus aureus. | N/A | 16 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0570 | 25884791 | 2015 | Comparison of whole-cell SELEX methods for the identification of Staphylococcus aureus-specific DNA aptamers | B3 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GCGTGCGGAGCCAGGATGGGAGGTCTGTAGGTCTGCGGGGCGTG-GGTGGATCCATATTCCTACTCG | 104 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Staphylococcus aureus (S. aureus) (KCCM 12103) | Whole cell | Identify aptamers against bacterial surface molecules and live Staphylococcus aureus. | Showed specific binding to S. aureus. | 16 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0571 | 25884791 | 2015 | Comparison of whole-cell SELEX methods for the identification of Staphylococcus aureus-specific DNA aptamers | B6 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GCGTGTCGGTGTCTGCCGGGGGATGTGGAGGCTGGGTGTTGCGCG-GGTGGATCCATATTCCTACTCG | 105 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Staphylococcus aureus (S. aureus) (KCCM 12103) | Whole cell | Identify aptamers against bacterial surface molecules and live Staphylococcus aureus. | Showed specific binding to S. aureus. | 16 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0572 | 25884791 | 2015 | Comparison of whole-cell SELEX methods for the identification of Staphylococcus aureus-specific DNA aptamers | B7 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GCGTGGGCGGGCTACCTGGCTAGTACGCCATGATGCCTGCACGCG-GGTGGATCCATATTCCTACTCG | 105 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Staphylococcus aureus (S. aureus) (KCCM 12103) | Whole cell | Identify aptamers against bacterial surface molecules and live Staphylococcus aureus. | N/A | 16 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0573 | 25884791 | 2015 | Comparison of whole-cell SELEX methods for the identification of Staphylococcus aureus-specific DNA aptamers | B15 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-CACGCGCAAACAGATTAACACTCCGCCTAAGTCTGCCGCACGC-GGTGGATCCATATTCCTACTCG | 103 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Staphylococcus aureus (S. aureus) (KCCM 12103) | Whole cell | Identify aptamers against bacterial surface molecules and live Staphylococcus aureus. | N/A | 16 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0586 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | APG-1 | CGGATCCATGGGCACTATTTATATCAA-TATGCCAGCATTTCGCCAACGGTGGTCATACAGTGTGAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0587 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | APG-2 | CGGATCCATGGGCACTATTTATATCAA-GGGTATCCCACTCGGACGTTCATACCTGGCTGGTTGCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0588 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | APG-3 | CGGATCCATGGGCACTATTTATATCAA-AGCGCGTTTTGGACATGCGCTAGCTTCAATTTGAGCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0589 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | APG-4 | CGGATCCATGGGCACTATTTATATCAA-GCCAATGCACTCTGGTTATTCCCCTAAACATCCCGGAAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0590 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | APG-5 | CGGATCCATGGGCACTATTTATATCAA-CGTTTGGGGCTGTGTTGCAAGACCGTACGTTGCCCCCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0591 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | APG-6 | CGGATCCATGGGCACTATTTATATCAA-TGCAACCGTGGAGTCGTGTTGAGGAGGCGCAATGCGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0592 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | APG-7 | CGGATCCATGGGCACTATTTATATCAA-TGGTACCGTGGAGTCGTGTTGAGGAGGCGCAATGCGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0593 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | APG-8 | CGGATCCATGGGCACTATTTATATCAA-TTACAGTATCCTCCCACGTTGGTTCGTGTCTTACGGAAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0594 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ATD-1 | CGGATCCATGGGCACTATTTATATCAA-CCCGTTTCGCGCTATTTCCGTACAACCCGCGACGCCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Treponema Denticola (ATCC 33521) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 ATD aptamers bound to the cell lysates of T. denticola, some showed cross-binding to P. gingivalis and E.coli, but not to S. mutans. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0595 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ATD-2 | CGGATCCATGGGCACTATTTATATCAA-GGCTAGGCCCCGGATCACCACTTTCCCTGCTTGATGCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Treponema Denticola (ATCC 33521) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 ATD aptamers bound to the cell lysates of T. denticola, some showed cross-binding to P. gingivalis and E.coli, but not to S. mutans. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0596 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ATD-3 | CGGATCCATGGGCACTATTTATATCAA-CCTTACGTTCTCTCCTCGCTCCTCAAGGAGCCACGCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Treponema Denticola (ATCC 33521) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 ATD aptamers bound to the cell lysates of T. denticola, some showed cross-binding to P. gingivalis and E.coli, but not to S. mutans. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0597 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ATD-4 | CGGATCCATGGGCACTATTTATATCAA-GGCGTTTCGCGCTATTTCCGTACAACCCGCGACGCCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Treponema Denticola (ATCC 33521) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 ATD aptamers bound to the cell lysates of T. denticola, some showed cross-binding to P. gingivalis and E.coli, but not to S. mutans. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0598 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ATD-5 | CGGATCCATGGGCACTATTTATATCAA-CTGCACGTGGGAGTCGTGTTGAGGAGGCGCAATGCGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Treponema Denticola (ATCC 33521) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 ATD aptamers bound to the cell lysates of T. denticola, some showed cross-binding to P. gingivalis and E.coli, but not to S. mutans. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0599 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ATD-6 | CGGATCCATGGGCACTATTTATATCAA-GACTACGTTCTCTCCTCGCTCCTCAAGGAGCCACGCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Treponema Denticola (ATCC 33521) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 ATD aptamers bound to the cell lysates of T. denticola, some showed cross-binding to P. gingivalis and E.coli, but not to S. mutans. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0600 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ATD-7 | CGGATCCATGGGCACTATTTATATCAA-GCCATTCGTCACTGAGTTGCTCTAGTGCCGTGTGCTCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Treponema Denticola (ATCC 33521) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 ATD aptamers bound to the cell lysates of T. denticola, some showed cross-binding to P. gingivalis and E.coli, but not to S. mutans. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0601 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ATD-8 | CGGATCCATGGGCACTATTTATATCAA-CTAAACGTTCTCTCCTCGCTCCTCAAGGAGCCACGCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Treponema Denticola (ATCC 33521) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 ATD aptamers bound to the cell lysates of T. denticola, some showed cross-binding to P. gingivalis and E.coli, but not to S. mutans. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0602 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASM-1 | CGGATCCATGGGCACTATTTATATCAA-GCATCGGTCCTGAAGTTGCTCTAGTGCCCGTGTGCTCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Mutans (ATCC 25175) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASM showed selective binding to S. mutans cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0603 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASM-2 | CGGATCCATGGGCACTATTTATATCAA-GGGCTAGCCCCGGATCACCACTTTCCCTGCTTGATGCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Mutans (ATCC 25175) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASM showed selective binding to S. mutans cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0604 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASM-3 | CGGATCCATGGGCACTATTTATATCAA-TGTAACGGTGGAGTCGTGTTGAGGAGGCGCAATGCGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Mutans (ATCC 25175) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASM showed selective binding to S. mutans cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0605 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASM-4 | CGGATCCATGGGCACTATTTATATCAA-TGGCACCGTGGAGTCGTGTTGAGGAGGCGCAATGCGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Mutans (ATCC 25175) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASM showed selective binding to S. mutans cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0606 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASM-5 | CGGATCCATGGGCACTATTTATATCAA-CCTAACGTTCTCTCCTCGCTCCTCAAGGAGCCACGCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Mutans (ATCC 25175) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASM showed selective binding to S. mutans cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0607 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASM-6 | CGGATCCATGGGCACTATTTATATCAA-CGGTTTTCGCGCTATTTCCGTACAACCCGCGACGCCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Mutans (ATCC 25175) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASM showed selective binding to S. mutans cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0608 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASM-7 | CGGATCCATGGGCACTATTTATATCAA-GTGTTTCGCGCTATTTCCGTACAACCCGCGGACGCCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Mutans (ATCC 25175) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASM showed selective binding to S. mutans cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0609 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-1 | CGGATCCATGGGCACTATTTATATCAA-CCTCACATAGTGACGATGTGGTTTGGTACCTCTATGCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0610 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-2 | CGGATCCATGGGCACTATTTATATCAA-CCGTGGATGTACGAAATTAACCGCACACCTAGCTACCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0611 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-3 | CGGATCCATGGGCACTATTTATATCAA-CGCATGCTTCTCGGGATACGGGCGGCTCGATAGAGTCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0612 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-4 | CGGATCCATGGGCACTATTTATATCAA-GCTTACTACGTTTGCCTCAGTGTGTTCCGGTCTTAACAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0613 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-5 | CGGATCCATGGGCACTATTTATATCAA-CCCATACCTTTTTCGATAGTAAGTGCCATGCCCATCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0614 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-6 | CGGATCCATGGGCACTATTTATATCAA-GCCTAGAACCCCCTGTCTAGTCAAGTAGTGCGAGTGCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0615 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-7 | CGGATCCATGGGCACTATTTATATCAA-GCCTTACCGCTCTATCACTCGTCTGTTGCCACTCAGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0616 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-8 | CGGATCCATGGGCACTATTTATATCAA-TGCGCCGATAGTTTCGATCATGATGCATCTGGCTGTCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0617 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-9 | CGGATCCATGGGCACTATTTATATCAA-CGGTAGTACTACTGGAGACAACTTCGCATACTTTAGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0618 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASS-1 | CGGATCCATGGGCACTATTTATATCAA-TTGCTACAGGTATTGCACAACCTCGTGTGGTGTCCGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Sanguis (ATCC 10556) | Whole cell | Screen and develop aptamers specific to oral pathogens. | Several ASS aptamers showed cross-reactions with lysates of P. gingivalis and/or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0619 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASS-2 | CGGATCCATGGGCACTATTTATATCAA-CGGTAGTACTACTGGAGACAACTTCGCATACTTTAGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Sanguis (ATCC 10556) | Whole cell | Screen and develop aptamers specific to oral pathogens. | Several ASS aptamers showed cross-reactions with lysates of P. gingivalis and/or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0620 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASS-3 | CGGATCCATGGGCACTATTTATATCAA-GCTGGCAACTGGATGCACTCGTCCTCAGCCTCGGTCAAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Sanguis (ATCC 10556) | Whole cell | Screen and develop aptamers specific to oral pathogens. | Several ASS aptamers showed cross-reactions with lysates of P. gingivalis and/or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0621 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASS-4 | CGGATCCATGGGCACTATTTATATCAA-GCCCGTGAGACTATACCCTATGCACTAGTTGCGTAATAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Sanguis (ATCC 10556) | Whole cell | Screen and develop aptamers specific to oral pathogens. | Several ASS aptamers showed cross-reactions with lysates of P. gingivalis and/or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0622 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASS-5 | CGGATCCATGGGCACTATTTATATCAA-GCTCGCGTCTGAGGGAAGTTACGTTATTTCGCTTGTAAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Sanguis (ATCC 10556) | Whole cell | Screen and develop aptamers specific to oral pathogens. | Several ASS aptamers showed cross-reactions with lysates of P. gingivalis and/or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0623 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASS-6 | CGGATCCATGGGCACTATTTATATCAA-CCGGACTTTAAGCGGCTTCTCGTGGCTGGGTAATCCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Sanguis (ATCC 10556) | Whole cell | Screen and develop aptamers specific to oral pathogens. | Several ASS aptamers showed cross-reactions with lysates of P. gingivalis and/or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0624 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASS-7 | CGGATCCATGGGCACTATTTATATCAA-CCTGACCGATGTTGTATTAATGGCTCCGGGTCTTATGAG-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Sanguis (ATCC 10556) | Whole cell | Screen and develop aptamers specific to oral pathogens. | Several ASS aptamers showed cross-reactions with lysates of P. gingivalis and/or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0625 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASS-8 | CGGATCCATGGGCACTATTTATATCAA-CGAGGGGTTGGTTTGTGGTGTTGCCGCCACTACAGCCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Sanguis (ATCC 10556) | Whole cell | Screen and develop aptamers specific to oral pathogens. | Several ASS aptamers showed cross-reactions with lysates of P. gingivalis and/or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0626 | 25562742 | 2015 | Aptamer-conjugated silver nanoparticles for electrochemical dual-aptamer-based sandwich detection of staphylococcus aureus | Primary anti-S.aureus aptamer | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | Dual-aptamer-based sandwich immunosensor (Apt/S.aureus/apt-AgNP) for the detection of S. aureus. | Display a dynamic range from 10 to 1×10(6) cfu/mL with a low detection limit of 1.0 cfu/mL. | 2 | N/A | 35 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated (Biotin-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0627 | 25562742 | 2015 | Aptamer-conjugated silver nanoparticles for electrochemical dual-aptamer-based sandwich detection of staphylococcus aureus | Secondary anti-S.aureus aptamer | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | Dual-aptamer-based sandwich immunosensor (Apt/S.aureus/apt-AgNP) for the detection of S. aureus. | Display a dynamic range from 10 to 1×10(6) cfu/mL with a low detection limit of 1.0 cfu/mL. | 2 | N/A | 129 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0633 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | MA1 | GGGAGCTCAGAATAAACGCTCAA-CGGATTAGTCAATAGACTGGTGGCTTTGTGTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | Sandwich ELISA based on MA2 and MA1 display a linear range of 8 × 10(4) to 128 × 10(4) CFU with the detection limit of 1 × 10(4) CFU. | 10 | Bio-Layer Interferometry (BLI) | 12.02 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0634 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | MA2 | GGGAGCTCAGAATAAACGCTCAA-TATCCCTATTCCGCTCCATGTTGCGTACCCGTGCC-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | Sandwich ELISA based on MA2 and MA1 display a linear range of 8 × 10(4) to 128 × 10(4) CFU with the detection limit of 1 × 10(4) CFU. | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0635 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | E6-15 | GGGAGCTCAGAATAAACGCTCAA-CGGATTAGTCAATAGACCGGTGGCTCTGTGTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0636 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | P9-3 | GGGAGCTCAGAATAAACGCTCAA-CGGATTAGTCAATAGACCGGTGGCTTTGTGTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0637 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | P9-4 | GGGAGCTCAGAATAAACGCTCAA-CGGATTAGTCAATAGACTGGTGGCTCTGTGTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0638 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | E7-12 | GGGAGCTCAGAATAAACGCTCAA-CGGATTAGTCAGTAGACTGGTGGCTCTGTGTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0639 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | P9-5 | GGGAGCTCAGAATAAACGCTCAA-CGGATTAGTCAATAGTCTGGTGGCTTTGTGTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0640 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | E9-16 | GGGAGCTCAGAATAAACGCTCAA-CGGGCTAGTCAATAGACTGGTGGCTTTGTGTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0641 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | P6-5 | GGGAGCTCAGAATAAACGCTCAA-TATCCCTATTCCGCTCCATGCTGCGTACCCGTGCC-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0642 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | P10-4 | GGGAGCTCAGAATAAACGCTCAA-TACCCCTATTCCGCTCCATGTTGCGTACCCGTGCC-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0643 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | P10-8 | GGGAGCTCAGAATAAACGCTCAA-CATCCCTATTCCGCTCCATGTTGCGTACCCGTGCC-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0672 | 25476286 | 2015 | Aptamer-functionalized localized surface plasmon resonance sensor for the multiplexed detection of different bacterial species | Lac-apt | AGCAGCACAGAGGTCAGATGTAGCCCTTCAACATAGTAATATCTCTGCATTCTGTGTGCCTATGCGTGCTACCGTGAA | 78 | N/A | ssDNA | Lactobacillus Acidophilus (KCTC 3164) | Whole cell | The aptamer-immobilized LSPR sensor was developed for bacteria detection. | Showed a detection limit of 30 cfu per assay. | N/A | N/A | 13 ± 3 nM | Biosensor | N/A | 3'-Thiolated (SH-(CH2)3) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0673 | 25476286 | 2015 | Aptamer-functionalized localized surface plasmon resonance sensor for the multiplexed detection of different bacterial species | Sty-apt | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (KCTC 2421) | Whole cell | The aptamer-immobilized LSPR sensor was developed for bacteria detection. | Showed a detection limit of 30 cfu per assay. | N/A | N/A | N/A | Biosensor | N/A | 3'-Thiolated (SH-(CH2)3) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0674 | 25476286 | 2015 | Aptamer-functionalized localized surface plasmon resonance sensor for the multiplexed detection of different bacterial species | Pae-apt | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 15692) | Whole cell | The aptamer-immobilized LSPR sensor was developed for bacteria detection. | Showed a detection limit of 30 cfu per assay. | N/A | N/A | 17.27 ± 5 nM | Biosensor | N/A | 3'-Thiolated (SH-(CH2)3) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0675 | https://doi.org/10.1007/s00604-015-1649-7 | 2015 | Impedimetric Salmonella aptasensor using a glassy carbon electrode modified with an electrodeposited composite consisting of reduced graphene oxide and carbon nanotubes | Anti-Salmonella aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 50761) | Whole cell | Develop a label-free impedimetric aptasensor based on an amino-modified aptamer bound to rGO-MWCNT composite for the detection of Salmonella. | Exhibits a linear range from 75 to 7.5 × 10(5) cfu/mL and a detection limit of 25 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0692 | 26302256 | 2015 | Colorimetric Aptasensor Based on Enzyme for the Detection of Vibrio parahemolyticus | Apt 1 | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a colorimetric aptasensor system based on sandwich-type complex (AuNPs−HRP−aptamer−target−aptamer−MNPs) to detect V. parahemolyticus. | Linear detection range: 10 to 10^6 cfu/mL, with a limit of detection (LOD) of 10 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0693 | 26302256 | 2015 | Colorimetric Aptasensor Based on Enzyme for the Detection of Vibrio parahemolyticus | Apt 2 | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a colorimetric aptasensor system based on sandwich-type complex (AuNPs−HRP−aptamer−target−aptamer−MNPs) to detect V. parahemolyticus. | Linear detection range: 10 to 10^6 cfu/mL, with a limit of detection (LOD) of 10 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0696 | 25533762 | 2015 | Identification of Staphylococcus aureus infection by aptamers directly radiolabeled with technetium-99m | SA20 | GCAATGGTACGGTACTTCC-GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT-CAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | 99mTc-labelled aptamers for bacterial infection identification. | EC50 value of 99mTc labelled aptamer was 70.86 nM and displayed a target/non-target ratio of 4.0±0.5. | N/A | Radiolabeled Binding assay | N/A | Diagnostic | N/A | 5'-Amidation (NH₂-(CH2)6) and 5'-Radiolabelled (32P-labeled) | N/A | Radiolabeled aptamers with 99mTc were stable in 0.9% saline solution, in plasma, and in the presence of excess cysteine (50-, 500-, and 5000-fold), even for long period of 24hr. | N/A | N/A | N/A |
| ABdb_0697 | 25533762 | 2015 | Identification of Staphylococcus aureus infection by aptamers directly radiolabeled with technetium-99m | SA23 | GCAATGGTACGGTACTTCC-GGGCTGGCCAGATCAGACCCCGGATGATCATCCTTGTGAGAACCA-CAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | 99mTc-labelled aptamers for bacterial infection identification. | EC50 value of 99mTc labelled aptamer was 61.50 nM and displayed a target/non-target ratio of 4.0±0.5. | N/A | Radiolabeled Binding assay | N/A | Diagnostic | N/A | 5'-Amidation (NH₂-(CH2)6) and 5'-Radiolabelled (32P-labeled) | N/A | Radiolabeled aptamers with 99mTc were stable in 0.9% saline solution, in plasma, and in the presence of excess cysteine (50-, 500-, and 5000-fold), even for long period of 24hr. | N/A | N/A | N/A |
| ABdb_0698 | 25533762 | 2015 | Identification of Staphylococcus aureus infection by aptamers directly radiolabeled with technetium-99m | SA34 | GCAATGGTACGGTACTTCC-CACAGTCACTCAGACGGCCGCTATTGTTGCCAGATTGCCTTTGGC-CAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | 99mTc-labelled aptamers for bacterial infection identification. | EC50 value of 99mTc labelled aptamer was 72.42 nM and displayed a target/non-target ratio of 4.0±0.5. | N/A | Radiolabeled Binding assay | N/A | Diagnostic | N/A | 5'-Amidation (NH₂-(CH2)6) and 5'-Radiolabelled (32P-labeled) | N/A | Radiolabeled aptamers with 99mTc were stable in 0.9% saline solution, in plasma, and in the presence of excess cysteine (50-, 500-, and 5000-fold), even for long period of 24hr. | N/A | N/A | N/A |
| ABdb_0699 | 25461175 | 2015 | A new aptamer/graphene interdigitated gold electrode piezoelectric sensor for rapid and specific detection of Staphylococcus aureus | S. aureus aptamer. | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | Developed an aptamer/graphene interdigitated gold electrode piezoelectric sensor to detect Staphylococcus aureus. | Achieved a detection limit of 41 cfu/mL with a linear range of 4.1×10(1) to 4.1×10(5) cfu/mL. The detection is rapid, completing in less than 60 minutes. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0700 | 26241735 | 2015 | Gold nanoparticles enhanced SERS aptasensor for the simultaneous detection of Salmonella typhimurium and Staphylococcus aureus | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | A GNPs-modified Raman-based biosensor was developed for the simultaneous detection of S. typhimurium and S. aureus. | Linear detection range of 10^2 to 10^7 cfu/mL for both; LOD of 15 cfu/mL for S. typhimurium. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0701 | 26241735 | 2015 | Gold nanoparticles enhanced SERS aptasensor for the simultaneous detection of Salmonella typhimurium and Staphylococcus aureus | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | A GNPs-modified Raman-based biosensor was developed for the simultaneous detection of S. typhimurium and S. aureus. | Linear detection range of 10^2 to 10^7 cfu/mL for both; LOD of 35 cfu/mL for S. aureus. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0702 | 25467500 | 2015 | Pathogen detection in complex samples by quartz crystal microbalance sensor coupled to aptamer functionalized core-shell type magnetic separation | Aptamer | CTGATGTGTGGGTAGGTGTCGTTGATTTCTTCTGGTGGGG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Developed an aptamer-based QCM biosensor for the determination of Salmonella in food samples. | Showed specific detection of Salmonella cells at 100 CFU/mL from a milk sample and a linear response range from 100 to 4 × 10(4) CFU/mL cells. | N/A | Quartz Crystal Microbalance (QCM) | 3259 CFU mL−1 | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0703 | https://doi.org/10.1080/00032719.2015.1036278 | 2015 | Aptamer Immobilized Magnetoelastic Sensor for the Determination of Staphylococcus aureus | S. aureus aptamer. | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Develop an aptamer-based magnetoelastic sensor for the detection of S. aureus. | Linear dynamic range of 10^1–10^11 cfu/mL and detection limit of 5 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0704 | https://doi.org/10.1039/C4AY02880E | 2015 | Rapid and sensitive detection of Salmonella typhimurium using aptamer-conjugated carbon dots as fluorescence probe | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Develop a fluorescence probe based on amino-modified aptamer conjugated to carboxyl-modified carbon dots (CDs) for detection of Salmonella typhimurium. | Limit of Detection (LOD): 50 cfu mL⁻¹ and linear range of 10(3)-10(5) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0705 | https://doi.org/10.1039/C4AY02662D | 2015 | A chronopotentiometric flow injection system for aptasensing of E. coli O157 | EcO 4 Rev | ACGGCGCTCCCAACAGGCCTCTCCTTACGGCATATTA | 37 | N/A | ssDNA | Escherichia Coli (E. Coli) O157 (ATCC 35150) | Whole cell | Develop a potentiometric aptasensor employing simple flow injection analysis system for the detection of E. coli O157. | N/A | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0706 | https://doi.org/10.1039/C4AY02662D | 2015 | A chronopotentiometric flow injection system for aptasensing of E. coli O157 | EcO 3 Rev | GTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCG | 36 | N/A | ssDNA | Escherichia Coli (E. Coli) O157 (ATCC 35150) | Whole cell | Develop a potentiometric aptasensor employing simple flow injection analysis system for the detection of E. coli O157. | Exhibited a linear range of 10-10(4) cfu/mL and the detection limit of 10 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0707 | https://doi.org/10.1039/C4AY02662D | 2015 | A chronopotentiometric flow injection system for aptasensing of E. coli O157 | E17F-37 | ATCAAATGTGCAGATATCAAGACGATTTGTACAAGAT | 37 | N/A | ssDNA | Escherichia Coli (E. Coli) O157 (ATCC 35150) | Whole cell | Develop a potentiometric aptasensor employing simple flow injection analysis system for the detection of E. coli O157. | N/A | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0708 | https://doi.org/10.1039/C4AY02662D | 2015 | A chronopotentiometric flow injection system for aptasensing of E. coli O157 | E18R-42 | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157 (ATCC 35150) | Whole cell | Develop a potentiometric aptasensor employing simple flow injection analysis system for the detection of E. coli O157. | N/A | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0709 | https://doi.org/10.1016/j.lwt.2015.07.021 | 2015 | Identification and characteristics of aptamers against inactivated Vibrio alginolyticus | Aptamer #7 | TCAGTCGCTTCGCCGTCTCCTTC-GGGGGCGCGGTGAGGGGCTGCACAAGAGGGAG-GCACAAGAGGGAGACCCCAGAGGG | 79 | N/A | ssDNA | Vibrio Alginolyticus | Whole cell | Develop an aptamer detection assay for inactivated V. alginolyticus. | The detection limit for aptamer #7 for inactivated V. alginolyticus was 10 cells/ml. | N/A | Fluorescence Spectroscopy | 28.39 ± 11.46 nM | Detection | N/A | 5'-DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0710 | https://doi.org/10.1016/j.lwt.2015.07.021 | 2015 | Identification and characteristics of aptamers against inactivated Vibrio alginolyticus | Aptamer #8 | TCAGTCGCTTCGCCGTCTCCTTC-AGCCGGGGTGGTCAGTAGGAGCAGCACAAGAGGGA-GCACAAGAGGGAGACCCCAGAGGG | 82 | N/A | ssDNA | Vibrio Alginolyticus | Whole cell | Develop an aptamer detection assay for inactivated V. alginolyticus. | The detection limit for aptamer #8 for inactivated V. alginolyticus was 10 cells/ml. | N/A | Fluorescence Spectroscopy | 12.82 ± 6.00 nM | Detection | N/A | 5'-DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0711 | https://doi.org/10.1016/j.lwt.2015.07.021 | 2015 | Identification and characteristics of aptamers against inactivated Vibrio alginolyticus | Aptamer #23 | TCAGTCGCTTCGCCGTCTCCTTC-GTAGGAGGTAGTCGGAGAGGCGAATGAGAGGGGAAGCACAAGAGGGA-GCACAAGAGGGAGACCCCAGAGGG | 94 | N/A | ssDNA | Vibrio Alginolyticus | Whole cell | Develop an aptamer detection assay for inactivated V. alginolyticus. | The detection limit for aptamer #23 for inactivated V. alginolyticus was 10(3) cells/ml. | N/A | Fluorescence Spectroscopy | 46.89 ± 15.87 nM | Detection | N/A | 5'-DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0712 | https://doi.org/10.1080/00032719.2015.1052974 | 2015 | Determination of Shigella flexneri by a Novel Fluorescent Aptasensor | Aptamer1 | CCTCATGTCGAACAGCAACACTGCAACACTGTATAGTCCTGTGTGCCTTGAGCGTTTATTCTGAGCT | 67 | N/A | ssDNA | Shigella Flexneri (CGMCC 1.1868) | Whole cell | Developed a homogeneous fluorescent aptasensor using a dye-labelled aptamer and graphene oxide, using target recycling amplification for Shigella flexneri detection. | A linear relationship was displayed from 500 to 10(9) CFU/mL with a limit of detection of 100 CFU/mL. | N/A | N/A | 29 ± 4 nM | Biosensor | N/A | Carboxyfluorescein-GGGCCC at the 5' and 3' ends | N/A | N/A | N/A | N/A | N/A |
| ABdb_0713 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp1 | TGAGCCCAAGCCCTGGTATG-TTCTTCCCTTTTATTAGTCCTGTATTCCTCTACTGTTGCC-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | With sandwich Sp1 and Sp20, the aptamer assay achieved a concentration range for S. sonnei of 10(2) cfu/mL to 10(7) cfu/mL and a detection limit of 30 cfu/mL. | 12 | Flow Cytometry | 5.98 ± 0.835 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled and Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0714 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp13 | TGAGCCCAAGCCCTGGTATG-TATCCGATTTTATCTGTCCAATATTCCCTGTGTCTACCTT-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | N/A | 12 | Flow Cytometry | 97.38 ± 36.2 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0715 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp16 | TGAGCCCAAGCCCTGGTATG-TATCTTCACTTGACCTTTACCGCAATCGTCCATGTATCTG-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | N/A | 12 | Flow Cytometry | 682.2 ± 125 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0716 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp19 | TGAGCCCAAGCCCTGGTATG-TTCTACCCAACTGCTTTAATAGTCACTGTCATAGTTCCAC-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0717 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp20 | TGAGCCCAAGCCCTGGTATG-TCGTCGATTATTGTTTCAGTTCAGTTCCCCCGCGTTCCGA-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | With sandwich Sp1 and Sp20, the aptamer assay achieved a concentration range for S. sonnei of 10(2) cfu/mL to 10(7) cfu/mL and a detection limit of 30 cfu/mL. | 12 | Flow Cytometry | 14.32 ± 2.19 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled and HEX (hexachlorofluorescein) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0718 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp22 | TGAGCCCAAGCCCTGGTATG-CCTACCTTAGTCCGTTTCGCTGTGTTTGTCCAATATTCCT-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | N/A | 12 | Flow Cytometry | 4.98 ± 0.357 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0719 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp23 | TGAGCCCAAGCCCTGGTATG-CTTCACTTGACCCTTATCGCTTCTAACACAACCGCTTTTT-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | N/A | 12 | Flow Cytometry | 5.735 ± 0.478 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0720 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp28 | TGAGCCCAAGCCCTGGTATG-TATTCCCCCTTATTTTAGCCATTTTGTTACATCTTCCGTC-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | N/A | 12 | Flow Cytometry | 72.89 ± 22.16 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0721 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp29 | TGAGCCCAAGCCCTGGTATG-ATATTCGTTCTTTTCGCCTTAACTTCTCGTGTTTCCTTAC-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | N/A | 12 | Flow Cytometry | 47.83 ± 9.7 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0722 | https://doi.org/10.1039/C5AY02298C | 2015 | Highly sensitive fluorescent aptasensor for Salmonella paratyphi A via DNase I-mediated cyclic signal amplification | Apt 10 | GATGATGGACGTATATCGTCTCCCATGAATTCAGTCGGACAGCG | 44 | N/A | ssDNA | Salmonella Paratyphi A | Whole cell | Developed an aptasensor composed of a designed aptamer (DA) and two short FAM-modified sequences (probe 1 and probe 2) for fluorimetric determination of S. paratyphi A via DNase I-mediated cyclic signal amplification. | Obtained a concentration ranging from 1 × 10(2) to 1 × 10(11) cells/mL with a detection limit of 1 × 10(2) cells/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0723 | https://doi.org/10.1039/C5AY02298C | 2015 | Highly sensitive fluorescent aptasensor for Salmonella paratyphi A via DNase I-mediated cyclic signal amplification | Apt 22 | ATGGACGAATATCGTCTCCCAGTGAATTCAGTCGGACAGCG | 41 | N/A | ssDNA | Salmonella Paratyphi A | Whole cell | Developed an aptasensor composed of a designed aptamer (DA) and two short FAM-modified sequences (probe 1 and probe 2) for fluorimetric determination of S. paratyphi A via DNase I-mediated cyclic signal amplification. | Obtained a concentration ranging from 1 × 10(2) to 1 × 10(11) cells/mL with a detection limit of 1 × 10(2) cells/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0724 | https://doi.org/10.1039/C5AY02298C | 2015 | Highly sensitive fluorescent aptasensor for Salmonella paratyphi A via DNase I-mediated cyclic signal amplification | Apt 45 | ATGGACGAATATCGTCTCCCAGTGAATTCAGTCGGACAGC | 40 | N/A | ssDNA | Salmonella Paratyphi A | Whole cell | Developed an aptasensor composed of a designed aptamer (DA) and two short FAM-modified sequences (probe 1 and probe 2) for fluorimetric determination of S. paratyphi A via DNase I-mediated cyclic signal amplification. | Obtained a concentration ranging from 1 × 10(2) to 1 × 10(11) cells/mL with a detection limit of 1 × 10(2) cells/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0725 | https://doi.org/10.1039/C5AY02298C | 2015 | Highly sensitive fluorescent aptasensor for Salmonella paratyphi A via DNase I-mediated cyclic signal amplification | Apt 60 | CGCCCACCCATAATGGATCAGGGCGGGCACCACGATG | 37 | N/A | ssDNA | Salmonella Paratyphi A | Whole cell | Developed an aptasensor composed of a designed aptamer (DA) and two short FAM-modified sequences (probe 1 and probe 2) for fluorimetric determination of S. paratyphi A via DNase I-mediated cyclic signal amplification. | Obtained a concentration ranging from 1 × 10(2) to 1 × 10(11) cells/mL with a detection limit of 1 × 10(2) cells/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0726 | https://doi.org/10.1039/C5AY02298C | 2015 | Highly sensitive fluorescent aptasensor for Salmonella paratyphi A via DNase I-mediated cyclic signal amplification | Apt 1 | CGAAGGGGCTATGCCGCCTACATAGACCGTCACGA | 35 | N/A | ssDNA | Salmonella Paratyphi A | Whole cell | Developed an aptasensor composed of a designed aptamer (DA) and two short FAM-modified sequences (probe 1 and probe 2) for fluorimetric determination of S. paratyphi A via DNase I-mediated cyclic signal amplification. | Obtained a concentration ranging from 1 × 10(2) to 1 × 10(11) cells/mL with a detection limit of 1 × 10(2) cells/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0727 | https://doi.org/10.1039/C5AY02298C | 2015 | Highly sensitive fluorescent aptasensor for Salmonella paratyphi A via DNase I-mediated cyclic signal amplification | Apt 2 | GGCCGGCAATACGGCCGAGCCCGGGGTTCCTCCGA | 35 | N/A | ssDNA | Salmonella Paratyphi A | Whole cell | Developed an aptasensor composed of a designed aptamer (DA) and two short FAM-modified sequences (probe 1 and probe 2) for fluorimetric determination of S. paratyphi A via DNase I-mediated cyclic signal amplification. | Obtained a concentration ranging from 1 × 10(2) to 1 × 10(11) cells/mL with a detection limit of 1 × 10(2) cells/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0728 | https://doi.org/10.1039/C5AY02298C | 2015 | Highly sensitive fluorescent aptasensor for Salmonella paratyphi A via DNase I-mediated cyclic signal amplification | Apt 3 | GCCACGCGCAGCAATCAAACCCGGCCCCCTGCTCC | 35 | N/A | ssDNA | Salmonella Paratyphi A | Whole cell | Developed an aptasensor composed of a designed aptamer (DA) and two short FAM-modified sequences (probe 1 and probe 2) for fluorimetric determination of S. paratyphi A via DNase I-mediated cyclic signal amplification. | Obtained a concentration ranging from 1 × 10(2) to 1 × 10(11) cells/mL with a detection limit of 1 × 10(2) cells/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0729 | https://doi.org/10.1039/C5AY02298C | 2015 | Highly sensitive fluorescent aptasensor for Salmonella paratyphi A via DNase I-mediated cyclic signal amplification | Apt 4 | TGGCCAGAGTACGAGTAAGGGAGGTCACAACCTTA | 35 | N/A | ssDNA | Salmonella Paratyphi A | Whole cell | Developed an aptasensor composed of a designed aptamer (DA) and two short FAM-modified sequences (probe 1 and probe 2) for fluorimetric determination of S. paratyphi A via DNase I-mediated cyclic signal amplification. | Obtained a concentration ranging from 1 × 10(2) to 1 × 10(11) cells/mL with a detection limit of 1 × 10(2) cells/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0730 | 27424215 | 2016 | Gold nanoparticle-DNA aptamer conjugate-assisted delivery of antimicrobial peptide effectively eliminates intracellular Salmonella enterica serovar Typhimurium | AptHis (6H7) | GCTATGGGTGGTCTGGTTGGGATTGGCCCCGGGAGCTGGC | 40 | N/A | ssDNA | Salmonella typhimurium infected HeLa cells | S. typhimurium Whole cell | His-aptamer conjugated AuNP platform for the loading of His-tagged AMP (C-terminally hexahistidine-tagged A3-APO (A3-APOHis) AMPs) to eliminate intracellular S. Typhimurium cells. | 80% viability increase of infected HeLa cells and 100% survival rate of infected mice. | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 3'-Thiolated (A10-Thiol) and Cyanine5 (Cy5) Labeled | AuNP-Apt(His)-A3-APO(His) led to the increased viability of S. Typhimurium-infected HeLa cells. | ∼80% of A3-APOHis remained in serum after 48 h of incubation with AuNP-Apt(His)-A3-APO(His). | N/A | N/A | N/A |
| ABdb_0731 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL26 | TAGCTCACTCATTAGGCA-CATTTGTGGCACCAAATTTGAATTAATCAAGACAGTGTGGT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | SAL 26 can detect 10(2) CFU/mL in the gold nanoparticle-based colourimetric assay and has a limit of detection (LOD) of 10(3) CFU/mL in the aptamer sedimentation assay. | 10 | Fluorescence Spectroscopy | 123 ± 23 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0732 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL33 | TAGCTCACTCATTAGGCA-CTCGTATTGAGGAGCTCGTATTATTTAATTCACACTGTGCT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | 221 ± 72 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0733 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL28 | TAGCTCACTCATTAGGCA-CTCTGTCGTCAACAGTCTAACTTGTAGAATTGATGTTACTG-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | Limit of detection (LOD) of 10(3)CFU/mL in the aptamer sedimentation assay. | 10 | Fluorescence Spectroscopy | 195 ± 46 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0734 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL43 | TAGCTCACTCATTAGGCA-CGAGACCACCGGCAACCTTTCACAAAGGGGAGGCTAA-GCATAGTTAAGCCAGCC | 72 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | 294 ± 112 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0735 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL21 | TAGCTCACTCATTAGGCA-CAGCAACTCGCTTTGATACCGGTAGAGTTTGTATTGCTCAA-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0736 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL37 | TAGCTCACTCATTAGGCA-CTTAGTTCAGACGCGAGTATTATCGGCGTCCAAGCAAGGG-GCATAGTTAAGCCAGCC | 75 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0737 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL20 | TAGCTCACTCATTAGGCA-CATATTCAGCAGTTGTATGATAGCGGGTCGCGAGTGTGTAT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0738 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL40 | TAGCTCACTCATTAGGCA-CTGCATTACATATATGGCAGTGGGTTAACCTGGATTGAGGA-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | 204 ± 73 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0739 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL16 | TAGCTCACTCATTAGGCA-CCCGATTGTACTAATGAAGATGGACACTGAGAGGGGGATGG-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0740 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL11 | TAGCTCACTCATTAGGCA-CTCGAGAGGGATCTCGGGGCGTGCGATGATTTTGCCTTCAT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | Limit of detection (LOD) of 10(3)CFU/mL in the aptamer sedimentation assay. | 10 | Fluorescence Spectroscopy | 184 ± 43 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0741 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL45 | TAGCTCACTCATTAGGCA-CCGTGCCAACTGAGGGATACAGGGGGAGTGTCGGTCTACCT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | 294 ± 133 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0742 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL23 | TAGCTCACTCATTAGGCA-CCTCACAGCCCTTCTTCCCGTATTTGTAGACTAGTTACATT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0743 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL48 | TAGCTCACTCATTAGGCA-CCACACTGTCTTGATTTTGGATTTGTCGGTGCTGACCTGTG-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0744 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL9 | TAGCTCACTCATTAGGCA-CTGCGAGTGAACTCCTCCTTTTGTATTTAGTGTGCGGATCT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0745 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL29 | TAGCTCACTCATTAGGCA-CATGTGGAGTGCGAACTGTCTGGTCTTATCGGGCTCGCTGT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0746 | 27979272 | 2016 | QCM-based aptamer selection and detection of Salmonella typhimurium | B5 | CAGTCCAGGACAGATTCGCGAG-CCCACTCCAAACACGACCAACTCACGCTCTATCAACATCGCTATC-CACGTGGATTTCATTCAGCGATT | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-45N-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that bind to and detect S. typhimurium using a QCM-based aptasensor. | LOD was 7.9 × 10(3) CFU/mL and a linear range from 7.9 × 10(2) to 7.9 × 10(6) CFU/mL of S. typhimurium with less than 1 h. | 10 | Quartz Crystal Microbalance (QCM) | 58.5 nM | Biosensor | QCM-based SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0747 | 27979272 | 2016 | QCM-based aptamer selection and detection of Salmonella typhimurium | A24 | CAGTCCAGGACAGATTCGCGAG-GCACAATCCACCTCTCACCGCACGCCACGCACTGCCTCTGTCCCG-CACGTGGATTTCATTCAGCGATT | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-45N-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that bind to and detect S. typhimurium using a QCM-based aptasensor. | N/A | 10 | Quartz Crystal Microbalance (QCM) | 19.63 nM | Biosensor | QCM-based SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0748 | 27979272 | 2016 | QCM-based aptamer selection and detection of Salmonella typhimurium | B30 | AATCGCTGAATGAAATCCACGTG-GGAAGTGTGTGGGTGACCAGAGGTGTGGTGATGGGATTGTCGTA-CCTCGCGAATCTGTCCTGGACTG | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-45N-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that bind to and detect S. typhimurium using a QCM-based aptasensor. | N/A | 10 | Quartz Crystal Microbalance (QCM) | 51.02 nM | Biosensor | QCM-based SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0749 | 27979272 | 2016 | QCM-based aptamer selection and detection of Salmonella typhimurium | B31 | CAGTCCAGGACAGATTCGCGAG-CCGCACCGCCCTATCCTCGTGTCCCTGCCCAACAGCGCCGCCCGC-CACGTGGATTTCATTCAGCGATT | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-45N-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that bind to and detect S. typhimurium using a QCM-based aptasensor. | N/A | 10 | Quartz Crystal Microbalance (QCM) | N/A | Biosensor | QCM-based SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0750 | 27979272 | 2016 | QCM-based aptamer selection and detection of Salmonella typhimurium | A37 | CAGTCCAGGACAGATTCGCGAG-GTGGGGCGGGAAAGTGTGTGTAGGTGGTGGCGTTGTCACGGCGGG-CACGTGGATTTCATTCAGCGATT | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-45N-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that bind to and detect S. typhimurium using a QCM-based aptasensor. | N/A | 10 | Quartz Crystal Microbalance (QCM) | N/A | Biosensor | QCM-based SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0751 | 27979272 | 2016 | QCM-based aptamer selection and detection of Salmonella typhimurium | B16 | CAGTCCAGGACAGATTCGCGAG-GGGCTGTGTGAGAAGTGGGTGTGGTGGTGGATATGCAACGTTGTA-CACGTGGATTTCATTCAGCGATT | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-45N-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that bind to and detect S. typhimurium using a QCM-based aptasensor. | N/A | 10 | Quartz Crystal Microbalance (QCM) | N/A | Biosensor | QCM-based SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0752 | 27979272 | 2016 | QCM-based aptamer selection and detection of Salmonella typhimurium | B21 | CAGTCCAGGACAGATTCGCGAG-GTCAACACGAGAGGAGGGGAGTGGAATCAGGATAGGTGTGTAGGG-CACGTGGATTTCATTCAGCGATT | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-45N-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that bind to and detect S. typhimurium using a QCM-based aptasensor. | N/A | 10 | Quartz Crystal Microbalance (QCM) | N/A | Biosensor | QCM-based SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0761 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-52 | CATACGATTTAGGTGACACTATAG-CCGCCCAGCGGGGGTAGGGCCGGACGTAGGAGGAGCTGCG-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | P12-52 bound strongly to all three Gram-positive bacteria tested (S. aureus, E. faecalis and E. freudini). | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 11.97 ± 2.94 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0762 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-31 | CATACGATTTAGGTGACACTATAG-CCCTCCGGGGGGGGGGGTCATCGGGATACCTGGTAAGGATA-ATTTCTCCTACTGGGATAGGTGGA | 89 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | The binding of P12-31 was 10-fold stronger than that of the random library. | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 87.03 ± 17.32 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0763 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-55 | CATACGATTTAGGTGACACTATAG-CCGGAGGGGGGTGAGGTCTGCGGCAGGCTGTGTGGGTGGA-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | The binding of P12-55 to E. coli cells was more than 100-fold stronger than that of the random library. | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 161.0 ± 34.74 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0764 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-17 | CATACGATTTAGGTGACACTATAG-GACGGTGGCAGGGAAAGGGGTCGGGCATATGGCGGAGGGG-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | P12-17 could only bind to E. faecalis. The binding of P12-17 was 10-fold stronger than that of the random library. | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 56.33 ± 15.87 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0765 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-11 | CATACGATTTAGGTGACACTATAG-CCCTCCGGGGGGGTCATCGGGATACCTGGTAAGGATA-ATTTCTCCTACTGGGATAGGTGGA | 85 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0766 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-21 | CATACGATTTAGGTGACACTATAG-CCGGAGGTGGGTGAGGTCTGCGGCAGGCTGTGTGGGTGGA-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0767 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-9 | CATACGATTTAGGTGACACTATAG-TGCGGGCGGAGGACACGGACCCGTATGGGAGCAATGCACG-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0768 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-15 | CATACGATTTAGGTGACACTATAG-GGCCACCCACAGGCACTCCGCTCATGAATCGTGGAGTCGG-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0769 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-30 | CATACGATTTAGGTGACACTATAG-CACCACGGACACGATCCCAAGCTAGGAGGTGCGGCGGGGT-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0770 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-48 | CATACGATTTAGGTGACACTATAG-TGGCACAGCACGTCGCACGGTCCCCGGGAGGTGTTCACTG-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0771 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-51 | CATACGATTTAGGTGACACTATAG-TCGCGAGTGCGTGTACGCCACACATCACAAAAGGGGTGTG-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0772 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-66 | CATACGATTTAGGTGACACTATAG-GGCAACATTCAGACATACCAGTACCCACTCGGACTTCCCG-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0773 | 27427891 | 2016 | An aptamer cocktail-functionalized photocatalyst with enhanced antibacterial efficiency towards target bacteria | E1 | GCAATGGTACGGTACTTCCACTTAGGTCGAGGTTAGTTTGTCTTGCTGGCGCATCCACTGAGCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Composite (TiO2-Apc) for enhanced photodynamic inactivation of target-specific bacteria. | TiO₂-Apc particles killed approximately 80% of E. coli after 15 min, whereas the raw TiO₂ particles killed only 20% and the TiO₂-Aps particles killed 60% of E. coli after 15 min of UV irradiation. | N/A | Fluorescence Spectroscopy | 12.4 nM | Therapeutics | N/A | 3'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0774 | 27427891 | 2016 | An aptamer cocktail-functionalized photocatalyst with enhanced antibacterial efficiency towards target bacteria | E2 | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Enhanced photodynamic inactivation via aptamer-functionalized TiO₂ particles. | TiO₂-Apc particles killed approximately 80% of E. coli after 15 min, whereas the raw TiO₂ particles killed only 20% and the TiO₂-Aps particles killed 60% of E. coli after 15 min of UV irradiation. | N/A | Fluorescence Spectroscopy | 25.2 nM | Therapeutics | N/A | 3'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0775 | 27427891 | 2016 | An aptamer cocktail-functionalized photocatalyst with enhanced antibacterial efficiency towards target bacteria | E10 | GCAATGGTACGGTACTTCCGTTGCACTGTGCGGCCGAGCTGCCCCCTGGTTTGTGAATACCCTGGGCAAAAGTGCACGCTACTTTGCTAA | 90 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Enhanced photodynamic inactivation via aptamer-functionalized TiO₂ particles. | TiO₂-Apc particles killed approximately 80% of E. coli after 15 min, whereas the raw TiO₂ particles killed only 20% and the TiO₂-Aps particles killed 60% of E. coli after 15 min of UV irradiation. | N/A | Fluorescence Spectroscopy | 14.2 nM | Therapeutics | N/A | 3'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0776 | 27871171 | 2016 | Cell-SELEX Based Identification of an RNA Aptamer for Escherichia coli and Its Use in Various Detection Formats | Ec3 (31) -Truncated | UUCAAUUGCACGAAUUUGCUGUGUUUUUGGG | 31 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssRNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify an aptamer that binds specifically to E. coli, and use the minimized Ec-3(31) aptamer to develop detection assays. | Ec3(31)-biotin-streptavidin magnetic separation has LOD of 1.3 × 10(6) CFU/ml, Optical analytic technique has LOD of 5 × 10(4) CFU/ml, and Electrochemical Impedance Spectroscopy (EIS) has LOD of 2 × 10(4) CFU/mL of E. coli cells. | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 225 nM | Biosensor | Whole Cell-SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) or 3'-Biotinylated or Thiolated or Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0777 | 27871171 | 2016 | Cell-SELEX Based Identification of an RNA Aptamer for Escherichia coli and Its Use in Various Detection Formats | Ec3 | AUACCAGCUUAUUCAAUUGCACGAAUUUGCUGUGUUUUUGGGGGGGUCGGGGAGUAUAAGAUAGUAAGUGCAAUCU | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssRNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify an aptamer that binds specifically to E. coli, and use the minimized Ec-3(31) aptamer to develop detection assays. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Biosensor | Whole Cell-SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) or 3'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0778 | 27871171 | 2016 | Cell-SELEX Based Identification of an RNA Aptamer for Escherichia coli and Its Use in Various Detection Formats | Ec2 | AUACCAGCUUAUUCAAUUCUUCUUUGAUCUGCUCGUAUCAUGGGACGGGAGGGUAUAGAUAGUAAGUGCAAUCU | 74 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssRNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify an aptamer that binds specifically to E. coli, and use the minimized Ec-3(31) aptamer to develop detection assays. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Biosensor | Whole Cell-SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) or 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0779 | 27871171 | 2016 | Cell-SELEX Based Identification of an RNA Aptamer for Escherichia coli and Its Use in Various Detection Formats | Ec5 | AUACCAGCUUAUUCAAUUCGAAUUUAAGUUUCUUUUCUGGUAUAGUGGUUGGGUGGGUAAGAUAGUAAGUGCAAUCU | 77 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssRNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify an aptamer that binds specifically to E. coli, and use the minimized Ec-3(31) aptamer to develop detection assays. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Biosensor | Whole Cell-SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) or 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0780 | 28121169 | 2016 | Development of a DNA aptamer that binds specifically to group A Streptococcus serotype M3 | 12L18A | GCCTGTTGTGAGCCTCCTAAC-TCCTCGAGGGGGGGGGGATGAAAAGGAAAACGCAACAA-CATGCTTATTCTTGTCTCC | 78 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Group A Streptococcus (GAS) serotype M3 | Whole cell | Identify aptamers against S. pyogenes serotype M3. | 74% efficiency toward the S. pyogenes serotype M3. | 12 | Flow Cytometry | 7.47 ± 1.72 pM | Detection | Whole Cell-SELEX | FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0781 | 28121169 | 2016 | Development of a DNA aptamer that binds specifically to group A Streptococcus serotype M3 | 12L12A | GCCTGTTGTGAGCCTCCTAAC-GAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATA-CATGCTTATTCTTGTCTCC | 78 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Group A Streptococcus (GAS) serotype M3 | Whole cell | Identify aptamers against S. pyogenes serotype M3. | N/A | 12 | Flow Cytometry | 8.25 ± 1.43 pM | Detection | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0782 | 27234880 | 2016 | Aptamer-nanobody based ELASA for specific detection of Acinetobacter baumannii isolates | Aci49 | GCCTGTTGTGAGCCTCCTAAC-TACATGGTCAACCAAATTCTTGCAAATTCTGCATTCCTACTGT-CATGCTTATTCTTGTCTCC | 83 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Acinetobacter Baumannii (ATCC 19606) | Whole cell | Identify aptamers against and develop a sandwich enzyme-linked aptamer sorbent assay (ELASA) for the rapid detection of A. baumannii from clinical isolates. | Display detection limit of 10(3) CFU/ml, and the sensitivity of the test toward the clinical isolates was 95.47%. | 12 | Flow Cytometry | 7.547 ± 1.353 pM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0783 | 27234880 | 2016 | Aptamer-nanobody based ELASA for specific detection of Acinetobacter baumannii isolates | Aci55 | GCCTGTTGTGAGCCTCCTAAC-GTTACATGGTCAACCAAATTCTTGCAAATTCTGCATTCCT-CATGCTTATTCTTGTCTCC | 80 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Acinetobacter Baumannii (ATCC 19606) | Whole cell | Identify aptamers against and develop a sandwich enzyme-linked aptamer sorbent assay (ELASA) for the rapid detection of A. baumannii from clinical isolates. | N/A | 12 | Flow Cytometry | 10.70 ± 2:561 pM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0789 | 26592593 | 2016 | Chemiluminescent aptasensor capable of rapidly quantifying Escherichia Coli O157:H7 | EA1 | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Develop aptamer conjugated graphene oxide (GO)/iron nanocomposites for guanine chemiluminescence detection of E. Coli O157:H7. | N/A | N/A | N/A | N/A | Biosensor | N/A | 3'-Fluorescein Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0790 | 26592593 | 2016 | Chemiluminescent aptasensor capable of rapidly quantifying Escherichia Coli O157:H7 | EA2 | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Develop aptamer conjugated graphene oxide (GO)/iron nanocomposites for guanine chemiluminescence detection of E. Coli O157:H7. | N/A | N/A | N/A | N/A | Biosensor | N/A | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0791 | 26592593 | 2016 | Chemiluminescent aptasensor capable of rapidly quantifying Escherichia Coli O157:H7 | EA3 | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Develop aptamer conjugated graphene oxide (GO)/iron nanocomposites for guanine chemiluminescence detection of E. Coli O157:H7. | N/A | N/A | N/A | N/A | Biosensor | N/A | 3'-Pacific Blue | N/A | N/A | N/A | N/A | N/A |
| ABdb_0792 | 26592593 | 2016 | Chemiluminescent aptasensor capable of rapidly quantifying Escherichia Coli O157:H7 | EA4 | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Develop aptamer conjugated graphene oxide (GO)/iron nanocomposites for guanine chemiluminescence detection of E. Coli O157:H7. | N/A | N/A | N/A | N/A | Biosensor | N/A | 3'-Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0793 | 26592593 | 2016 | Chemiluminescent aptasensor capable of rapidly quantifying Escherichia Coli O157:H7 | EA5 | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Develop aptamer conjugated graphene oxide (GO)/iron nanocomposites for guanine chemiluminescence detection of E. Coli O157:H7. | N/A | N/A | N/A | N/A | Biosensor | N/A | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0794 | 26592593 | 2016 | Chemiluminescent aptasensor capable of rapidly quantifying Escherichia Coli O157:H7 | EA6 | GGGGGGTTTTCCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 52 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Develop aptamer conjugated graphene oxide (GO)/iron nanocomposites for guanine chemiluminescence detection of E. Coli O157:H7. | The limit of detection (LOD) was as low as 4.5×10(3) cfu/ml, with a linear range of 10(4)-10(7) cfu/ml. | N/A | N/A | N/A | Biosensor | N/A | 3'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0795 | 26334590 | 2016 | Label-free and highly sensitive electrochemical detection of E. coli based on rolling circle amplifications coupled peroxidase-mimicking DNAzyme amplification | Anti-E. coli aptamer | GCAATGGTACGGTACTTCCACTTAGGTCGAGGTTAGTTTGTCTTGCTGGCGCATCCACTGAGCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Label-free electrochemical biosensor using RCA coupled DNAzyme amplification for detecting E. coli. | Exhibits detection limits of 8 cfu/mL and a detection range of 5 orders of magnitude. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0805 | 27318566 | 2016 | Staphylococcus aureus detection in blood samples by silica nanoparticle-oligonucleotides conjugates | Aptamer | GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT | 45 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Aptamer-functionalized silica magnetic nanoparticles-based assay for on-site determination of S. aureus. | Detects S. aureus cells as low as 682 CFU in whole blood, with a linear range from 800 CFU/ml blood to 104 CFU/ml blood. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0806 | 26599860 | 2016 | Salmonella typhimurium detection using a surface-enhanced Raman scattering-based aptasensor | Apt1 | AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | A SERS-based aptasensor bearing Au@Ag core/shell nanoparticles (NPs) functionalized with apt 1 and X-rhodamine (ROX)-modified apt 2 was developed for the detection of bacteria. | A calibration curve is obtained in the range of 15 to 1.5 × 10(6) CFU/mL with a limit of detection of 15 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0807 | 26599860 | 2016 | Salmonella typhimurium detection using a surface-enhanced Raman scattering-based aptasensor | Apt2 | AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | A SERS-based aptasensor bearing Au@Ag core/shell nanoparticles (NPs) functionalized with apt 1 and X-rhodamine (ROX)-modified apt 2 was developed for the detection of bacteria. | A calibration curve is obtained in the range of 15 to 1.5 × 10(6) CFU/mL with a limit of detection of 15 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-X-rhodamine (ROX) modified | N/A | N/A | N/A | N/A | N/A |
| ABdb_0809 | 27411775 | 2016 | Rapid and Selective Detection of Pathogenic Bacteria in Bloodstream Infections with Aptamer-Based Recognition | Apt-S. aureus | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAACTTTTTTTTT | 71 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Aptamer-based capture platform using Fe3O4@mTiO2 magnetic nanoparticles for the detection of bacteria. | Display a favourable bacterial-capture efficiency of about 80% even at low infectious doses (10–2000 CFU/mL). | N/A | N/A | N/A | Detection | N/A | 3'-Amidation (NH₂-(CH2)7) and 3'-FAM Labeled ((CH2)7-FAM) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0810 | 27411775 | 2016 | Rapid and Selective Detection of Pathogenic Bacteria in Bloodstream Infections with Aptamer-Based Recognition | Apt-E. coli | ATCCGTCACACCTGCTCTACTGGCCGGCTCAGCATGACTAAGAAGGAAGTTATGTGGTGTTGGCTCCCGTATTTTTTTTTT | 81 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Aptamer-based capture platform using Fe3O4@mTiO2 magnetic nanoparticles for the detection of bacteria. | Display a favourable bacterial-capture efficiency of about 80% even at low infectious doses (10–2000 CFU/mL). | N/A | N/A | N/A | Detection | N/A | 3'-Amidation (NH₂-(CH2)7) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0812 | 26641108 | 2016 | Dual Recognition Strategy for Specific and Sensitive Detection of Bacteria Using Aptamer-Coated Magnetic Beads and Antibiotic-Capped Gold Nanoclusters | SA-aptamer | GCAATGGTACGGTACTTCC-TCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGT-CAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Aptamer-coated magnetic beads (Apt-MB) and Van-functionalized fluorescent gold nanoclusters (AuNCs@Van) were employed for specific capture of SA. | Sensitive quantification of SA in the range of 32–10(8) cfu/mL with the detection limit of 16 cfu/mL via fluorescence intensity. | N/A | N/A | N/A | Biosensor | N/A | 5′-Biotinylated and 5′-Cyanine3 (Cy3) and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0813 | 27427591 | 2016 | Duplex Identification of Staphylococcus aureus by Aptamer and Gold Nanoparticles | SA23 | GGGCTGGCCAGATCAGACCCCGGATGATCATCCTTGTGAGAACCA | 45 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | Develop an aptamer-AuNPs-based colorimetric method for duplex identification of S. aureus. | AuNPs as a sensor could well distinguish S. aureus from S. enteritidis and P. mirabilis. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0814 | 26768582 | 2016 | DNA aptamers for the detection of Haemophilus influenzae type b by cell SELEX | Clone 63 | GCCTGTTGTGAGCCTCCTAAC-AGGAGGCGAACGGGCAGGTTCTTGGGGAGACAAGAATAAG-CATGCTTATTCTTGTCTCC | 80 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Haemophilus Influenzae type b (Hib) (ATCC 10211) | Whole cell | Identify an aptamer against Hib for the detection of H. influenzae. | Clone 63 could detect Hib in patients’ CSF samples at 60 CFU/mL. | 7 | Flow Cytometry | 28.46 pM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0815 | 26768582 | 2016 | DNA aptamers for the detection of Haemophilus influenzae type b by cell SELEX | Clone 2, 42, 45 | GCCTGTTGTGAGCCTCCTAAC-GCCAGGTGTTTTGGCGGTAGGGGTGAAACAACAGGGGG-CATGCTTATTCTTGTCTCC | 78 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Haemophilus Influenzae type b (Hib) (ATCC 10211) | Whole cell | Identify an aptamer against Hib for the detection of H. influenzae. | N/A | 7 | Flow Cytometry | 47.10 pM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0816 | 27063716 | 2016 | Magnetic Nanoparticles-based Aptasensor Using Gold Nanoparticles as Colorimetric Probes for the Detection of Salmonella typhimurium | S. typhimurium aptamer | ATAGGAGTCACGACGACCAGAAAGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGATATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a colorimetric aptasensor for S. typhimurium detection using gold nanoparticles (AuNPs) and magnetic nanoparticles (MNPs). | The assay shows a linear response over a range of 25 to 10(5) cfu/mL, and the detection limit was improved to 10 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (for Apt1) and 5'-Biotinylated (for Apt2) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0817 | 26971274 | 2016 | Dual-excitation upconverting nanoparticle and quantum dot aptasensor for multiplexed food pathogen detection | S. aureus aptamer | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Dual-excitation aptasensing platform based on the luminescent nanoparticles (QDs and UCNPs) for the detection of Salmonella typhimurium and Staphylococcus aureus. | Linear detection range: 50 to 10⁶ cfu/mL; LOD: 16 cfu/mL (S. aureus). | N/A | N/A | 35 nM | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0818 | 26971274 | 2016 | Dual-excitation upconverting nanoparticle and quantum dot aptasensor for multiplexed food pathogen detection | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Dual-excitation aptasensing platform based on the luminescent nanoparticles (QDs and UCNPs) for the detection of Salmonella typhimurium and Staphylococcus aureus. | Linear detection range: 50 to 10⁶ cfu/mL; LOD: 28 cfu/mL (S. typhimurium). | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0820 | https://doi.org/10.1021/acssensors.6b00333 | 2016 | Quantitative Label-Free Listeria Analysis Based On Aptamer Modified Nanoporous Sensor | LM Aptamer | ATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT | 47 | N/A | ssDNA | Listeria Monocytogenes | Whole cell | Developed a nanoporous sensor with aptamer combined porous anodic aluminium oxide membrane for detection of L. monocytogenes. | Achieved detection within 10 min, with a high sensitivity of 100 CFU/mL and a good linear range between 100 and 1250 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5′-CHO | N/A | N/A | N/A | N/A | N/A |
| ABdb_0821 | https://doi.org/10.1016/j.foodcont.2015.11.031 | 2016 | Vibrio parahaemolyticus detection aptasensor using surface-enhanced Raman scattering | Aptamer | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | A SERS-based aptasensor was developed using Au@Ag core-shell nanoparticles for the detection of V. parahaemolyticus. | Achieved a concentration in the linear range of 10–10(6) cfu/mL, with a limit of detection of 10 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (for apt 1) and 5'-Cyanine3 (Cy3) Labeled (for apt 2) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0822 | https://doi.org/10.1039/C6AY02623K | 2016 | SERS aptasensor detection of Salmonella typhimurium using a magnetic gold nanoparticle and gold nanoparticle based sandwich structure | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 50761) | Whole cell | Developed a SERS aptasensor using aptamer-functionalized magnetic gold nanoparticles (MGNPs) and mercaptobenzoic acid (4-MBA) functionalized gold nanoparticles (GNPs) based sandwich structure for the detection of S. typhimurium. | Exhibit a good linear range from 10 cfu/mL to 10(7) cfu/mL, and the LOD is 5 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0827 | 28646719 | 2017 | DNA aptamer-based colorimetric detection platform for Salmonella Enteritidis | Crn-1 | AAGGGCTGGCTGGGATGGA-CCCTCCCGAAACGAGCTGTCTCTTAACGGAAGCTAATCTGCC-TCACTCCACGGACCCCACT | 80 | 5'-AAGGGCTGGCTGGGATGGA-N42-TCACTCCACGGACCCCACT-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Identify aptamers that bind to and develop a sandwich aptamer-based colorimetric bioassay to detect S. Enteritidis at 4°C. | Display a LOD of 10(3) CFU/mL for S. Enteritidis. | 12 | Isothermal Titration Calorimetry (ITC) | 0.971 ± 0.013 µM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0828 | 28646719 | 2017 | DNA aptamer-based colorimetric detection platform for Salmonella Enteritidis | Crn-2 | AAGGGCTGGCTGGGATGGA-TGTAAGAAGGGAGGAAAGGACCTAAGACCTGCTATATTGCGA-TCACTCCACGGACCCCACT | 80 | 5'-AAGGGCTGGCTGGGATGGA-N42-TCACTCCACGGACCCCACT-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Identify aptamers that bind to and develop a sandwich aptamer-based colorimetric bioassay to detect S. Enteritidis at 4°C. | Display a LOD of 10(3) CFU/mL for S. Enteritidis. | 12 | Isothermal Titration Calorimetry (ITC) | 0.309 ± 0.071 µM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0829 | 28646719 | 2017 | DNA aptamer-based colorimetric detection platform for Salmonella Enteritidis | Crn-3 | AAGGGCTGGCTGGGATGGA-GGATGGCATTACCTATGCGGTAGATTGCCGACGACCACGAC-TCACTCCACGGACCCCACT | 79 | 5'-AAGGGCTGGCTGGGATGGA-N42-TCACTCCACGGACCCCACT-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Identify aptamers that bind to and develop a sandwich aptamer-based colorimetric bioassay to detect S. Enteritidis at 4°C. | N/A | 12 | Isothermal Titration Calorimetry (ITC) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0833 | 28778062 | 2017 | DNA aptamer functionalized gold nanostructures for molecular recognition and photothermal inactivation of methicillin-Resistant Staphylococcus aureus | Aptamer | ATCCAGACGTGACGCAGC-ATGCGGTTGGTTGCGGTTGGGCATGATGTATTTCTGTG-TGGACACGGTGGCTTAGTA | 75 | 5'-ATCCAGACGTGACGCAGC-N38-TGGACACGGTGGCTTAGTA-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) standard strain 43300 | Whole cell | Aptamer-functionalized gold nanorods (Apt@Au NRs) for inactivation of MRSA with targeted photothermal therapy (PTT). | Over 95% inactivation of MRSA cells within 2 min. | N/A | N/A | N/A | Therapeutics | N/A | 3'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0843 | 28818557 | 2017 | DNA aptamer identification and characterization for E. coli O157 detection using cell based SELEX method | AM-6 | CGTGATGATGTTGAGTTG-GGGTGATGGGTGCATGTGATGAAAGGGGTTCGTGCTATGCTGTTTTGTCTAATAATACTAGTCCTTGCCAAGGTTTATTC-CAGTAATGCCAACCAATCT | 117 | 5'-CGTGATGATGTTGAGTTG-80N-CAGTAATGCCAACCAATCT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers for the detection of E. coli O157 and selectively distinguish the pathogenic strain from other strains. | 66.26% fluorescent cell intensity for E. coli O157 with less cross-reactivity. | 10 | Flow Cytometry | 107.6 ± 67.8 pM | Detection | Whole Cell-SELEX | FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0844 | 28818557 | 2017 | DNA aptamer identification and characterization for E. coli O157 detection using cell based SELEX method | AM-5 | CGTGATGATGTTGAGTTG-GAGTTGCGTTGCTGAATGCATGGGCTGTACTAGGTTGGTGCTACTCTGTAATGTCTACTATTACTATTCCATCGCAACGTATACTG-CAGTAATGCCAACCAATCT | 123 | 5'-CGTGATGATGTTGAGTTG-80N-CAGTAATGCCAACCAATCT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers for the detection of E. coli O157 and selectively distinguish the pathogenic strain from other strains. | 57.41% fluorescent cell intensity for E. coli O157 with less cross-reactivity. | 10 | Flow Cytometry | 120.4 ± 32.2 pM | Detection | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0845 | 28818557 | 2017 | DNA aptamer identification and characterization for E. coli O157 detection using cell based SELEX method | AM-1 | CGTGATGATGTTGAGTTG-GCCGAGATTGAAGCTGGTGACCATTGGCCTTACTGGGATGCTCTTGTGATTACTACTACTAATCGTTGTGAACGTAAATGC-CAGTAATGCCAACCAATCT | 118 | 5'-CGTGATGATGTTGAGTTG-80N-CAGTAATGCCAACCAATCT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers for the detection of E. coli O157 and selectively distinguish the pathogenic strain from other strains. | N/A | 10 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0846 | 28818557 | 2017 | DNA aptamer identification and characterization for E. coli O157 detection using cell based SELEX method | AM-2 | CGTGATGATGTTGAGTTG-GTGTTAATCCGTGTATGCCATGAGACCGGTAAGTCCTATTTTCGCTCCTGGAATGGTACAAGCTCATGTCAAGATATACTC-CAGTAATGCCAACCAATCT | 118 | 5'-CGTGATGATGTTGAGTTG-80N-CAGTAATGCCAACCAATCT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers for the detection of E. coli O157 and selectively distinguish the pathogenic strain from other strains. | N/A | 10 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0847 | 28818557 | 2017 | DNA aptamer identification and characterization for E. coli O157 detection using cell based SELEX method | AM-3 | CGTGATGATGTTGAGTTG-GGGCAGATCCGTGCACATGATCTTAGCCGTACGTGTTCTGCGGTATAGTCTATTCATACTACCACTTCGCAATGTATATCG-CAGTAATGCCAACCAATCT | 118 | 5'-CGTGATGATGTTGAGTTG-80N-CAGTAATGCCAACCAATCT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers for the detection of E. coli O157 and selectively distinguish the pathogenic strain from other strains. | N/A | 10 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0848 | 28818557 | 2017 | DNA aptamer identification and characterization for E. coli O157 detection using cell based SELEX method | AM-4 | CGTGATGATGTTGAGTTG-GTCGAGTACGGATCACTTGGAGATTGGCCATCGAGCTATTCTGTAATGTGTAATCCTACTACACCTTCGCATCGTTAATGC-CAGTAATGCCAACCAATCT | 118 | 5'-CGTGATGATGTTGAGTTG-80N-CAGTAATGCCAACCAATCT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers for the detection of E. coli O157 and selectively distinguish the pathogenic strain from other strains. | N/A | 10 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0849 | 28941453 | 2017 | Development of a DNA Aptamer for Screening Neisseria meningitidis Serogroup B by Cell SELEX | K3 | GCCTGTTGTGAGCCTCCTAACGCCAGGCGTTTTGGCCGTAGGCGTGGGAGACAAGAATAAGCA | 63 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Neisseria Meningitidis Serogroup B (ATCC 13090) | Whole cell | Identity aptamers bind to and detect N. meningitidis in patients’ CSF samples. | Detected 10(2) CFU of CSF isolated N. meningitidis. | 6 | Flow Cytometry | 28.3 ± 8.9 pM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0850 | 28941453 | 2017 | Development of a DNA Aptamer for Screening Neisseria meningitidis Serogroup B by Cell SELEX | K4 | N/A | N/A | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Neisseria Meningitidis Serogroup B (ATCC 13090) | Whole cell | Identity aptamers bind to and detect N. meningitidis in patients’ CSF samples. | N/A | 6 | Flow Cytometry | 39.1 ± 8.6 pM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0881 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB2p | AGCAGCACAGAGGTCAGATG-CCGGGCAGCGGTCAATGCCGCACCTTCCATATGATCGGGG-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | The per cent gated fluorescence intensity above the background was 8.9% for BB2p. | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0882 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB10p | AGCAGCACAGAGGTCAGATG-GGCCCCCTGCCTGCCAAAAAGGTGTTGCCAGGTTGGCGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | The per cent gated fluorescence intensity above the background was 11.2% for BB10p. | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0883 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB16p | AGCAGCACAGAGGTCAGATG-CTCCCAGGCCGTTGGGGCGTTGCCTGCGTGCACCCGGGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | The per cent gated fluorescence intensity above the background was 7.0% for BB16p. | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0884 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB2 | CCGGGCAGCGGTCAATGCCGCACCTTCCATATGATCGGGG | 40 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | BB2 showed a lower binding affinity than the aptamer BB2p. | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0885 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB10 | GGCCCCCTGCCTGCCAAAAAGGTGTTGCCAGGTTGGCGGC | 40 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | Demonstrated higher binding affinity than the original full-length aptamer. | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0886 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB16 | CTCCCAGGCCGTTGGGGCGTTGCCTGCGTGCACCCGGGGC | 40 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | Demonstrated higher binding affinity than the original full-length aptamer. | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0887 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB10-6f | GGCCCCCTGCCTGCCAAAAAGGTGTTGCCAGGTT | 34 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0888 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB10-10f | GGCCCCCTGCCTGCCAAAAAGGTGTTGCCA | 30 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0889 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB10-14f | GGCCCCCTGCCTGCCAAAAAGGTGTT | 26 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0890 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB10-2r | CCCCCTGCCTGCCAAAAAGGTGTTGCCAGGTTGGCGGC | 38 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0891 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB10-9r | CCTGCCAAAAAGGTGTTGCCAGGTTGGCGGC | 31 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0892 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB10-13r | CCAAAAAGGTGTTGCCAGGTTGGCGGC | 27 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0893 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB16-11f | CTCCCAGGCCGTTGGGGCGTTGCCTGCGT | 29 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | LOD of the assay was 1000 cfu/mL with a linear range from 10(3) to 10(7) cfu/mL. | 12 | Flow Cytometry | 18.66 ± 1.41 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0894 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB16-13f | CTCCCAGGCCGTTGGGGCGTTGCCTGC | 27 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0895 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB16-15f | CTCCCAGGCCGTTGGGGCGTTGCCT | 25 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0896 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB16-8r | CCGTTGGGGCGTTGCCTGCGTGCACCCGGGGC | 32 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0897 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-3 | ATACCAGCTTATTCAATTCCA-TGGTCCCTCGTGTTTATTATGTTGTCTGAACTGGCTG-AGATTGCACTTACTATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | Sandwich complex pair of SS-3 and SS-4 shows a linear dynamic range of 10(3)-10(6) cells/mL, and a limit of detection of 10(3) cells per mL for S. sonnei. | 8 | Surface Plasmon Resonance (SPR) | 39.32 ± 5.02 nM | Biosensor | Whole Cell-SELEX | 5'-Cyanine5 (Cy5) Labeled or 5′-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0898 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-4 | ATACCAGCTTATTCAATTCCA-CACATACCAAAAACACAGCACACTTCATCAATTTCACG-AGATTGCACTTACTATCT | 77 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | Sandwich complex pair of SS-3 and SS-4 shows a linear dynamic range of 10(3)-10(6) cells/mL, and a limit of detection of 10(3) cells per mL for S. sonnei. | 8 | Surface Plasmon Resonance (SPR) | 15.89 ± 1.77 nM | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0899 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-1 | ATACCAGCTTATTCAATTCCA-GGGCATGTGGACCTGCGATTTCGGTTTGGTGTGGTTGGGG-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0900 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-2 | ATACCAGCTTATTCAATTCCA-CCCCATGTCTGTTTCTTTTAACAGGTAATCCGCCTTATGC-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0901 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-5 | ATACCAGCTTATTCAATTCCA-CAGGACAAAAATTCGGGAAGGCGGCCTTCCACTCTTTCTG-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0902 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-6 | ATACCAGCTTATTCAATTCCA-ATACAGTGAAGGCCCAGGAGGCAAATTCTAGGACGAAAGC-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0903 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-7 | ATACCAGCTTATTCAATTCCA-CACCAAGTCGCCTCCTCTGCCCCCATGTAAATCGTTACAT-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0904 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-8 | ATACCAGCTTATTCAATTCCA-GAACAATTTCACGCACACCGCGTAGATACCACCTCGTGCA-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0905 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-9 | ATACCAGCTTATTCAATTCCA-CGACGAACTACACCACAGGCCCTTAACACATCTACTTGTA-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0906 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-10 | ATACCAGCTTATTCAATTCCA-CATGCTAACTGCCATCACCACTATTTATGATTCCATCCAT-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0907 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-11 | ATACCAGCTTATTCAATTCCA-CGCAACACAGAAACACCCGTACACAAACAGTTTCAGCCCG-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0908 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-12 | ATACCAGCTTATTCAATTCCA-TGCGTAGTTCTCTTAACAACCATTCAGCGTATTTTCGTGG-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0909 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-13 | ATACCAGCTTATTCAATTCCA-CAGGCACGAGTTCATCACACACCATACACAGTTCGTTACT-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0910 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-14 | ATACCAGCTTATTCAATTCCA-CCACACCACACACTACACGCATAAAACCACGAAACTACAC-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0911 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-15 | ATACCAGCTTATTCAATTCCA-GGGTATGTGGACTTGCGATTTCGGTTTGGTGTGGTTGGGG-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0912 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-16 | ATACCAGCTTATTCAATTCCA-CATACAGTGGCCAGATTTACCAACACACCTTTCCATACGC-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0913 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-17 | ATACCAGCTTATTCAATTCCA-CCACTCACATATTAACAACACCACATGAATATATTTCG-AGATTGCACTTACTATCT | 77 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0914 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-18 | ATACCAGCTTATTCAATTCCA-ACAGGGCATGTCTTCATCAACGCTTACCACACACCGCTCG-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0915 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-19 | ATACCAGCTTATTCAATTCCA-CACTCATGCGCACCGCGTCGCACTTAATCAGTGTTGTGC-AGATTGCACTTACTATCT | 78 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0916 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-20 | ATACCAGCTTATTCAATTCCA-GGGCATGTGGACTTGCGATTTCGGTTTGGTGTGGTTGGGG-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0917 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-21 | ATACCAGCTTATTCAATTCCA-CAGACACACCAACGCACGGGCACACGCTACAAATGTAAGT-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0920 | 28689112 | 2017 | Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor | Aptamer 1 | GGGAGCTCAGAATAAACGCTCAA-CCCTGCGGGGCTGCCCGATATGTGTCCAAGTGGTG-TTCGACATGAGGCCCGGATC | 55 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain. | The detection time for M. tuberculosis was 70 min, and the detection limit was 100 cfu/mL. | 14 | Fluorescence Spectroscopy | 37 ± 4 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0921 | 28689112 | 2017 | Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor | Aptamer 2 | GGGAGCTCAGAATAAACGCTCAA-GGCACACAGGACTATACAGTGTTGCAGTGTTGCTG-TTCGACATGAGGCCCGGATC | 55 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain. | N/A | 14 | Fluorescence Spectroscopy | 97 ± 4 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0922 | 28689112 | 2017 | Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor | Aptamer 3 | GGGAGCTCAGAATAAACGCTCAA-CCCTGCGGGGCTGCCCGATATGTGTCCAAGTGGTG-TTCGACATGAGGCCCGGATC | 55 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain. | N/A | 14 | Fluorescence Spectroscopy | 101 ± 5 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0923 | 28689112 | 2017 | Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor | Aptamer 4 | GGGAGCTCAGAATAAACGCTCAA-CCCTGCGGGGCTGCCCGATATGTGTCCAAGTGGTG-TTCGACATGAGGCCCGGATC | 55 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain. | N/A | 14 | Fluorescence Spectroscopy | 98 ± 7 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0924 | 28689112 | 2017 | Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor | Aptamer 5 | GGGAGCTCAGAATAAACGCTCAA-CCCTGCGGGGCTACCCGATATGTGTCCGAGTGGTG-TTCGACATGAGGCCCGGATC | 55 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain. | N/A | 14 | Fluorescence Spectroscopy | 96 ± 8 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0925 | 28689112 | 2017 | Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor | Aptamer 6 | GGGAGCTCAGAATAAACGCTCAA-GGCACGATGTGGCTACATCGATCGCGGTACTGGTG-TTCGACATGAGGCCCGGATC | 55 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain. | N/A | 14 | Fluorescence Spectroscopy | 103 ± 6 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0926 | 28689112 | 2017 | Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor | Aptamer 7 | GGGAGCTCAGAATAAACGCTCAA-GGCAGGTGGTGTTGGTTGGTTGTGCGTGGAGTTGG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain. | N/A | 14 | Fluorescence Spectroscopy | 107 ± 9 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0927 | 28689112 | 2017 | Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor | Aptamer 8 | GGGAGCTCAGAATAAACGCTCAA-GGCAGCAGCAATGTAACACTGTGTGTATGTGTTGG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain. | N/A | 14 | Fluorescence Spectroscopy | 102 ± 8 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0928 | 28689112 | 2017 | Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor | Aptamer 9 | GGGAGCTCAGAATAAACGCTCAA-CCCTGCGGGGCTGCCCGATATGTGTCCAAGTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain. | N/A | 14 | Fluorescence Spectroscopy | 108 ± 4 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0929 | 28689112 | 2017 | Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor | Aptamer10 | GGGAGCTCAGAATAAACGCTCAA-CCCTGCGGGGCTGCCCGATATGTGTCCAGGTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain. | N/A | 14 | Fluorescence Spectroscopy | 110 ± 3 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0930 | 28689112 | 2017 | Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor | Aptamer11 | GGGAGCTCAGAATAAACGCTCAA-GGCACGATGTGGCTACATCGATCGCGGTACTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain. | N/A | 14 | Fluorescence Spectroscopy | 103 ± 4 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0931 | 28689112 | 2017 | Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor | Aptamer12 | GGGAGCTCAGAATAAACGCTCAA-GGGGAGGCAGTGTGTTGTGTCGTGTGTGTGCTTGG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain. | N/A | 14 | Fluorescence Spectroscopy | 110 ± 7 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0932 | 27696554 | 2017 | Evaluation of Staphylococcus aureus DNA aptamer by enzyme-linked aptamer assay and isothermal titration calorimetry | SA31 | TCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGA | 45 | N/A | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Whole cell | ELAA and ITC to study impact of temperature and ion concentration in the binding of aptamer to its target on surface of bacteria. | Both temperature and salt concentration directly influenced the 3D structure of the DNA molecule under specified experimental conditions, thereby altering the aptamer's affinity for its target. | N/A | N/A | N/A | Detection | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0934 | 27825886 | 2017 | Upconversion nanoparticles based FRET aptasensor for rapid and ultrasenstive bacteria detection | E.coli aptamer | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC 8739) | Whole cell | Upconversion nanoparticles (UCNPs) based FRET aptasensor (UCNPs-cDNA from AuNPs-aptamers) for detecting E. coli in tap/pond water and milk. | Display a detection range of 5–10(6) cfu/mL and a detection limit of 3 cfu/mL in 20 min. | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0935 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.1A | GCGC(U^y)CGCGCGGCG(U^y)GC-ACAACAAA(U^y)G(U^y)GACCA(U^y)GCGA(U^y)(U^y)CCCCA(U^y)A(U^y)CCAGGCACA-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 77 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | N/A | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0936 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.2A | GCGC(U^y)CGCGCGGCG(U^y)GC-GA(U^y)GCG(U^y)G(U^y)GG(U^y)G(U^y)GGAG(U^y)(U^y)G(U^y)G(U^y)GAG(U^y)GG(U^y)C(U^y)GCG(U^y)(U^y)G(U^y)-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 77 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | N/A | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0937 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.5B | GCGC(U^y)CGCGCGGCG(U^y)GC-(U^y)(U^y)CA(U^y)GCCC(U^y)G(U^y)G(U^y)C(U^y)(U^y)GC(U^y)C(U^y)(U^y)G(U^y)GAG(U^y)(U^y)G(U^y)(U^y)G(U^y)G(U^y)CA-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 76 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | N/A | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0938 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.8A | GCGC(U^y)CGCGCGGCG(U^y)GC-G(U^y)G(U^y)G(U^y)A(U^y)GCG(U^y)(U^y)CA(U^y)G(U^y)GG(U^y)GAGG(U^y)C(U^y)(U^y)GCG(U^y)C(U^y)G(U^y)(U^y)(U^y)-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 76 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | N/A | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0939 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.10A | GCGC(U^y)CGCGCGGCG(U^y)GC-GAG(U^y)G(U^y)G(U^y)G(U^y)GGG(U^y)CCGAG(U^y)GGG(U^y)GG(U^y)CAGGG(U^y)(U^y)(U^y)G(U^y)(U^y)(U^y)-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 76 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | Showed the highest % binding to the DH5α cells, with per cent bound ranging from 2.9 to 21%. | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0940 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.14B | GCGC(U^y)CGCGCGGCG(U^y)GC-(U^y)C(U^y)G(U^y)G(U^y)GCGG(U^y)G(U^y)(U^y)A(U^y)GCGGG(U^y)(U^y)GGG(U^y)(U^y)G(U^y)(U^y)(U^y)G(U^y)G(U^y)(U^y)(U^y)-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 76 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | Showed the highest % binding to the DH5α cells, with per cent bound ranging from 2.9 to 21%. | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0941 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.16B | GCGC(U^y)CGCGCGGCG(U^y)GC-(U^y)(U^y)(U^y)GCG(U^y)CCGGG(U^y)(U^y)(U^y)A(U^y)GCGGG(U^y)(U^y)G(U^y)C(U^y)CG(U^y)G(U^y)C(U^y)G(U^y)(U^y)(U^y)-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 76 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | N/A | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0942 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.17B | GCGC(U^y)CGCGCGGCG(U^y)GC-(U^y)C(U^y)(U^y)G(U^y)(U^y)GGG(U^y)CGACGG(U^y)C(U^y)G(U^y)(U^y)CA(U^y)G(U^y)GGG(U^y)G(U^y)(U^y)G(U^y)CCC-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 77 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | N/A | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0943 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.18B | GCGC(U^y)CGCGCGGCG(U^y)GC-(U^y)(U^y)G(U^y)G(U^y)(U^y)CACG(U^y)CA(U^y)(U^y)(U^y)CGCAC(U^y)CC(U^y)C(U^y)CAGC(U^y)ACG(U^y)(U^y)(U^y)(U^y)-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 77 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | Showed the highest % binding to the DH5α cells, with per cent bound ranging from 2.9 to 21%. | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0944 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.24A | GCGC(U^y)CGCGCGGCG(U^y)GC-(U^y)G(U^y)G(U^y)(U^y)(U^y)G(U^y)GG(U^y)ACGAGCG(U^y)G(U^y)G(U^y)GGA(U^y)GG(U^y)CCG(U^y)G(U^y)CA-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 76 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | N/A | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0945 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.28A | GCGC(U^y)CGCGCGGCG(U^y)GC-(U^y)CC(U^y)CGCG(U^y)(U^y)(U^y)GGA(U^y)(U^y)CA(U^y)G(U^y)(U^y)GG(U^y)(U^y)(U^y)G(U^y)CGG(U^y)G(U^y)A(U^y)(U^y)G(U^y)-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 77 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | Showed the highest % binding to the DH5α cells, with per cent bound ranging from 2.9 to 21%. | 12 | Saturation Binding Assay | 27.4 ± 18.7 nM | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) and Radiolabelled ([γ-32P]-labeled) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0946 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.30A | GCGC(U^y)CGCGCGGCG(U^y)GC-ACAGAAAG(U^y)G(U^y)GGCCA(U^y)G(U^y)G(U^y)(U^y)G(U^y)G(U^y)CCC(U^y)GGCAGG(U^y)(U^y)AG(U^y)(U^y)(U^y)A-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 81 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | N/A | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0950 | https://doi.org/10.1007/s00604-017-2142-2 | 2017 | A magnetic relaxation switch aptasensor for the rapid detection of Pseudomonas aeruginosa using superparamagnetic nanoparticles | Aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Develop a magnetic relaxation switch (MRSw) aptasensor (SPIO-aptamer) for the determination of Pseudomonas aeruginosa in real food and drinking water samples. | Exhibit a linear range from 10(0) cfu/mL to 10(6) cfu/mL, and a detection limit of 50 cfu/mL was obtained within 40 mins. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0951 | https://doi.org/10.1016/j.snb.2017.09.121 | 2017 | Novel impedimetric aptasensor for label-free detection of Escherichia coli O157:H7 | E. coli specific aptamer | ATCCGTCACACCTGCTCTGTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCGTGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Developed a novel impedance-based aptasensor for the detection of E. coli O157:H7. | Exhibited a broad range from 10(1) to 10(5) cfu/mL with the LOD about 2.9 × 10(2) cfu/mL with a detection time of 30 min. | N/A | N/A | N/A | Biosensor | N/A | 5'-disulfide-modified | N/A | N/A | N/A | N/A | N/A |
| ABdb_0952 | https://doi.org/10.1016/j.foodcont.2017.07.016 | 2017 | SERS aptasensor for Salmonella typhimurium detection based on spiny gold nanoparticles | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Developed a novel SGNPs-based SERS aptasensor functionalized with p-MBA for the detection of S. typhimurium. | Display linear range 10(1) cfu/mL to 10(5) cfu/mL, with a limit of detection (LOD) of 4 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated or Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0955 | 29071202 | 2017 | An Electrochemical Aptasensor Using Coaxial Capillary with Magnetic Nanoparticle, Urease Catalysis and PCB Electrode for Rapid and Sensitive Detection of Escherichia coli O157:H7 | E. coli aptamer | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 43888) | Whole cell | Develop an electrochemical aptasensor for rapid and sensitive detection of E. coli O157:H7 that relies on aptamer and urease-modified GNPs. | Able to detect E. coli as low as 10(1) CFU/mL in 3 h, and the mean recovery of E. coli in the spiked pasteurized milk was ~99%. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0956 | 28803475 | 2017 | Intuitive Label-Free SERS Detection of Bacteria Using Aptamer-Based in Situ Silver Nanoparticles Synthesis | S.aureus-AptamerS | TCCCTACGGCGCTAACCTCCCAACCGCTCCACCCTGCCTCCGCCTCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CICC 21600) | Whole cell | Developed a SERS-based aptasensor using aptamer@AgNPs for the detection of bacteria. | Exhibited a linear concentration, ranging from 10(1) to 10(7) cfu/mL with the detection limit of 1.5 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0957 | 28803475 | 2017 | Intuitive Label-Free SERS Detection of Bacteria Using Aptamer-Based in Situ Silver Nanoparticles Synthesis | L.mono-AptamerL | TACTATCGCGGAGACAGCGCGGGAGGCACCGGGGA | 35 | N/A | ssDNA | Listeria Monocytogenes (CICC 21633) | Whole cell | Developed a SERS-based aptasensor using aptamer@AgNPs for the detection of bacteria. | N/A | N/A | N/A | N/A | Biosensor | N/A | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0958 | 28107686 | 2017 | A novel aptasensor for the colorimetric detection of S. typhimurium based on gold nanoparticles | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Colorimetric aptasensor was developed based on color changing GNPs for the detection of S. typhimurium. | Quantitative detection of S. typhimurium from 10(2) to 10(7) cfu/mL with a detection limit as low as 56 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0959 | 28107930 | 2017 | A chemiluminescent aptasensor based on rolling circle amplification and Co2+/N-(aminobutyl)-N-(ethylisoluminol) functional flowerlike gold nanoparticles for Salmonella typhimurium detection | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Chemiluminescent aptasensor based on rolling circle amplification (RCA) using Co2+/ABEI-AuNFs-cDNA complex was developed for the detection of S. typhimurium. | The limit of detection (LOD) was 10 cfu/mL. The method exhibited excellent selectivity over non-target bacteria. | N/A | N/A | N/A | Biosensor | N/A | 3'-Biotinylated (Biotin-TTTTTT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0960 | 29030671 | 2017 | Graphene-based label-free electrochemical aptasensor for rapid and sensitive detection of foodborne pathogen | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | rGO-azophloxine (AP) nanocomposite aptasensor was developed for the detection of foodborne pathogens. | Exhibited a linear range of detection from 10(8) to 10(1) cfu/mL with a detection limit of 10(1) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | Aptasensor showed good stability for up to 20 days, with a 5.1% increase in current response when stored in ultrapure water at 4°C. | N/A | N/A | N/A |
| ABdb_0961 | 28645756 | 2017 | An aptamer-based PCR method coupled with magnetic immunoseparation for sensitive detection of Salmonella Typhimurium in ground turkey | S. Typhimurium aptamer | CAGTCCAGGACAGATTCGCGAGCCCACTCCAAACACGACCAACTCACGCTCTATCAACATCGCTATCCACGTGGATTTCATTCAGCGATT | 90 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Aptamer-based PCR method coupled with magnetic immunoseparation was developed to detect S. Typhimurium from ground turkey. | Able to detect 10(2) CFU/mL of S. Typhimurium in pure culture, and 10(3) CFU/mL of S. Typhimurium in ground turkey. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0962 | 29594712 | 2017 | Fluorometric graphene oxide-based detection of Salmonella enteritis using a truncated DNA aptamer | SE54F | TACCAAAATGTTGGATTGGATGTTGTACTGGGTTGCATAGGTAGTCCAGAAGCC | 54 | N/A | ssDNA | Salmonella Enteritidis (S. Enteritidis) (ATCC 13076) | Whole cell | Truncated aptamer was used to develop a fluorometric graphene oxide (GO) based assay for the detection of S. enteriditis. | LOD of 38 and 25 cfu/mL for the full length SE54 and SE54T, respectively, with a linear response from 10(2) to 10(7) cfu/mL. | N/A | Fluorescence Spectroscopy | 6.3 nM | Detection | N/A | 5'-Fluorescein Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0963 | 29594712 | 2017 | Fluorometric graphene oxide-based detection of Salmonella enteritis using a truncated DNA aptamer | SE54T | GGATTGGATGTTGTACTGGGTTGCATAGG | 29 | N/A | ssDNA | Salmonella Enteritidis (S. Enteritidis) (ATCC 13076) | Whole cell | Truncated aptamer was used to develop a fluorometric graphene oxide (GO) based assay for the detection of S. enteriditis. | LOD of 38 and 25 cfu/mL for the full length SE54 and SE54T, respectively with a linear response from 10(2) to 10(7) cfu/mL. | N/A | Fluorescence Spectroscopy | 3.2 nM | Detection | N/A | 5'-Fluorescein Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0972 | 28910678 | 2017 | Colorimetric aptasensor for the detection of Salmonella enterica serovar typhimurium using ZnFe2O4-reduced graphene oxide nanostructures as an effective peroxidase mimetics | Apt 1 (Capture) | AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | The colorimetric aptasensor platform was developed based on ZnFe2O4/rGO nanostructures, which act as an artificial enzyme (mimetic) that catalyses the oxidation of TMB by H2O2 to detect S. typhimurium. | The limit of detection (LOD) of 11 cfu/mL, and the detection range was 11 to 1.10 × 10(5) cfu/mL of S. typhimurium in buffer solution. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0973 | 28910678 | 2017 | Colorimetric aptasensor for the detection of Salmonella enterica serovar typhimurium using ZnFe2O4-reduced graphene oxide nanostructures as an effective peroxidase mimetics | Apt 2 (Signal) | AAAAAAAAAAAAAGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA | 52 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | The colorimetric aptasensor platform was developed based on ZnFe2O4/rGO nanostructures, which act as an artificial enzyme (mimetic) that catalyses the oxidation of TMB by H2O2 to detect S. typhimurium. | Limit of detection (LOD) of 11 cfu/mL | N/A | N/A | N/A | Biosensor | N/A | 5'-PolyA (12A) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0976 | 28860462 | 2017 | Development of gold nanoparticle-aptamer-based LSPR sensing chips for the rapid detection of Salmonella typhimurium in pork meat | Aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (KCTC 2421) | Whole cell | Develop a portable LSPR biosensor-based device on gold nanoparticles (AuNPs) for the detection of Salmonella typhimurium in pork meat samples. | Limit of detection (LOD) of 10(4) cfu/mL in both pure culture and spiked pork samples, and total analysis time of 30-35 minutes. | N/A | N/A | N/A | Biosensor | N/A | 3'-Thiolated (SH-(CH2)3) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0977 | 28624620 | 2017 | AgBr nanoparticles/3D nitrogen-doped graphene hydrogel for fabricating all-solid-state luminol-electrochemiluminescence Escherichia coli aptasensors | E. coli aptamer | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Developed a ECL aptasensor based on amine-functionalized E. coli aptamer and luminol/AgBr/3DNGH for the detection of E. coli. | Linear response range from 0.5 to 500 cfu/mL and Limit of Detection (LOD) of 0.17 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | No obvious change was observed for the response of a BSA/aptamer/GA/CHIT/luminol/AgBr/3DNGH/GCE when stored at 4°C for 12 d, indicating an acceptable stability of the aptasensor. | N/A | N/A | N/A |
| ABdb_0978 | 27526340 | 2017 | Aptamer biosensor for Salmonella typhimurium detection based on luminescence energy transfer from Mn2+-doped NaYF4:Yb, Tm upconverting nanoparticles to gold nanorods | S. typhimurium aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | A LET method based on UCNPs and gold nanorods (Au NRs) was developed for the determination of Salmonella typhimurium. | Linear range: 12 to 5×10^5 cfu/mL and Limit of Detection (LOD): 11 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0980 | 28691795 | 2017 | Copper-Based Metal-Organic Framework Nanoparticles with Peroxidase-Like Activity for Sensitive Colorimetric Detection of Staphylococcus aureus | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | A colorimetric method for the detection of S. aureus was developed using aptamer-modified Cu-MOF nanoparticles. | The linear range for S. aureus detection is 50-10,000 CFU/mL, with a detection limit of 20 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0981 | 28159108 | 2017 | An enhanced chemiluminescence resonance energy transfer aptasensor based on rolling circle amplification and WS2 nanosheet for Staphylococcus aureus detection | Aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | A chemiluminescence resonance energy transfer aptasensor was developed for the detection of S. aureus with Co2+ enhanced N-(aminobutyl)-N-(ethylisoluminol) (ABEI) functional flowerlike gold nanoparticles (Co2+/ABEI-AuNFs) and WS2 nanosheet. | The CL signal was found to be linear within the range of 50 cfu/mL to 1.5 × 10(5) cfu/mL, and the limit of detection was 15 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0982 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-01 | CATATCCGCGTCGCTGCGCTCAGACCCACCACTACGCACC | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0983 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-02 | CATATCCGTGTCGCTGCGCTCAGACCCACCACCACGCACC | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0984 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-03 | CATATCCGCGTCGCTGCGCTCAGACCCACCACCACGCACC | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | STC-03 showed better affinity to E. aerogenes, K. pneumoniae, C. freundii, and B. subtilis. | 18 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | 27.2 nM (for E. coli), 11.9 nM (for E. aerogenes), 9.22 nM (for K. pneumoniae), 15.9 nM (for C. freundii), 9.97 nM (for B. subtilis), and 16.4 nM (for S. epidermidis) | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0985 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-04 | ATATCCGCGTCGCTGCGCTCAGACCCACCACCACGCACC | 39 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0986 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-05 | CATATCCGCGTCGCTGCGCTCAGACCCACCACCCGCCC | 38 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0987 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-06 | GGGCGGGGGTGCTGGGGGAATGGAGTGCTGCGTGCTGCGG | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0988 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-07 | GGGCGGGGGGTGCTGGGGGAATGGAGTGCTGCGTGCTGCG | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0989 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-08 | GGGCGGGGGTGCTGGGAGAATGGAGTGCTGCGTGCTGCAG | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0990 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-09 | GGGCAGGTGTGCTGGGGGAATGGAGTGCTGCGTGCTGCGG | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0991 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-10 | AGACCGCAGGTGCACCGGGCGACGTCTCTGGGTGTGGTGA | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0992 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-11 | AGACCGCAGGTGCACTGGGCGACGTCTCTGGGTGTGGTGT | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0993 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-12 | GGACCGCAGGTGCACTGGGCGACGTCTCTGGGTGTGGTGT | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | STC-12 showed better affinity to E. coli and S. epidermidis. | 18 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | 38.5 nM (for E. coli), 33.7 nM (for E. aerogenes), 16.3 nM (for K. pneumoniae), 25.6 nM (for C. freundii), 18.9 nM (for B. subtilis), and 13.7 nM (for S. epidermidis) | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0994 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-13 | GGACGCGCGTTGGTGGTGGATGGTGTGTTACACGTGTTGT | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0995 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-14 | CGGGGTGGGACCAGTCTTGCGCGGGTGAC | 29 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0996 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-15 | GGACTGGAGTCTAGACCGGGTAGCTGTGGT | 30 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0997 | https://doi.org/10.1007/s12161-017-0864-8 | 2017 | Fabricating a Novel Raman Spectroscopy-Based Aptasensor for Rapidly Sensing Salmonella typhimurium | S. typhimurium aptamer (STA) | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a surface-enhanced Raman scattering (SERS) based aptasensor with Raman active molecule attached GNRs and cDNA for the detection of Salmonella typhimurium (ST). | Observed linear ST concentration from 56 to 56 × 10(7) cfu/mL with a LOD of 9 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0998 | 28795534 | 2017 | Graphene Field-Effect Transistors for the Sensitive and Selective Detection of Escherichia coli Using Pyrene-Tagged DNA Aptamer | Aptamer | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC 8739) | Whole cell | Developed a biosensing platform using graphene field-effect transistors (APG-FETs) with the aid of pyrene-tagged DNA aptamers for E. coli detection. | Achieve a detection limit of 10(2) CFU/mL for E. coli within 72 s. | N/A | N/A | N/A | Biosensor | N/A | 5'-(pyrene derivate)-TTTT | N/A | N/A | N/A | N/A | N/A |
| ABdb_0999 | https://doi.org/10.1007/s00604-017-2383-0 | 2017 | Rolling circle amplification based amperometric aptamer/immuno hybrid biosensor for ultrasensitive detection of Vibrio parahaemolyticus | Vp-aptamer | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed an antibody-aptamer-based hetero-sandwich amperometric biosensor for the detection of V. parahaemolyticus. | Achieved a range of 2.2 to 2.2 x10(8) cfu/mL, and the limit of detection is as low as 2 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | After 2 weeks of storage at 4°C, the fabricated electrochemical aptasensor retains about 95.2% of its initial sensing current response. | N/A | N/A | N/A |
| ABdb_1000 | https://doi.org/10.1016/j.jelechem.2017.10.054 | 2017 | Development of an aptasensor using reduced graphene oxide chitosan complex to detect Salmonella | Aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Developed a rGO-CHI electrochemical aptasensor to detect Salmonella. | Had a wide detection range of 10(1) to 10(6) CFU/mL with a low limit of detection of 10(1) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 3'-Thiolated ((C12)-SH) and 5'-Amidation ((C12)-NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1001 | https://doi.org/10.1016/j.snb.2017.05.146 | 2017 | A simple dendrimer-aptamer based microfluidic platform for E. coli O157:H7 detection and signal intensification by rolling circle amplification | Aptamer | ATCCGTCACACCTGCTCTATCAAATGTGCAGATATCAAGACGATTTGTACAAGATGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Developed a dendrimer-aptamer microfluidic detection system with Rolling circle amplification (RCA) for the detection of E. coli O157:H7 cells. | RCA was able to enhance detection signals by up to 50 times, and the limit of detection of the system was reduced to 10(2) cells/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) and 5'-Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1012 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB10 | TAGCTCACTCATTAGGCAC-TCGAGAGGGATCTCGGGGCGTGCGATGATTTTGCCTTCAT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | A dual-labelled sandwich detection system was developed using biotinylated RAB10 and FITC-labelled RAB35, with a limit of detection (LOD) of 10^2 CFU/mL of S. aureus, and showed 2.7-fold more signal than other bacteria. | 10 | Flow Cytometry | 46 ± 24 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1013 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB20 | TAGCTCACTCATTAGGCAC-GCGTTACGTTAGTGGCCGCCTATGAGGACAGGCGGTTGTA-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | N/A | 10 | Flow Cytometry | 128 ± 45 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1014 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB28 | TAGCTCACTCATTAGGCAC-TGGACGTCGTGGCGGAGGTTTTATAAAACGGCGCCACTGT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | N/A | 10 | Flow Cytometry | 49 ± 39 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1015 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB35 | TAGCTCACTCATTAGGCAC-GGGGGGTTGTGCCATTTAAGATGACCGGTTGCCGCGATTT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | A dual-labelled sandwich detection system was developed using biotinylated RAB10 and FITC-labelled RAB35, with a limit of detection (LOD) of 10^2 CFU/mL of S. aureus, and showed 2.7-fold more signal than other bacteria. | 10 | Flow Cytometry | 34 ± 5 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1016 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB1 | TAGCTCACTCATTAGGCAC-CGGGTGGGCTCCAATATGAATCGCTTGCCCTGACGCTATCT-GCATAGTTAAGCCAGCC | 77 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | N/A | 10 | Flow Cytometry | 56 ± 87 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1017 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB3 | TAGCTCACTCATTAGGCAC-CGTAGTCTAGTGTCGATTAGTTTCCTTGAGACCTTGTGCT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | N/A | 10 | Flow Cytometry | 37 ± 112 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1018 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB5 | TAGCTCACTCATTAGGCAC-CGTAGTCTAGTGTCGATTAGTTTCCTTGCTATTGCAGACCTTGTGCT-GCATAGTTAAGCCAGCC | 83 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | N/A | 10 | Flow Cytometry | 58 ± 14 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1019 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB9 | TAGCTCACTCATTAGGCAC-TCGAGAGGGATCTCGGGGCGTGCGATGATTTTGCCTTCAT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1020 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB21 | TAGCTCACTCATTAGGCAC-GGGGGGTTGTGCCATTTAAGATGACCGGTTGCCAAGATG-GCATAGTTAAGCCAGCC | 75 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1021 | 29098517 | 2018 | Influence of aptamer-targeted antibiofilm agents for treatment of Pseudomonas aeruginosa biofilms | PA-ap1 (F23) | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Aptamer-ciprofloxacin-SWNTs complex for antibiofilm activity. | 90% inhibitory efficiency of complex aptamer-ciprofloxacin-SWNTs on biofilm formation. | 16 | Flow Cytometry | 17.27 ± 5.00 nM | Targeted Delivery/Therapeutics | Whole Cell-SELEX | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1026 | 29964028 | 2018 | Selection of DNA aptamers to Streptococcus pneumonia and fabrication of graphene oxide based fluorescent assay | Lyd-3 | TGACGAGCCCAAGTTACCT-GCCCCCGAACCATACCACACGATGCCCCGTACCCCAGCCACC-AGAATCTCCGCTGCCTACA | 80 | 5'-TGACGAGCCCAAGTTACCT-N42-AGAATCTCCGCTGCCTACA-3' (Library 1) and 5'-AAGGGCTGGCTGGGATGGA-N42-TCACTTCACGGACCCCACT-3' (Library 2) | ssDNA | Streptococcus Pneumoniae | Whole cell | Identify aptamers that bind to and develop a graphene oxide/aptamer-based label-free fluorescent assay to detect Streptococcus pneumoniae and inhibit biofilm formation. | Show a detection limit of 15 cfu mL-1. Biofilm formation was reduced from 100% to 35.8% at a Lyd-3 concentration of 1 μM compared with the no-aptamer control. | 20 | Fluorescence Spectroscopy | 661.8 ± 111.3 nM | Diagnostic/Therapeutics | Whole Cell-SELEX | FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1027 | 29964028 | 2018 | Selection of DNA aptamers to Streptococcus pneumonia and fabrication of graphene oxide based fluorescent assay | Lyd-1 | AAGGGCTGGCTGGGATGGA-CCCTCCCGAAACGAGCTGTCTCTTAACGGAAGCTAATCTGCC-TCACTCCACGGACCCCACT | 80 | 5'-TGACGAGCCCAAGTTACCT-N42-AGAATCTCCGCTGCCTACA-3' (Library 1) and 5'-AAGGGCTGGCTGGGATGGA-N42-TCACTTCACGGACCCCACT-3' (Library 2) | ssDNA | Streptococcus Pneumoniae | Whole cell | Identify aptamers that bind to and develop a graphene oxide/aptamer-based label-free fluorescent assay to detect Streptococcus pneumoniae and inhibit biofilm formation. | At 100 nM of Lyd-1, biofilm formation decreased to 90.8%. | 20 | Fluorescence Spectroscopy | 844.7 ± 123.6 nM | Diagnostic/Therapeutics | Whole Cell-SELEX | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1028 | 29964028 | 2018 | Selection of DNA aptamers to Streptococcus pneumonia and fabrication of graphene oxide based fluorescent assay | Lyd-2 | TGACGAGCCCAAGTTACCT-CACCCGCCTGGCAAAAAACACCACGACATTTTTCTCACCCCC-AGAATCTCCGCTGCCTACA | 80 | 5'-TGACGAGCCCAAGTTACCT-N42-AGAATCTCCGCTGCCTACA-3' (Library 1) and 5'-AAGGGCTGGCTGGGATGGA-N42-TCACTTCACGGACCCCACT-3' (Library 2) | ssDNA | Streptococcus Pneumoniae | Whole cell | Identify aptamers that bind to and develop a graphene oxide/aptamer-based label-free fluorescent assay to detect Streptococcus pneumoniae and inhibit biofilm formation. | At 100 nM of Lyd-2, biofilm formation decreased to 92.6%. | 20 | Fluorescence Spectroscopy | 1984.8 ± 347.5 nM | Diagnostic/Therapeutics | Whole Cell-SELEX | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1029 | 29698672 | 2018 | Selection and characterization, application of a DNA aptamer targeted to Streptococcus pyogenes in cooked chicken | S-12 | AGCAGCACAGAGGTCAGATG-GCGGGCGGGGGGAGGGCGGCCGTGGGCTGCGAGTGGGAGG-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Streptococcus Pyogenes (ATCC 49399) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect S. pyogenes in the cooked chicken. | Limit of detection of 70 cfu/mL with a range of 70–7100 cfu/mL. | 12 | Flow Cytometry | 44 ± 5 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1030 | 29698672 | 2018 | Selection and characterization, application of a DNA aptamer targeted to Streptococcus pyogenes in cooked chicken | S-2 | AGCAGCACAGAGGTCAGATG-GTTCGGGGTCGGGGTGAGTGGGGCCTAGGAGTGGGGGCGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Streptococcus Pyogenes (ATCC 49399) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect S. pyogenes in the cooked chicken. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1031 | 29698672 | 2018 | Selection and characterization, application of a DNA aptamer targeted to Streptococcus pyogenes in cooked chicken | S-8 | AGCAGCACAGAGGTCAGATG-ATGGGGGGCGGGGAGGTGGGTACAGGGTCGGGGATGGCAG-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Streptococcus Pyogenes (ATCC 49399) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect S. pyogenes in the cooked chicken. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1032 | 29698672 | 2018 | Selection and characterization, application of a DNA aptamer targeted to Streptococcus pyogenes in cooked chicken | S-10 | AGCAGCACAGAGGTCAGATG-CGGGCGGGGCGTGGGGTGTTGGAGTGGAGGGCGGGGCGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Streptococcus Pyogenes (ATCC 49399) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect S. pyogenes in the cooked chicken. | N/A | 12 | Flow Cytometry | 54 ± 8 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1033 | 29698672 | 2018 | Selection and characterization, application of a DNA aptamer targeted to Streptococcus pyogenes in cooked chicken | S-15 | AGCAGCACAGAGGTCAGATG-CAGGGTGCGGGAGGGCCAAAGGGGGGAGGGCCCGGGGGGA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Streptococcus Pyogenes (ATCC 49399) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect S. pyogenes in the cooked chicken. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1034 | 29698672 | 2018 | Selection and characterization, application of a DNA aptamer targeted to Streptococcus pyogenes in cooked chicken | S-21 | AGCAGCACAGAGGTCAGATG-GGGGGAGGCGCCGGGCAGGGGGCTCGGGGGAGGCGGGCGG-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Streptococcus Pyogenes (ATCC 49399) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect S. pyogenes in the cooked chicken. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1035 | 29698672 | 2018 | Selection and characterization, application of a DNA aptamer targeted to Streptococcus pyogenes in cooked chicken | S-26 | AGCAGCACAGAGGTCAGATG-TTCAGGGCGGGGTAAACGGGAGGTGGGGGGGGCTTGGGAC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Streptococcus Pyogenes (ATCC 49399) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect S. pyogenes in the cooked chicken. | N/A | 12 | Flow Cytometry | 130 ± 24 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1036 | 29698672 | 2018 | Selection and characterization, application of a DNA aptamer targeted to Streptococcus pyogenes in cooked chicken | S-28 | AGCAGCACAGAGGTCAGATG-TAATACTACCAACTTCTTTGCCTGGCGTAAGTAACAGTCA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Streptococcus Pyogenes (ATCC 49399) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect S. pyogenes in the cooked chicken. | N/A | 12 | Flow Cytometry | 132 ± 18 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1037 | 29698672 | 2018 | Selection and characterization, application of a DNA aptamer targeted to Streptococcus pyogenes in cooked chicken | S-32 | AGCAGCACAGAGGTCAGATG-TACACAATGCTTCGATAATTGACGCTACTTCATTTTATTA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Streptococcus Pyogenes (ATCC 49399) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect S. pyogenes in the cooked chicken. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1048 | 30685034 | 2018 | Selection of highly specific aptamers to Vibrio parahaemolyticus using cell-SELEX powered by functionalized graphene oxide and rolling circle amplification | Apt-2 | TCAGCACGT-ATAAGCATGAATTGACCAACCTAAACTTATTCATTTTCCAGCACCTCTAATATTACTGGC-TCCACTGAGAGATCC | 84 | 5'-TCAGCACGT-N60-TCCACTGAGAGATCC-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell (lipopolysaccharides (LPS) and Outer membrane protein (OMP) on V. parahaemolyticus cell surface) | Identify aptamers against a V. parahaemolyticus. | 75% binding affinity to V. parahaemolyticus than to other foodborne bacteria (less than 18%). | 8 | Flow Cytometry | 10.3 ± 4.5 nM | Detection | Advanced Cell-SELEX (with PC-GO and CRM-RCA) | 5ʹ-Phosphorylation or 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1049 | 30685034 | 2018 | Selection of highly specific aptamers to Vibrio parahaemolyticus using cell-SELEX powered by functionalized graphene oxide and rolling circle amplification | Apt-1 | TCAGCACGT-AGCCCTATTTGTTTTCTCTTGTCTCTGTACTGCTGATGTTGGTCATTCTCTTTTCTCGGT-TCCACTGAGAGATCC | 84 | 5'-TCAGCACGT-N60-TCCACTGAGAGATCC-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell (lipopolysaccharides (LPS) and Outer membrane protein (OMP) on V. parahaemolyticus cell surface) | Identify aptamers against a V. parahaemolyticus. | N/A | 8 | Flow Cytometry | 19.2 ± 2.8 nM | Detection | Advanced Cell-SELEX (with PC-GO and CRM-RCA) | 5ʹ-Phosphorylation or 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1050 | 30685034 | 2018 | Selection of highly specific aptamers to Vibrio parahaemolyticus using cell-SELEX powered by functionalized graphene oxide and rolling circle amplification | Apt-3 | TCAGCACGT-TATCTAGTCAGATATCCAGACAGTCGCGGCTGGAAGCTTCTGTTAAGAATTTGAGATACT-TCCACTGAGAGATCC | 84 | 5'-TCAGCACGT-N60-TCCACTGAGAGATCC-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell (lipopolysaccharides (LPS) and Outer membrane protein (OMP) on V. parahaemolyticus cell surface) | Identify aptamers against a V. parahaemolyticus. | N/A | 8 | Flow Cytometry | 25.2 ± 3.1 nM | Detection | Advanced Cell-SELEX (with PC-GO and CRM-RCA) | 5ʹ-Phosphorylation or 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1051 | 30685034 | 2018 | Selection of highly specific aptamers to Vibrio parahaemolyticus using cell-SELEX powered by functionalized graphene oxide and rolling circle amplification | Apt-4 | TCAGCACGT-GCGGGCATTATTGCACTCCACGGCGAGTAGTGCTCACAGAGTCATTTACACCGGTCGTAT-TCCACTGAGAGATCC | 84 | 5'-TCAGCACGT-N60-TCCACTGAGAGATCC-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell (lipopolysaccharides (LPS) and Outer membrane protein (OMP) on V. parahaemolyticus cell surface) | Identify aptamers against a V. parahaemolyticus. | N/A | 8 | Flow Cytometry | 17.2 ± 5.1 nM | Detection | Advanced Cell-SELEX (with PC-GO and CRM-RCA) | 5ʹ-Phosphorylation or 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1052 | 29756774 | 2018 | Selection, Identification, and Binding Mechanism Studies of an ssDNA Aptamer Targeted to Different Stages of E. coli O157:H7 | Apt-1 | TGAGCCCAAGCCCTGGTATG-TTACAGTATGCTACCTCTACTTGAAGGTTGGTCGACGCGG-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers that bind to different phases (adjustment phase, log phase, and stationary phase) of bacteria E. coli O157:H7 in the actual sample. | N/A | 14 | Flow Cytometry | 18.97 ± 1.73 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1053 | 29756774 | 2018 | Selection, Identification, and Binding Mechanism Studies of an ssDNA Aptamer Targeted to Different Stages of E. coli O157:H8 | Apt-2 | TGAGCCCAAGCCCTGGTATG-TGATCGGTGACGAGGGTGCGGGGCGGGGGGTGAGGCACAG-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers that bind to different phases (adjustment phase, log phase, and stationary phase) of bacteria E. coli O157:H7 in the actual sample. | N/A | 14 | Flow Cytometry | 20.73 ± 2.29 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1054 | 29756774 | 2018 | Selection, Identification, and Binding Mechanism Studies of an ssDNA Aptamer Targeted to Different Stages of E. coli O157:H9 | Apt-3 | TGAGCCCAAGCCCTGGTATG-TAGTAATGGTGCGTACAGGCGACGGGGTCCAGGCTGGAGG-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers that bind to different phases (adjustment phase, log phase, and stationary phase) of bacteria E. coli O157:H7 in the actual sample. | N/A | 14 | Flow Cytometry | 16.44 ± 2.16 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1055 | 29756774 | 2018 | Selection, Identification, and Binding Mechanism Studies of an ssDNA Aptamer Targeted to Different Stages of E. coli O157:H10 | Apt-4 | TGAGCCCAAGCCCTGGTATG-AGCCCACGGAACACTGGTCGCGCCCACTGGTTTCTATATT-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers that bind to different phases (adjustment phase, log phase, and stationary phase) of bacteria E. coli O157:H7 in the actual sample. | N/A | 14 | Flow Cytometry | 15.13 ± 0.88 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1057 | 29756774 | 2018 | Selection, Identification, and Binding Mechanism Studies of an ssDNA Aptamer Targeted to Different Stages of E. coli O157:H12 | Apt-6 | TGAGCCCAAGCCCTGGTATG-GTGTGCCTGTCGTTGTATTGGTCGGTAGGGATCGGAGTGG-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers that bind to different phases (adjustment phase, log phase, and stationary phase) of bacteria E. coli O157:H7 in the actual sample. | N/A | 14 | Flow Cytometry | 36.67 ± 4.55 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1058 | 29756774 | 2018 | Selection, Identification, and Binding Mechanism Studies of an ssDNA Aptamer Targeted to Different Stages of E. coli O157:H13 | Apt-7 | TGAGCCCAAGCCCTGGTATG-TGTGGGGTCCTGGATTATGTTTAGCGTCTTTCGCAGTGGG-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers that bind to different phases (adjustment phase, log phase, and stationary phase) of bacteria E. coli O157:H7 in the actual sample. | N/A | 14 | Flow Cytometry | 17.11 ± 0.31 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1059 | 29756774 | 2018 | Selection, Identification, and Binding Mechanism Studies of an ssDNA Aptamer Targeted to Different Stages of E. coli O157:H14 | Apt-8 | TGAGCCCAAGCCCTGGTATG-TCACATCCGGGTTCTTTGCGAACGCGTTTCCGCAGTCTCA-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers that bind to different phases (adjustment phase, log phase, and stationary phase) of bacteria E. coli O157:H7 in the actual sample. | N/A | 14 | Flow Cytometry | 24.68 ± 1.95 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1060 | 29756774 | 2018 | Selection, Identification, and Binding Mechanism Studies of an ssDNA Aptamer Targeted to Different Stages of E. coli O157:H15 | Apt-9 | TGAGCCCAAGCCCTGGTATG-TTGCGGGAGTCTAGCGGGCCACACTTTTATAGGTTCGCAG-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers that bind to different phases (adjustment phase, log phase, and stationary phase) of bacteria E. coli O157:H7 in the actual sample. | N/A | 14 | Flow Cytometry | 20.99 ± 0.37 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1061 | 30477331 | 2018 | Rapid selection of single-stranded DNA aptamers binding Staphylococcus epidermidis in platelet concentrates | SE40 | TACGACTCACTATAGGGATCC-ACCTATGGCAGATTGAGCCCAAGGGCTGTGCAGC-GAATTCCCTTTAGTGAGGGTT | 76 | 5'-TACGACTCACTATAGGGATCC-N34-GAATTCCCTTTAGTGAGGGTT-3' | ssDNA | Staphylococcus Epidermidis (ATCC 49134) | Whole cell | Identify aptamers that capture, detect or remove S. epidermidis contaminant from platelet concentrates. | N/A | 1 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Detection | Whole Cell RIDA | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1062 | 30477331 | 2018 | Rapid selection of single-stranded DNA aptamers binding Staphylococcus epidermidis in platelet concentrates | SE42 | TACGACTCACTATAGGGATCC-CCCCGAGTGAAGAGCAGGACAGCGGGACAGCGTC-GAATTCCCTTTAGTGAGGGTT | 76 | 5'-TACGACTCACTATAGGGATCC-N34-GAATTCCCTTTAGTGAGGGTT-3' | ssDNA | Staphylococcus Epidermidis (ATCC 49134) | Whole cell | Identify aptamers that capture, detect or remove S. epidermidis contaminant from platelet concentrates. | N/A | 1 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Detection | Whole Cell RIDA | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1063 | 30477331 | 2018 | Rapid selection of single-stranded DNA aptamers binding Staphylococcus epidermidis in platelet concentrates | SE43 | TACGACTCACTATAGGGATCC-GTGACTGTACGGGCTCAGTCGTTACTTGAGAGTT-GAATTCCCTTTAGTGAGGGTT | 76 | 5'-TACGACTCACTATAGGGATCC-N34-GAATTCCCTTTAGTGAGGGTT-3' | ssDNA | Staphylococcus Epidermidis (ATCC 49134) | Whole cell | Identify aptamers that capture, detect or remove S. epidermidis contaminant from platelet concentrates. | SE43 bound to bacteria was four times higher compared with scrambled control and background controls, and twofold higher in PBS. | 1 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Detection | Whole Cell RIDA | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1064 | 30477331 | 2018 | Rapid selection of single-stranded DNA aptamers binding Staphylococcus epidermidis in platelet concentrates | SE48 | TACGACTCACTATAGGGATCC-AATGGCACAGCGCCTGGAACGTACTCTGTACCTG-GAATTCCCTTTAGTGAGGGTT | 76 | 5'-TACGACTCACTATAGGGATCC-N34-GAATTCCCTTTAGTGAGGGTT-3' | ssDNA | Staphylococcus Epidermidis (ATCC 49134) | Whole cell | Identify aptamers that capture, detect or remove S. epidermidis contaminant from platelet concentrates. | N/A | 1 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Detection | Whole Cell RIDA | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1065 | 30477331 | 2018 | Rapid selection of single-stranded DNA aptamers binding Staphylococcus epidermidis in platelet concentrates | SE52 | TACGACTCACTATAGGGATCC-TTCGCATCCGGCACGATGGCTAGGACACCCCGAT-GAATTCCCTTTAGTGAGGGTT | 76 | 5'-TACGACTCACTATAGGGATCC-N34-GAATTCCCTTTAGTGAGGGTT-3' | ssDNA | Staphylococcus Epidermidis (ATCC 49134) | Whole cell | Identify aptamers that capture, detect or remove S. epidermidis contaminant from platelet concentrates. | N/A | 1 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Detection | Whole Cell RIDA | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1066 | 29896641 | 2018 | Aptamer based SERS detection of Salmonella typhimurium using DNA-assembled gold nanodimers | Aptamer (ssDNA1) | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Develop SERS-based aptasensor using DNA-assembled gold nanodimers (AuNDs) for detection of S. typhimurium. | Display a linear range in the 10(2) to 10(7) cfu/mL, and the limit of detection is 35 cfu/mL within 1hr. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1067 | 29242148 | 2018 | Whole-bacterium SELEX of DNA aptamers for rapid detection of E.coli O157:H7 using a QCM sensor | S1 | CAGTCCAGGACAGATTCGCGAG-TGGTCGTGGTGAGGTGCGTGTATGGGTGGTGGATGAGTGTGTGGC-CACGTGGATTTCATTCAGCGATT | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-N45-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 43888) | Whole cell | Identify aptamers specifically bound to Escherichia coli O157:H7 and develop a QCM-based aptasensor for its detection. | The limit of detection (LOD) was 1.46 × 10^3 CFU/mL, with a total detection time of 50 minutes. | 19 | Quartz Crystal Microbalance (QCM) | 10.30 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1068 | 29242148 | 2018 | Whole-bacterium SELEX of DNA aptamers for rapid detection of E.coli O157:H7 using a QCM sensor | S2 | CAGTCCAGGACAGATTCGCGAG-GCGGGAATAGGATGCGGCTGGAAGGAGAGGTGTTGGTGGGTGGTG-CACGTGGATTTCATTCAGCGATT | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-N45-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 43888) | Whole cell | Identify aptamers specifically bound to Escherichia coli O157:H7 and develop a QCM-based aptasensor for its detection. | N/A | 19 | Quartz Crystal Microbalance (QCM) | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1069 | 29242148 | 2018 | Whole-bacterium SELEX of DNA aptamers for rapid detection of E.coli O157:H7 using a QCM sensor | S3 | CAGTCCAGGACAGATTCGCGAG-GTGCGGTGACGTGAGGGGGAGAGGCGTTGGTGTAGGCTGTTGGTG-CACGTGGATTTCATTCAGCGATT | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-N45-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 43888) | Whole cell | Identify aptamers specifically bound to Escherichia coli O157:H7 and develop a QCM-based aptasensor for its detection. | N/A | 19 | Quartz Crystal Microbalance (QCM) | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1071 | 29766180 | 2018 | A nitrocellulose membrane-based integrated microfluidic system for bacterial detection utilizing magnetic-composite membrane microdevices and bacteria-specific aptamers | Aptamer | ACAGCACCACAGACCACATATCACATGCTGTCGCCTTGCGATATCAATTCCAGTGATGTTTGTCTTCCTGCC | 72 | N/A | ssDNA | Acinetobacter Baumannii | Whole cell | A nitrocellulose membrane-based integrated microfluidic system for detecting bacteria. | Display a limit of detection as low as 450 CFU/reaction for AB within 40 minutes and a linear range from 4.5×10(4) to 4.5 CFU/reaction. | N/A | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1072 | 30014163 | 2018 | Selective capture and sensitive fluorometric determination of Pseudomonas aeruginosa by using aptamer modified magnetic nanoparticles | P. aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa | Whole cell | A fluorometric assay for the detection of the food pathogen P. aeruginosa based on hybridization of aptamer and FAM-cDNA (aptamer&FAM-cDNA@MNPs). | Display a linear range between 10 and 10(8) cfu/mL, with a detection limit as low as 1 cfu/mL. The detection process can be finished within <1.5 h. | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1073 | 29260861 | 2018 | Whole-Cell Pseudomonas aeruginosa Localized Surface Plasmon Resonance Aptasensor | Bt-aptamer | ATACCAGCTTATTCAATTCCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTGAGATAGTAAGTGCAATCT | 96 | N/A | ssDNA | Pseudomonas Aeruginosa PAO1 | Whole cell | A localized surface plasmon resonance (LSPR) based sensing platform was developed to detect the whole-cell Pseudomonas aeruginosa strain PAO1. | Achieve a limit of detection (LOD) of 10 cfu/mL with a linear range of 10(0)–10(3) cfu/mL. | N/A | N/A | 17.27 ± 5.00 nM | Biosensor | Whole Cell-SELEX | 5′-Biotinylated Polyethene Glycol (Bt-PEG) thiol/PEG thiol (1:3) or 5'-6FAM-aptamer-Biotin-3' | N/A | Stable in ambient conditions for ≥2 months. | N/A | N/A | N/A |
| ABdb_1074 | 30247907 | 2018 | Graphene Oxide Quantum Dots Assisted Construction of Fluorescent Aptasensor for Rapid Detection of Pseudomonas aeruginosa in Food Samples | P.aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 15442) | Whole cell | Develop a fluorescent aptasensor based on DNA hybridization and fluorescence resonance energy transfer for the detection of P. aeruginosa. | Shows a wide linear range of 1.28 × 10(3)-2.00 × 10(7) cfu/mL with a detection limit of 100 cfu/mL within 2 h. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1075 | 35547676 | 2018 | Development of a fluorescence assay for highly sensitive detection of Pseudomonas aeruginosa based on an aptamer-carbon dots/graphene oxide system | PA1 | TGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGACGTGACCGCTGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGAC | 84 | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify and develop an aptamer-based fluorescence assay (aptamer-CDs/GO system) for culture-independent detection of P. aeruginosa. | Achieved a wide detection range from 10(1) to 10(7) CFU/mL with a detection limit as low as 9 CFU/mL. | 12 | N/A | 15.16 ± 3.62 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1076 | 35547676 | 2018 | Development of a fluorescence assay for highly sensitive detection of Pseudomonas aeruginosa based on an aptamer-carbon dots/graphene oxide system | PA2 | TGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGACGTGACCGTTGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGAC | 84 | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify and develop an aptamer-based fluorescence assay (aptamer-CDs/GO system) for culture-independent detection of P. aeruginosa. | N/A | 12 | N/A | 14.11 ± 2.59 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1077 | 35547676 | 2018 | Development of a fluorescence assay for highly sensitive detection of Pseudomonas aeruginosa based on an aptamer-carbon dots/graphene oxide system | PA3 | TGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGACACGACGCATGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGAC | 84 | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify and develop an aptamer-based fluorescence assay (aptamer-CDs/GO system) for culture-independent detection of P. aeruginosa. | N/A | 12 | N/A | 32.59 ± 8.89 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1078 | 35547676 | 2018 | Development of a fluorescence assay for highly sensitive detection of Pseudomonas aeruginosa based on an aptamer-carbon dots/graphene oxide system | PA4 | TGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGACGCACGTTGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGAC | 82 | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify and develop an aptamer-based fluorescence assay (aptamer-CDs/GO system) for culture-independent detection of P. aeruginosa. | N/A | 12 | N/A | 16.39 ± 8.14 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1079 | 35547676 | 2018 | Development of a fluorescence assay for highly sensitive detection of Pseudomonas aeruginosa based on an aptamer-carbon dots/graphene oxide system | PA5 | TGGACCTTGCGATTGACAGCTCGTGGCACGTGCCGCTCGCCTTGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGAC | 80 | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify and develop an aptamer-based fluorescence assay (aptamer-CDs/GO system) for culture-independent detection of P. aeruginosa. | N/A | 12 | N/A | 30.69 ± 7.15 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1080 | https://doi.org/10.1002/slct.201801008 | 2018 | Exploiting Stokes and anti-Stokes type emission profiles of aptamer-functionalized luminescent nanoprobes for multiplex sensing applications | S. aureus aptamer | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTCCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Aptamer-functionalized QD and UCNP nanoprobes conjugated with partially complementary DNA-modified magnetic beads for separation of different bacteria. | The limit of detection was 15 cfu/mL for S. aureus with a linear range from 10(2)-10(6) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1081 | https://doi.org/10.1002/slct.201801008 | 2018 | Exploiting Stokes and anti-Stokes type emission profiles of aptamer-functionalized luminescent nanoprobes for multiplex sensing applications | L. monocytogenes aptamer | TACTATCGCGGAGACAGCGCGGGAGGCACCGGGGA | 35 | N/A | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | aptamer-functionalized QD and UCNP nanoprobes that were conjugated with partially complementary DNA-modified magnetic beads for separation. | The limit of detection was 28 cfu/mL for L. monocytogenes with a linear range from 10(2)-10(6) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1082 | https://doi.org/10.1002/slct.201801008 | 2018 | Exploiting Stokes and anti-Stokes type emission profiles of aptamer-functionalized luminescent nanoprobes for multiplex sensing applications | P. aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | aptamer-functionalized QD and UCNP nanoprobes that were conjugated with partially complementary DNA-modified magnetic beads for separation. | The limit of detection was 25 cfu/mL for P. aeruginosa with a linear range from 10(2)-10(6) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1083 | https://doi.org/10.1002/slct.201801008 | 2018 | Exploiting Stokes and anti-Stokes type emission profiles of aptamer-functionalized luminescent nanoprobes for multiplex sensing applications | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | aptamer-functionalized QD and UCNP nanoprobes that were conjugated with partially complementary DNA-modified magnetic beads for separation. | The limit of detection was 12 cfu/mL for S. typhimurium with a linear range from 10(2)-10(6) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1084 | 29729642 | 2018 | Design and fabrication of an electrochemical aptasensor using Au nanoparticles/carbon nanoparticles/cellulose nanofibers nanocomposite for rapid and sensitive detection of Staphylococcus aureus | Staphylococcus aureus aptamer | TCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTC | 46 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed an impedimetric aptasensor using AuNPs/CNPs/CNFs nanocomposites for the rapid detection of S. aureus. | Exhibited a wide linear dynamic range 1.2 × 10(1) to 1.2 × 10(8) CFU/mL with a LOD of 1 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1095 | 29553704 | 2018 | Aptamer-Based Paper Strip Sensor for Detecting Vibrio fischeri | VFCA-01 | ATACCAGCTTATTCAATT-GGTCGTGTGGACTTGCGATTTCGGTTTGGTGTGGTTGGTG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Fischeri (ATCC 49387) | Whole cell | Identify aptamers against Vibrio fischeri and develop an aptamer-based paper strip sensor for its detection. | N/A | 9 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1096 | 29553704 | 2018 | Aptamer-Based Paper Strip Sensor for Detecting Vibrio fischeri | VFCA-02 | ATACCAGCTTATTCAATT-GGGCATGTGGACTTGCGATTTCGGTTTGGTGTGGTTGGGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Fischeri (ATCC 49387) | Whole cell | Identify aptamers against Vibrio fischeri and develop an aptamer-based paper strip sensor for its detection. | VFCA-02 and VFCA-03 was linear in the range of 4 × 10(1) to 4 × 10(5) CFU/mL of target cell. | 9 | Surface Plasmon Resonance (SPR) | 1.28 × 10(-10) M | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1097 | 29553704 | 2018 | Aptamer-Based Paper Strip Sensor for Detecting Vibrio fischeri | VFCA-03 | ATACCAGCTTATTCAATT-GGGCATGTGGGCTTGCGATTTCGGTTTGGTGTGGTTGGGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Fischeri (ATCC 49387) | Whole cell | Identify aptamers against Vibrio fischeri and develop an aptamer-based paper strip sensor for its detection. | VFCA-02 and VFCA-03 was linear in the range of 4 × 10(1) to 4 × 10(5) CFU/mL of target cell. | 9 | Surface Plasmon Resonance (SPR) | 1.25 × 10(-9) M | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1098 | 29553704 | 2018 | Aptamer-Based Paper Strip Sensor for Detecting Vibrio fischeri | VFCA-04 | ATACCAGCTTATTCAATT-TGGCATGTGGACTTGCGATTTCGGTTTGGTGTGGTTGGGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Fischeri (ATCC 49387) | Whole cell | Identify aptamers against Vibrio fischeri and develop an aptamer-based paper strip sensor for its detection. | N/A | 9 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1099 | 29553704 | 2018 | Aptamer-Based Paper Strip Sensor for Detecting Vibrio fischeri | VFCA-05 | ATACCAGCTTATTCAATT-GGGCATGTGGACTTGCGGTTTCGGTTTGGTGTGGTTGGGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Fischeri (ATCC 49387) | Whole cell | Identify aptamers against Vibrio fischeri and develop an aptamer-based paper strip sensor for its detection. | N/A | 9 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1100 | 29553704 | 2018 | Aptamer-Based Paper Strip Sensor for Detecting Vibrio fischeri | VFCA-06 | ATACCAGCTTATTCAATT-GGGCGTGTGGACTTGCGATTTCGGTTTGGTGTGGTTGGGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Fischeri (ATCC 49387) | Whole cell | Identify aptamers against Vibrio fischeri and develop an aptamer-based paper strip sensor for its detection. | N/A | 9 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1101 | 29553704 | 2018 | Aptamer-Based Paper Strip Sensor for Detecting Vibrio fischeri | VFCA-07 | ATACCAGCTTATTCAATT-GGGCATGTGGACTTGCGATTTCGGTTGGTGTGGTTGGGG-AGATAGTAAGTGCAATCT | 75 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Fischeri (ATCC 49387) | Whole cell | Identify aptamers against Vibrio fischeri and develop an aptamer-based paper strip sensor for its detection. | N/A | 9 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1102 | 29553704 | 2018 | Aptamer-Based Paper Strip Sensor for Detecting Vibrio fischeri | VFCA-08 | ATACCAGCTTATTCAATT-GGGCATGTGGACTTGCGACTTCGGTTTGGTGTGGTTGGGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Fischeri (ATCC 49387) | Whole cell | Identify aptamers against Vibrio fischeri and develop an aptamer-based paper strip sensor for its detection. | N/A | 9 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1103 | 29553704 | 2018 | Aptamer-Based Paper Strip Sensor for Detecting Vibrio fischeri | VFCA-09 | ATACCAGCTTATTCAATT-AGACAGCATAGCACTGTAACGATTGGTTTGGTGTGGTTGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Fischeri (ATCC 49387) | Whole cell | Identify aptamers against Vibrio fischeri and develop an aptamer-based paper strip sensor for its detection. | N/A | 9 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1104 | 29553704 | 2018 | Aptamer-Based Paper Strip Sensor for Detecting Vibrio fischeri | VFCA-10 | ATACCAGCTTATTCAATT-CCAGAATTGGTGGGTCGACTGCTGGTGTCCTATAAAGGGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Fischeri (ATCC 49387) | Whole cell | Identify aptamers against Vibrio fischeri and develop an aptamer-based paper strip sensor for its detection. | N/A | 9 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1105 | 29553704 | 2018 | Aptamer-Based Paper Strip Sensor for Detecting Vibrio fischeri | VFCA-11 | ATACCAGCTTATTCAATT-CGTGGGCGGTAGAGCCAATGCTACTGGAGCGCGTATCCTA-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Fischeri (ATCC 49387) | Whole cell | Identify aptamers against Vibrio fischeri and develop an aptamer-based paper strip sensor for its detection. | N/A | 9 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1106 | 29553704 | 2018 | Aptamer-Based Paper Strip Sensor for Detecting Vibrio fischeri | VFCA-12 | ATACCAGCTTATTCAATT-GTCGGAGAGCCCGGCCGTCTGCTCGTAAGTACTATCATAGC-AGATAGTAAGTGCAATCT | 77 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Fischeri (ATCC 49387) | Whole cell | Identify aptamers against Vibrio fischeri and develop an aptamer-based paper strip sensor for its detection. | N/A | 9 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1107 | 29553704 | 2018 | Aptamer-Based Paper Strip Sensor for Detecting Vibrio fischeri | VFCA-13 | ATACCAGCTTATTCAATT-GCGGACGGATAGTAAATAGCCCATGTACGCTGCTGGCGTC-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Fischeri (ATCC 49387) | Whole cell | Identify aptamers against Vibrio fischeri and develop an aptamer-based paper strip sensor for its detection. | N/A | 9 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1108 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt1 | AGGGTTGGTCGTCCAGCATTCCGTTCGATTGTAGTTCTGACTCTTGTGAAGTTAATGAGCTCCTTTTGCTGACTGTTGTT | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1109 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt2 | TTCTGATGAGAGTTGCGACCTCCCGGATGAGTGCCCTGGCTCCGGGTTTGTCTATTTTTGGGGGTGTTGACAGATATCCT | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | Vapt2 could detect the pathogen in a wide concentration range: 8–2.0 × 10^8 cfu/ml.The Limit of Detection (LOD) was 8 cfu/ml. | 13 | Fluorescence Microscopy | 26.8 ± 5.3 nM | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1110 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt3 | ATCGGATATGAGGCCGGGTATTAAGTGGGGTTCCATATGCAAGGCAGATCTCCCAGTGTTTTTTCAGGATTGCGTTACTG | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1111 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt4 | AAGAGGGCTTGGGAACTCTAGGCGTCTGTGCATTAAGCCATGTCTGCCGGGAAAGATCTGTGAAGTGTTCGCCCGCACTT | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1112 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt5 | GCATGGGTATAGGGAAACCCGAGTCTAGTTTACACTGACGTTAGGAGATTACGTCTGCCGACAGAACATTCTCTCTGTGA | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1113 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt6 | GGCGGGGTGTTATGAATCCACCGCGATCCGTTATGTTAGGCTGTAATCATTAAGCACTTTATGTGCACTCGTGGTATGCC | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1114 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt7 | AATTACTGGAGCTTGGCCGTAGGTAGAAAGATTTGCATTATACCTGGGGGGCTCTCTGGTTGTGTTTAATTGGTTACCCC | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1115 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt8 | ATGCTGCACTAGTTACCTTGCCTTTGCTTTCTTATTCTGCTCGTGCGTAAAAGTGGTTTTTCTTGCGTTGCGGGTGCTTG | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1116 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt9 | TGTTCGTTCGACTTCTCCGTCGTTTTTGTATTAACGTAGACCTTGGTTGAGCATGCTTACCTCTGCTTGGATTAATGACG | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1117 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt10 | TAAGGATCTTGGGTTCATGCCGCAACTGGGATGTTTGCTGCCTCCTTTATGGAGCTTAGCTGCGAGCGTTCTTGTTTGGT | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1118 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt11 | GTCTAAGTGCTTCTAGGCGGATTTGGCGCGTTCCGACGATTAGACTAGGACAACGATTCAGTGGTGTCGATGGTGTGTTC | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1119 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt12 | GGGGTAAGCCCGCGGCTCTCTCCTATGTATTCAGTGTACTCACGAAGATGTCCGTACTCCGTACGCTGCTATGCGTTCCC | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1120 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt13 | TCGGGGGCGCAGCTTGGGCCGTTGCTCCTGCCGGTCTCTGTGTGCGTGCGGTTCTCGCTCTTGTGGCTCCGTCCTTGGGG | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1124 | 29870692 | 2018 | Carbon nanotube-based aptasensor for sensitive electrochemical detection of whole-cell Salmonella | Salmonella aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Developed an amino-modified aptasensor using MWCNTs-deposited ITO electrode for the detection of Salmonella. | It possesses a linear range from 10 mV/s to 90 mV /s, and the detection limit was 5.5 × 10(1) cfu/mL and 6.7 × 10(1) cfu/mL for S. Enteritidis and S. Typhimurium, respectively. | N/A | N/A | N/A | Biosensor | N/A | Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1125 | 33418673 | 2018 | Fast and Sensitive Detection of Salmonella in Milk Samples Using Aptamer-Functionalized Magnetic Silica Solid Phase and MCM-41-Aptamer Gate System | S. enterica specific aptamer | TATGGCGGCGTCACCCGACGGGGACTT | 27 | N/A | ssDNA | Salmonella Enterica | Whole cell | Developed an aptamer-gated MCM-41 silica system (Fe3O4@SiO2@pGMA and MCM-41 particles) to detect S. enterica in food samples. | The linear range is from 2000 CFU/mL to 104 CFU/mL in milk, with the LOD of 2336 cells. | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1126 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S1 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-TGCTGGTGGCCATTGGCTCGTGTCTCGTTACTGCCGAGTG-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | Exhibited a linear concentration ranging from 2×10(1) to 2×10(5) CFU/mL and LOD of 20 CFU/mL. | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1127 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S2 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-GGAATGACCTGGATTGACCCGTGAGTGTAGCATTTGTCCG-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1128 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S3 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-TTGACGATACGCAGGGGCGATACAGACAGTCTGCGTATTC-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1129 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S4 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-CTGTATCCCTCCTCGCTTCCATACCCAAACCGGACACACC-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1130 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S5 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-CTGCATGCACCTCACGCATCGAGCACTCACTCCTTCTACG-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1131 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S6 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-CCTCCCGAGGACACACACACACCATCGCGGTACTCTCCCG-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1132 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S7 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-GCGCACCTCCGCCCTGTCGGGCGTCGTTTCCCCACGAATC-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1133 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S8 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-GTTTCCGTATGCGCAGCGCCATACACCTGTCTGATCTCCCC-AGATAGTAAGTGCAATCT | 101 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1134 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S9 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-TGTCGCAAGGACTCGATCTGGTGGTACCTGCTTTCCGTTG-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1135 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S10 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-TGAGCACCAAGGATAGTTAGCGGTCGCCTTCACACTAGGC-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1136 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S11 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-CTGACAGATTAAAAGTGGTTGGGCAACTTCTGCTTGCGAA-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | 4.41 × 10(-12) M | Detection | Whole Cell-SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1137 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S12 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-GGTGGTGTTGACAATTGAACCTTTGCAGGGGTCTGGTGGG-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1138 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S13 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-GTGGAGGTGCGCTATAGGTCTCTCCGGGTACTGATCCAAT-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1139 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S14 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-CCGACCCGTAACGCCAGTGAGGGAACACTCTGGAATAGTT-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1140 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S15 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-CGAGCAAACTGATAAACTCCGCCATGTCAGGCAAAGCTTT-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1141 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S16 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-CTTCGTTCCGTTGACATAATTCAATTTTGCGTATTTCTTG-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1142 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S17 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-ATGGGGCTAGTCTACTTCTGTGTCTACCTAGGATTCCGCT-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1143 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S18 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-TGTAGGCGTAACCTCCTACTCTGTGCACTGTCTAAAGTGAC-AGATAGTAAGTGCAATCT | 101 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1144 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S19 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-CGCGGCGTACGCTATCTTGTAACCTCCCGAACTATAACCAC-AGATAGTAAGTGCAATCT | 101 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1145 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S20 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-CAAGCGACTCGACCGTGGTACCTCCCCAATAGCCATTTGA-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1146 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S21 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-TCTCGCAGCCTCTTCCAATCTTGTTATTTACGCTTTCTGT-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1147 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S22 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-CACAAAGGAGCAAGAACTCAATTGCGCTCGTACCTTGTGG-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1148 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S23 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-GTAGCTGGGGTCCGGATCTGCGGTTCAGTGCGCTATTGTG-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1149 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S24 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-TGACGGCTATCTCATTTGGCACATCATTTAGTAAGCTATC-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | 3.75 ×10(-3) M | Detection | Whole Cell-SELEX | 5'-Cyanine5 (Cy5) Labeled or 5′-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1150 | 29550346 | 2018 | An aptasensor for staphylococcus aureus based on nicking enzyme amplification reaction and rolling circle amplification | Aptamer | TCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGT | 45 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | A chemiluminescence aptasensor for S. aureus detection based on aptamer recognition and the DNA amplification cycle (NEAR-RCA) was developed. | Detect S. aureus specifically with a good linear correlation at 5-10(4) CFU/mL and limit of detection (LoD) of 5 CFU/mL. | N/A | N/A | 210.70 ± 135.91 nM | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1151 | 29777309 | 2018 | Fluorometric determination of Vibrio parahaemolyticus using an F0F1-ATPase-based aptamer and labeled chromatophores | V. parahaemolyticus aptamer | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed an F0F1-ATPase-based aptasensor for the fluorometric determination of V. parahaemolyticus. | The relative fluorescence varies linearly over the 15 to 1.5 × 10(6) cfu/mL Vibrio parahaemolyticus concentration range, and the limit of detection is 15 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1152 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#1 | ATACCAGCTTATTCAATT-CCATGGTCCCTCGTGTTTATTATGTTGTCTGAACTGGCTG-AGATTGCACTTACTATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | VPCAapta#1 was significantly higher (798.41 ng/ul) than that of the other aptamer. | 11 | Surface Plasmon Resonance (SPR) | 2.04 ± 0.12 nM | Diagnostic | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1153 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#2 | ATACCAGCTTATTCAATT-CCACGTTTCCACGTATCCTCGGAGCTTGCTTAACCGTACG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1154 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#3 | ATACCAGCTTATTCAATT-TGCGTAGTTCTTTTAACAACCATTCAGCGTATTTTCGTGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1155 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#4 | ATACCAGCTTATTCAATT-CCCTCGGCGTAACTAGTACCGTTGCACCACCAACGTGATT-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1156 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#5 | ATACCAGCTTATTCAATT-CGCAAGGGATTTCGGACCGGGCTTGGTCACACACAGAGCA-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1157 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#6 | ATACCAGCTTATTCAATT-CCAGCAGTGGGGCATGGGGGAACGATAAGATTATAAGGGGG-AGATAGTAAGTGCAATCT | 77 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1158 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#7 | ATACCAGCTTATTCAATT-CACGCAAGCAGAAGCCACTCCCCCTGGTCGTACTATTTAG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1159 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#8 | ATACCAGCTTATTCAATT-CACAGGCGTACCACTGCCCCAACGATCCTTTTGGTTACCG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1160 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#9 | ATACCAGCTTATTCAATT-GTCGGAGAGCCTGGCCGTCTGCTCGTAAGTACTATCATAGC-AGATAGTAAGTGCAATCT | 77 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1161 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#10 | ATACCAGCTTATTCAATT-TGGAGAAGCGGCAGTTGATGCCTGGTACCCGTCTGCTACG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1162 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#11 | ATACCAGCTTATTCAATT-CGTAAAGGACGCTGCCATGAATGTGCTATCCAAGCCTGGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1163 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#12 | ATACCAGCTTATTCAATT-CGTAAAGAACGCTGCCATGAATGTGCTATCCAAGCCTGGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1164 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#13 | ATACCAGCTTATTCAATT-CGTAAGAACGCTGCCATGAATGTGCTATCCAGGCCTGGG-AGATAGTAAGTGCAATCT | 75 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1165 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#14 | ATACCAGCTTATTCAATT-CAACGGAGGGAAGTTTCCATGTCCGGTACCAAGCGGTTTTTG-AGATAGTAAGTGCAATCT | 78 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1166 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#15 | ATACCAGCTTATTCAATT-GCACGGGAGGCACCCTGACATTGCAAATCCCATCGGTGTG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1167 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#16 | ATACCAGCTTATTCAATT-ACCTATAACAGCCATCATACGAGGTAATCCCCTCCCTCGA-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1168 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#17 | ATACCAGCTTATTCAATT-CCAACTGGATCTTACTGAGGAACGGTCCATTAGCACATCG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1169 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#18 | ATACCAGCTTATTCAATT-CGCGACCACATCCTGCGTAAACACATCTCCGCCAGTCCAT-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1170 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#19 | ATACCAGCTTATTCAATT-CGCAAGAGCAGCATACAGCACGAACGAGCCATTTACGCCA-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1171 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#20 | ATACCAGCTTATTCAATT-CGAAGACCAGACATGGTAGCCACGCATAGTCCAACTTAAG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1172 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#21 | ATACCAGCTTATTCAATT-ACACCACACTAATGCATGCATTCTGTGAGTCACAGTTCA-AGATAGTAAGTGCAATCT | 75 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1173 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#22 | ATACCAGCTTATTCAATT-CACTCAAACCCAAACCATGCAAACTGAACAACGCAACACA-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1174 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#23 | ATACCAGCTTATTCAATT-CACCAAACTGCCCAAATTTGAGGACGCCCTATACATGCG-AGATAGTAAGTGCAATCT | 75 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1175 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#24 | ATACCAGCTTATTCAATT-GCCCAATACGTATGTTGATACATGCCCCTTACCCTTTGCG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1176 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#25 | ATACCAGCTTATTCAATT-CACCGTAGTAAGTAAGCAGACGCTAAGGATGTTGCCAGTG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1177 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#26 | ATACCAGCTTATTCAATT-GTGACATGAACTGGTTTTCCACAGCTTAGGATCATGGATG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1178 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#27 | ATACCAGCTTATTCAATT-GGGCATGTGGGCTTGCGATTTCGGTTTGGTGTGGTTGGGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1179 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#28 | ATACCAGCTTATTCAATT-CCGTCGCTATAACCCTGTCTTTATATATCTTCGCCCACGGG-AGATAGTAAGTGCAATCT | 77 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1180 | 32254837 | 2018 | Sensitive and specific detection of clinical bacteria via vancomycin-modified Fe3O4@Au nanoparticles and aptamer-functionalized SERS tags | Sa1 | GCAATGGTACGGTACTTCCACTTAGGTCGAGGTTAGTTTGTCTTGCTGGCGCATCCACTGAGCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Develop a dual-recognition SERS platform using vancomycin-modified Fe3O4@Au magnetic nanoparticles (Fe3O4@Au-Van MNPs) for the detection of E. coli and S. aureus. | The LOD of the platform was 20 cells/mL for S. aureus, with a capture efficiency of up to 88.89% within 15 min. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1181 | 32254837 | 2018 | Sensitive and specific detection of clinical bacteria via vancomycin-modified Fe3O4@Au nanoparticles and aptamer-functionalized SERS tags | E1 | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Develop a dual-recognition SERS platform using vancomycin-modified Fe3O4@Au magnetic nanoparticles (Fe3O4@Au-Van MNPs) for the detection of E. coli and S. aureus. | The LOD of the platform was 50 cells/mL for E. coli, and capture efficiency reached 74.96% within 15 min. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) and 5'-Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1182 | 29901674 | 2018 | Aptamer immobilization on amino-functionalized metal-organic frameworks: an ultrasensitive platform for the electrochemical diagnostic of Escherichia coli O157:H7 | E.coli aptamer | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Electrochemical biosensor based on amino-functionalized metal-organic frameworks (MOFs) for detection of Escherichia coli O157:H7. | Display linear range of 2.1×10(1) to 2.1×10(7) CFU/mL with a LOQ of 21 CFU/mL and LOD of 2 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1193 | 29907294 | 2018 | New colorimetric aptasensor for rapid on-site detection of Campylobacter jejuni and Campylobacter coli in chicken carcass samples | ONS-23TA | ACAAGGGACAGTAGACCAACAGGAAATCAAAGGCCGTGGGAA | 42 | N/A | ssDNA | Campylobacter Jejuni (ATCC 33560, NCTC11168, 2 human isolates, and 3 food isolates) | Whole cell | A 2-stage label-free aptasensing platform was developed to detect C. jejuni and C. coli. | Detection limit (LOD) of 7.2×10^5 CFU/mL and linear range from 10(5) to 10(8) CFU/mL for C. jejuni. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1194 | 29907294 | 2018 | New colorimetric aptasensor for rapid on-site detection of Campylobacter jejuni and Campylobacter coli in chicken carcass samples | ONS-23TA | ACAAGGGACAGTAGACCAACAGGAAATCAAAGGCCGTGGGAA | 42 | N/A | ssDNA | Campylobacter Coli (ATCC 33559 and 3 food isolates) | Whole cell | Aptamers normally adsorb to gold nanoparticles (AuNPs) to protect them from salt-induced aggregation. | Detection limit (LOD) of 5.6×10^5 CFU/mL with a strong correlation (from 10(5) to 10(8) CFU/mL) for C. coli. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1196 | 30081031 | 2018 | Label-free aptasensors based on fluorescent screening assays for the detection of Salmonella typhimurium | S. typhimurium binding Aptamer (Apt1) | CCAAAGGCTACGCGTTAACGTGGTGTTGG | 29 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (MTCC 3232) | Whole cell | A label-free fluorescent aptasensor was developed for the detection of Salmonella typhimurium using SYBR Green I. | Achieved a linear range of approximately 1530-96938 CFU/mL and a detection limit of 733 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1197 | 30081031 | 2018 | Label-free aptasensors based on fluorescent screening assays for the detection of Salmonella typhimurium | S. typhimurium binding Aptamer (Apt2) | ATAGGAGTCACGACGACCAGAAAGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGATATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (MTCC 3232) | Whole cell | An aptasensor based on FRET between Rhodamine B and gold nanoparticles for the detection of Salmonella typhimurium was developed. | Achieved concentrations ranging from 1530 to 96938 CFU/mL, with a detection limit of 464 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1198 | 30359519 | 2018 | Ω-Shaped Fiber-Optic Probe-Based Localized Surface Plasmon Resonance Biosensor for Real-Time Detection of Salmonella Typhimurium | Aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed an aptamer-immobilized Ω-shaped fiber-optic localized surface plasmon resonance (FOLSPR) biosensor for S. Typhimurium detection. | Achieved high detection sensitivity for S. Typhimurium down to 128 CFU/mL within a linear range from 5 × 10(2) to 1 × 10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1199 | https://doi.org/10.1016/j.snb.2017.08.160 | 2018 | Nanoporous gold as a suitable substrate for preparation of a new sensitive electrochemical aptasensor for detection of Salmonella typhimurium | Anti-S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Developed a label-free electrochemical aptasensor based on nanoporous gold (NPG/Au/GCE) for the detection of Salmonella typhimurium. | Capable of detecting S. typhimurium in a wide linear dynamic range 6.5 × 10(2) to 6.5 × 10(8) CFU/mL with a LOD of 1 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1201 | 30001487 | 2018 | Magnetism-Resolved Separation and Fluorescence Quantification for Near-Simultaneous Detection of Multiple Pathogens | E. coli aptamer | ATCCGTCACACCTGCTCTATCAAATGTGCAGATATCAAGACGATTTGTACAAGATGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (CICC 21530) | Whole cell | Aptamer-modified fluorescent-magnetic multifunctional nanoprobes (apt-FMNPs) for near-simultaneous detection of multiple pathogens. | The detection limits were 100 cfu/mL in milk, 80 cfu/mL in human serum, and 80 cfu/mL in human urine for E. coli. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated and 3'-Cyanine3 (Cy3) Labeled | Bacterial viability remained about 100% during incubation with apt-FMNPs nanoprobes at successive incubation time points of 0, 0.5, 1, 3, 6, 12, and 18 h. | N/A | N/A | N/A | N/A |
| ABdb_1202 | 30001487 | 2018 | Magnetism-Resolved Separation and Fluorescence Quantification for Near-Simultaneous Detection of Multiple Pathogens | S. typ aptamer | ATAGGAGTCACGACGACCAGAAAGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGATATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Aptamer-modified fluorescent-magnetic multifunctional nanoprobes (apt-FMNPs) for near-simultaneous detection of multiple pathogens. | The detection limits of 150 cfu/mL in milk, 120 cfu/mL in human serum, and 120 cfu/mL in human urine for S. typ. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated and 3'-FAM Labeled | Bacterial viability remained about 100% during incubation with apt-FMNPs nanoprobes at successive incubation time points of 0, 0.5, 1, 3, 6, 12, and 18 h. | N/A | N/A | N/A | N/A |
| ABdb_1214 | 31704587 | 2019 | Theranostic Application of a Novel G-Quadruplex-Forming DNA Aptamer Targeting Malate Synthase of Mycobacterium tuberculosis | MS10-Trunc | GGTGGTGGTGG | 11 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) | Surface-associated Malate synthase (MS -Whole cells) | Identify aptamers that bind to and inhibit the MS enzyme activity, thereby blocking bacterial entry into host cells. | Inhibited MS activity with an IC₅₀ of 251.1 nM; Ki of 230 nM; inhibited M. tb invasion into human THP-1 monocytic cells. | 10 | Surface Plasmon Resonance (SPR) | 1.9 × 10−11 M | Therapeutics | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | Indian Patent application no. 201611021901 |
| ABdb_1215 | 31704587 | 2019 | Theranostic Application of a Novel G-Quadruplex-Forming DNA Aptamer Targeting Malate Synthase of Mycobacterium tuberculosis | MS4 | GGACCAGGTGAGTGGATGCGGGTGCGGGTGGGGGTGAGGGGGGG | 44 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) | Surface-associated Malate synthase (MS -Whole cells) | Identify aptamers that bind to and inhibit the MS enzyme activity, thereby blocking bacterial entry into host cells. | Inhibition of MS activity, the aptamers were ranked as MS10 (IC50 of 275.6 nM, Ki of 270 nM) > MS5 > MS20 > MS4 > MS6. | 10 | Surface Plasmon Resonance (SPR) | 9.9 × 10−9 M | Therapeutics | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1216 | 31704587 | 2019 | Theranostic Application of a Novel G-Quadruplex-Forming DNA Aptamer Targeting Malate Synthase of Mycobacterium tuberculosis | MS5 | GCAGAGAGAGAGAAAGTGAGAAGGGCGGGGGGGAGAGGGTGGGG | 44 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) | Surface-associated Malate synthase (MS -Whole cells) | Identify aptamers that bind to and inhibit the MS enzyme activity, thereby blocking bacterial entry into host cells. | Inhibition of MS activity, the aptamers were ranked as MS10 (IC50 of 275.6 nM, Ki of 270 nM) > MS5 > MS20 > MS4 > MS6. | 10 | Surface Plasmon Resonance (SPR) | 2.7 × 10−6 M | Therapeutics | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1217 | 31704587 | 2019 | Theranostic Application of a Novel G-Quadruplex-Forming DNA Aptamer Targeting Malate Synthase of Mycobacterium tuberculosis | MS6 | GGTGGGATGGGGGGGGGAGGGTAGGGTGTGCAAGTAGAGGGTC | 43 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) | Surface-associated Malate synthase (MS -Whole cells) | Identify aptamers that bind to and inhibit the MS enzyme activity, thereby blocking bacterial entry into host cells. | Inhibition of MS activity, the aptamers were ranked as MS10 (IC50 of 275.6 nM, Ki of 270 nM) > MS5 > MS20 > MS4 > MS6. | 10 | Surface Plasmon Resonance (SPR) | 2.8 × 10−10 M | Therapeutics | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1218 | 31704587 | 2019 | Theranostic Application of a Novel G-Quadruplex-Forming DNA Aptamer Targeting Malate Synthase of Mycobacterium tuberculosis | MS10 | GGTGTGTTGACTGAGGGGGTGGGGTGGGTGGTGGTGGATATAGC | 44 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) | Surface-associated Malate synthase (MS -Whole cells) | Identify aptamers that bind to and inhibit the MS enzyme activity, thereby blocking bacterial entry into host cells. | Inhibition of MS activity, the aptamers were ranked as MS10 (IC50 of 275.6 nM, Ki of 270 nM) > MS5 > MS20 > MS4 > MS6. | 10 | Surface Plasmon Resonance (SPR) | 1.2 × 10−8 M | Therapeutics | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1219 | 31704587 | 2019 | Theranostic Application of a Novel G-Quadruplex-Forming DNA Aptamer Targeting Malate Synthase of Mycobacterium tuberculosis | MS20 | GGGTTGTAAGAGGGAGCTGGGAGGGGTCGGGGGGGGGGGTGGC | 43 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) | Surface-associated Malate synthase (MS -Whole cells) | Identify aptamers that bind to and inhibit the MS enzyme activity, thereby blocking bacterial entry into host cells. | Inhibition of MS activity, the aptamers were ranked as MS10 (IC50 of 275.6 nM, Ki of 270 nM) > MS5 > MS20 > MS4 > MS6. | 10 | Surface Plasmon Resonance (SPR) | 9.1 × 10−7 M | Therapeutics | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1224 | 30637436 | 2019 | Aptamer-mediated colorimetric and electrochemical detection of Pseudomonas aeruginosa utilizing peroxidase-mimic activity of gold NanoZyme | F23 | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Aptamer-mediated tunable NanoZyme colorimetric and electrochemical sensors for the detection of Pseudomonas aeruginosa. | Possess a detection limit of the electrochemical sensor of ~ 60 CFU/mL in water within 10 min. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1226 | 31403764 | 2019 | Rapid Detection of Mycoplasma-Infected Cells by an ssDNA Aptamer Probe | Aptamer A15-1 | GTGGGGTTGAAAACGCCGGAGAGGGTGTGTGGGTGGGGTA | 40 | 5'-ATCCAGAGTGACGCAGCA-N40-TGGACACGGTGGCTTAGT-3' | ssDNA | Mycoplasma-Infected Cells (Jeko-1 lymphoma cells) | Whole cell | Develop an aptamer probe for the rapid detection of mycoplasma-infected cells. | Mycoplasma-positive cells showed a strong signal, but no signal was detected in the mycoplasma-negative cells. | 15 | Flow Cytometry | 24.5 nM | Detection | Whole Cell-SELEX | 5'-Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1227 | 30877887 | 2019 | A new aptamer/polyadenylated DNA interdigitated gold electrode piezoelectric sensor for rapid detection of Pseudomonas aeruginosa | P. aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Developed a piezoelectric sensor (Au IDE-MSPQC) based on magnetic bead/aptamer/polyadenylated-DNA for the detection of P. aeruginosa. | The limits of detection (LOD) of the method were as low as 9 CFU/mL in buffer and 52 CFU/mL in a simulated blood sample. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (Biotin-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1228 | 31183576 | 2019 | Surface-enhanced Raman spectroscopic single step detection of Vibrio parahaemolyticus using gold coated polydimethylsiloxane as the active substrate and aptamer modified gold nanoparticles | V.P. Aptamer | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Aptamer-based SERS method using Au-PDMS film for the detection of V. parahaemolyticus. | The detection limit is 12 cfu/mL with a wide linear range from 1.2 × 10(2) to 1.2 × 10(6) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1229 | 31472413 | 2019 | Vertical capacitance aptasensors for real-time monitoring of bacterial growth and antibiotic susceptibility in blood | E. coli aptamer | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Vertical-type aptamer-functionalized sensor (aptasensor) for monitoring bacterial growth and antibiotic susceptibility in blood in real-time. | Detect bacteria growth in blood at 10(0)-10(3) CFU/mL in real-time within 12 hours, and the MIC for E. coli was approximately 0.1 and 1 μg/mL for gentamicin and amikacin, respectively. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1230 | 31472413 | 2019 | Vertical capacitance aptasensors for real-time monitoring of bacterial growth and antibiotic susceptibility in blood | P. aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Vertical-type aptamer-functionalized sensor (aptasensor) for monitoring bacterial growth and antibiotic susceptibility in blood in real-time. | Detect bacteria growth in blood at 10(0)-10(3) CFU/mL in real-time within 12 hours and the MIC for S. aureus was approximately 1 and 0.1 μg/mL for gentamicin and amikacin, respectively, | N/A | N/A | N/A | Biosensor | N/A | 3'-Thiolated (SH-(CH2)3) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1231 | 31472413 | 2019 | Vertical capacitance aptasensors for real-time monitoring of bacterial growth and antibiotic susceptibility in blood | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Vertical-type aptamer-functionalized sensor (aptasensor) for monitoring bacterial growth and antibiotic susceptibility in blood in real-time. | Detect bacteria growth in blood at 10(0)-10(3) CFU/mL in real-time within 12 hours and the MIC for P. aeruginosa was approximately 1 μg/mL for both gentamicin and amikacin. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1232 | https:doi.org10.1039C9AY01509D | 2019 | A nano-sized chitosan particle based electrochemical aptasensor for sensitive detection of P. aeruginosa | P.aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa | Whole cell | Develop an aptasensor based on a glassy carbon electrode (GCE) modified with nano-sized chitosan particles (NCs) for sensitive and simultaneous detection of P. aeruginosa. | Displayed a low detection limit of 3 CFU/mL, wide linearity of 10(1)–10(7) CFU/mL and a recovery rate from 93.2% to 124%. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1233 | https://doi.org/10.1021/acssuschemeng.9b01314 | 2019 | Development of a Sensitive Diagnostic Device Based on Zeolitic Imidazolate Frameworks-8 Using Ferrocene–Graphene Oxide as Electroactive Indicator for Pseudomonas aeruginosa Detection | P.aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa | Whole cell | An electrochemical biosensor (Fc-GO/Apt/HZIFs-8/GCE ) based on aptamers immobilized in engineered zeolitic imidazolate Framework-8 (ZIFs-8) for the detection of P. aeruginosa in human urine samples. | Exhibits a wide linear dynamic range (from 1.2 × 10(1) to 1.2 × 10(7) CFU/mL) with a low detection limit of 1 CFU/mL. | N/A | N/A | N/A | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1234 | 31362188 | 2019 | Dual-aptamers labeled polydopamine-polyethyleneimine copolymer dots assisted engineering a fluorescence biosensor for sensitive detection of Pseudomonas aeruginosa in food samples | P. aeruginosa aptamer1 | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 15442) | Whole cell | A dual aptamer labelled PDA-PEI copolymer dots-based biosensor for detection and quantification of P. aeruginosa. | The LOD of P. aeruginosa is as low as 1 cfu/mL with a linear range from 10(1)–10(7) cfu/mL in 1.5h. | N/A | N/A | N/A | Biosensor | N/A | 5'-COOH (Carboxylated) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1235 | 31362188 | 2019 | Dual-aptamers labeled polydopamine-polyethyleneimine copolymer dots assisted engineering a fluorescence biosensor for sensitive detection of Pseudomonas aeruginosa in food samples | P. aeruginosa aptamer2 | ATGCACTCTTCTATCGGTAGTTGAGGGTGCGG | 32 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 15442) | Whole cell | A dual aptamer labelled PDA-PEI copolymer dots-based biosensor for detection and quantification of P. aeruginosa. | The LOD of P. aeruginosa is as low as 1 cfu/mL with a linear range from 10(1)–10(7) cfu/mL in 1.5h. | N/A | N/A | N/A | Biosensor | N/A | 5'-COOH (Carboxylated) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1236 | 31279171 | 2019 | A novel enzyme-free electrochemical biosensor for rapid detection of Pseudomonas aeruginosa based on high catalytic Cu-ZrMOF and conductive Super P | P-aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Develop a Cu-ZrMOF@Aptamer@DNA nanocomposite-based enzyme-free electrochemical biosensor to detect P. aeruginosa. | Exhibit a wide linearity range of 10-10(6) CFU/mL and a low limit of detection of 2 CFU/mL within 120 min. | N/A | N/A | N/A | Biosensor | N/A | 5'-Phosphate | N/A | The biosensor had acceptable storage stability (98.1% and 83.9%) within 7 days of storage at 4°C. | N/A | N/A | N/A |
| ABdb_1237 | 31655899 | 2019 | Impedimetric aptasensor for Pseudomonas aeruginosa by using a glassy carbon electrode modified with silver nanoparticles | P.aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa | Whole cell | Develop an aptasensor based on an immobilised NH2-aptamer that was covalently attached to the AgNP/GCE surface for the detection of P. aeruginosa. | The impedance increases on going from 10(2) to 10(7) CFU/mL concentrations of P. aeruginosa, and the detection limit is 33 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1245 | 30825657 | 2019 | A reduced graphene oxide-titanium dioxide nanocomposite based electrochemical aptasensor for rapid and sensitive detection of Salmonella enterica | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Developed a rGO-TiO2 electrochemical aptasensor for the detection of Salmonella bacteria. | Exhibited high sensitivity with a wide detection range (10(8) to 10(1) cfu/mL), a low detection limit of 10(1) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | Showed good durability up to 21 days with a 10% decrease in signal after 30 days of non-use. | N/A | N/A | N/A |
| ABdb_1246 | https://doi.org/10.1016/j.foodcont.2019.106806 | 2019 | A competitive enzyme linked aptasensor with rolling circle amplification (ELARCA) assay for colorimetric detection of Listeria monocytogenes | Aptamer | TATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT | 48 | N/A | ssDNA | Listeria Monocytogenes (CMCC 54007) | Whole cell | Developed an enzyme-linked aptasensor with rolling circle amplification (ELARCA) assay for the detection of L. monocytogenes. | Showed a limit of detection (LOD) of 4.6 × 10(2) CFU/mL in pure culture, and in fresh lettuce showed an LOD of 6.1 × 10(3) CFU/g. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1255 | 30608683 | 2019 | Visualized Detection of Vibrio parahaemolyticus in Food Samples Using Dual-Functional Aptamers and Cut-Assisted Rolling Circle Amplification | A-Apt | TACGACCAGAATCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACTTATGTGCGTCAAAAAAAAAA | 71 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | A biosensor using Dual-Apt and cut-assisted rolling circle amplification (CA-RCA) for rapid and visualized detection of Vibrio parahaemolyticus. | Shows a good linear correlation in the range from 10(6) to 10 CFU/mL and LOD as low as 10 CFU/mL (g) in real food samples. | N/A | N/A | N/A | Biosensor | N/A | 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1256 | 30608683 | 2019 | Visualized Detection of Vibrio parahaemolyticus in Food Samples Using Dual-Functional Aptamers and Cut-Assisted Rolling Circle Amplification | D-Apt | CCTCAGCATAAGCATGAATTGACCAACCTAAACTTATTCATTTTCCAGCACCTCTAATATTACTGGCGCAGTGCACCCACCCACCCACCC | 90 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | A biosensor using Dual-Apt and cut-assisted rolling circle amplification (CA-RCA) for rapid and visualized detection of Vibrio parahaemolyticus. | Shows a good linear correlation in the range from 10(6) to 10 CFU/mL and LOD as low as 10 CFU/mL (g) in real food samples. | N/A | N/A | N/A | Biosensor | N/A | 5'-Phosphate (3'-end phosphorylation) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1257 | 31307721 | 2019 | Dual-recognition surface-enhanced Raman scattering(SERS)biosensor for pathogenic bacteria detection by using vancomycin-SERS tags and aptamer-Fe3O4@Au | S. aureus-aptamer | GCAATGGTACGGTACTTCCACTTAGGTCGAGGTTAGTTTGTCTTGCTGGCGCATCCACTGAGCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed a dual-recognition SERS biosensor using Vancomycin-Au@MBA and aptamer-Fe3O4@Au for the detection of pathogenic bacteria. | A detection limit of 3 cells/mL with a wide dynamic linear range from 10 to 10(7) cells/mL can be achieved within 50 min. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1258 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A3P | ATAGGAGTCACGACGACCAGAATCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACTTATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | Exhibits a wide linear detection range (from 10(2) to 10(7) cfu/mL), and the detection limit could be as low as 10 cfu/mL. | N/A | Flow Cytometry | 50.76 ± 8.92 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1259 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A1 | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 32.53 ± 6.86 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1260 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A2 | GCAAAGAAACAGTGACTCGTTGA | 23 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 37.44 ± 6.98 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1261 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A3 | GCAACGAAACAGTGACTCGTTGA | 23 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 34.61 ± 3.47 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1262 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A4 | CAACGAAACAGTGACTCGTTG | 21 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 28.65 ± 3.05 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled and 5'-Biotinylated (Biotin-TTTTTTTTT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1263 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A5 | AACGAAACAGTGACTCGTT | 19 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 422.0 ± 21.93 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1264 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A6 | ACGAAACAGTGACTCGT | 17 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 412.9 ± 27.12 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1265 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A4-1 | CAACGAAACATTGACTCGTTG | 21 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 1004 ± 187.1 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1266 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A4-2 | CAACGAAACAGTTACTCGTTG | 21 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 1103 ± 180.2 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1267 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A4-3 | CAACGAAACTGTGACTCGTTG | 21 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 958.9 ± 183.1 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1268 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A4-4 | CAACGAAACAGCGACTCGTTG | 21 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 1070 ± 73.05 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1269 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A4-5 | CAACGAAACAGTGTCTCGTTG | 21 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 1119 ± 187.1 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1270 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A4-6 | CAACGAAATAGTGACTCGTTG | 21 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 1070 ± 125.4 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1271 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A4-7 | CAACGAACCAGTGACTCGTTG | 21 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 423.2 ± 36.91 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1272 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A4-8 | CAACGATACAGTGACTCGTTG | 21 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 467.0 ± 33.38 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1273 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A4-9 | CAACGAAACAGTGAGTCGTTG | 21 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 376.4 ± 54.25 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1278 | 31380872 | 2019 | A transcription aptasensor: amplified, label-free and culture-independent detection of foodborne pathogens via light-up RNA aptamers | SA31 | TCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGA | 45 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Develop a transcription aptasensor by using a light-up RNA aptamer for culture-free detection of intact foodborne pathogens. | The dynamic range was 10(2)-10(6) CFU/mL, and the LOD of the transcription aptasensor was estimated to be 77.0 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1279 | 31617347 | 2019 | Ultrasensitive Fluorometric Angling Determination of Staphylococcus aureus in Vitro and Fluorescence Imaging in Vivo Using Carbon Dots with Full-Color Emission | S. aureus aptamer (Apt) | GCAATGGTACGGTACTTCC-TCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGT-CAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | An ultrasensitive magnetic fluorescence aptasensor was designed using Fe3O4/CD for the separation and detection of S. aureus. | The FRET-based aptasensor achieved a wide linear range of 50–10(7) CFU/mL and a detection limit of 8 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1280 | 31036183 | 2019 | Rapid and label-free detection of Brucella melitensis in milk and milk products using an aptasensor | B. melitensis aptamer | GAGAGTAAAGGCCATCGGCGGCCATTTATGTTGTACCC | 38 | N/A | ssDNA | Brucella Melitensis | Whole cell | A QCM-aptasensor [Fe3O4 @SiO2 @p(PEG-MA-GMA)] was developed for the determination of B. melitensis from food samples. | The detection limits of the QCM aptasensor were in the range 1.0(2)–1.0(7) CFU/mL, with recoveries up to 79% and LOD of 100 CFU/mL. | 15 | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1281 | 31718045 | 2019 | Aptamer Affinity-Bead Mediated Capture and Displacement of Gram-Negative Bacteria Using Acoustophoresis | GN6 aptamer | ATACCAGCTTATTCAATTGGGTGAGGGGGGGTTCACAACGTTAAAGATAGACGGGGGAAGATAGTAAGTGCAATCT | 76 | N/A | ssDNA | Gram-negative Bacteria | Whole cell | Develop aptamer-modified microbeads and an acoustophoresis method for capturing and displacing gram-negative bacteria. | It achieved high recovery (up to 98%) and high purity (up to 99.5%). | N/A | N/A | N/A | Detection | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1282 | 31511614 | 2019 | Detection of Gram-negative bacterial outer membrane vesicles using DNA aptamers | GN6 | ATACCAGCTTATTCAATT-GGGTGAGGGGGGGTTCACAACGTTAAAGATAGACGGGGGA-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Gram-negative Bacteria (Escherichia Coli (E. Coli) DH5α, Escherichia Coli (E. Coli) K12, and Serratia Marcescens) | Whole cell | Isolated aptamers against multiple Gram-negative bacterial species and developed an aptamer-based detection tool (ELAA) towards bacterial secretory cargo released from the outer membranes of Gram-negative bacteria. | Can detect as low as 25 ng/mL of bacterial OMVs, and dissociation constants of GN6 to OMVs derived from E. coli DH5α, E. coli K12 and S. marcescens were 0.13 ± 0.01 μg/ml, 3.70 ± 0.98 μg/ml and 0.23 ± 0.16 μg/ml, respectively. | 12 | Fluorescence Binding Assay | 29.94 ± 2.49 nM (for E. coli DH5α), 59.70 ± 10.89 nM (for E. coli K12) and 38.98 ± 6.46 nM (for S. marcescens) | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 5'-Biotinylated and 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1283 | 31511614 | 2019 | Detection of Gram-negative bacterial outer membrane vesicles using DNA aptamers | GN12 | ATACCAGCTTATTCAATT-CCGAGTCCAGACTCACCGCCGCCTCCTCAAGACGTGCTGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Gram-negative Bacteria (Escherichia Coli (E. Coli) DH5α, Escherichia Coli (E. Coli) K12, and Serratia Marcescens) | Whole cell | Isolated aptamers against multiple Gram-negative bacterial species and developed an aptamer-based detection tool towards bacterial secretory cargo released from the outer membranes of Gram-negative bacteria. | GN12 was 3.6 times higher in binding to 10(8) cells of Gram-negative bacteria than to Gram-positive bacteria tested. | 12 | Fluorescence Binding Assay | 20.36 ± 2.38 nM (for E. coli DH5α), 24.80 ± 3.98 nM (for E. coli K12) and 53.83 ± 17.70 nM (for S. marcescens) | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1284 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA1 | GACGCTTACTCAGGTGTGACTCG-TCCATACCTCCTATTCCTATCTGATCACCATGAGCTCTCGCCTGAACTGG-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1285 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA2 | GACGCTTACTCAGGTGTGACTCG-TCGGTCGGGTGGTTGGGGCGGGTGGTCGGTTTTTAAGTTGTGTCATTGTC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | VA2 could recognize different V. alginolyticus prevalent in Beibu Gulf with high specificity and affinity. | 9 | Flow Cytometry | 14.31 ± 4.26 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | No cytotoxic effects shown in vitro and in vivo. | N/A | Best Candidate | N/A | N/A |
| ABdb_1286 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA3 | GACGCTTACTCAGGTGTGACTCG-TATCTTGTCAGCATATAGCCGCCCTGTCTCGTGCCTCTAATTGGGCTTGT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1287 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA4 | GACGCTTACTCAGGTGTGACTCG-CTTGGTGGGGGGTGGCGGGTTGGTGATTAGTTGCGTGTACAACCGTTGCG-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1288 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA5 | GACGCTTACTCAGGTGTGACTCG-TCGGTCGGGTGGTTGGGGCGGGTGGTCGGTTTTTAAGTTGTGTCATTGTC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1289 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA6 | GACGCTTACTCAGGTGTGACTCG-TCGGTCGGGTGGTTGGGGCGGGTGGTCGGTTTTTAAGTTGTGTCATTGTC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1290 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA7 | GACGCTTACTCAGGTGTGACTCG-GGGGCACTCTGGGGAAGGACGTAAGCGATAGCCGACCTCGTGGAATATTA-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1291 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA8 | GACGCTTACTCAGGTGTGACTCG-CGTTTTATTGGTGTGGGGCTGGGGTGGTGGGTGGCTCTACTGGTTCCGTT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | VA8 could recognize different V. alginolyticus prevalent in Beibu Gulf with high specificity and affinity but less potent than VA2. | 9 | Flow Cytometry | 90.00 ± 13.51 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | No cytotoxic effects shown in vitro and in vivo. | N/A | Best Candidate | N/A | N/A |
| ABdb_1292 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA9 | GACGCTTACTCAGGTGTGACTCG-TCACCGTCATACACGGTCACCTGTTCTGCTATCACCCTGACGTGATTGTT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1293 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA10 | GACGCTTACTCAGGTGTGACTCG-CGTTTTATTGGTGTGGGGCTGGGGTGGTGGGTGGCTCTACTGGTTCCGTT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1294 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA11 | GACGCTTACTCAGGTGTGACTCG-TGGCGCAAGGGAAGGTGTTGGGGGATGGTTGGTGGGGTGTGTGGTTGTAT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1295 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA12 | GACGCTTACTCAGGTGTGACTCG-ATGGCTGACTATATAAGAGAACGGGGGCTGCGGTGGTCCCGATCTGGCAT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1296 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA13 | GACGCTTACTCAGGTGTGACTCG-TCGGTCGGGTGGTTGGGGCGGGTGGTCGGTTTTTAAGTTGTGTCATTGTC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1297 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA14 | GACGCTTACTCAGGTGTGACTCG-CGTTTTATTGGTGTGGGGCTGGGGTGGTGGGTGGCTCTACTGGTTCCGTT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1298 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA15 | GACGCTTACTCAGGTGTGACTCG-TGGCGATGTACGCACCGCCCTCAGACTCATTCAGCATATAGCCTAGTAAC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1299 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA16 | GACGCTTACTCAGGTGTGACTCG-GGGGTGGATTGGGTGGGGTGGTTGGTTCGTTTTAAAGTACTGTGTAAGCG-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1300 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA17 | GACGCTTACTCAGGTGTGACTCG-TCGGTCGGGTGGTTGGGGCGGGTGGTCGGTTTTTAAGTTGTGTCATTGTC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1301 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA18 | GACGCTTACTCAGGTGTGACTCG-GCTGCGTTAACATATAGGGCATTTGAGTGCGCGCATAGGGTTGTGGCGAT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1302 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA19 | GACGCTTACTCAGGTGTGACTCG-TCGGTCGGGTGGTTGGGGCGGGTGGTCGGTTTTTAAGTTGTGTCATTGTC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1303 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA20 | GACGCTTACTCAGGTGTGACTCG-TCCAGTCAGTATATAACTCCTCGACCCTGTGATCGGCTACGGTGGCAGTA-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1304 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA21 | GACGCTTACTCAGGTGTGACTCG-GAGTGCTCGGTTGGTGTTGGGGGAGGGTGGTGGGTGACCATGCTACATGT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1305 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA22 | GACGCTTACTCAGGTGTGACTCG-CGTTTTATTGGTGTGGGGCTGGGGTGGTGGGTGGCTCTACTGGTTCCGTT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1306 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA23 | GACGCTTACTCAGGTGTGACTCG-GGGCGGGTGGACGGGGGTGGTATGGAGGTTGGAGTAAGCGGTTTCACCGA-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1307 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA24 | GACGCTTACTCAGGTGTGACTCG-TCGGTCGGGTGGTTGGGGCGGGTGGTCGGTTTTTAAGTTGTGTCATTGTC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1308 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA25 | GACGCTTACTCAGGTGTGACTCG-TCGGTCGGGTGGTTGGGGCGGGTGGTCGGTTTTTAAGTTGTGTCATTGTC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1309 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA26 | GACGCTTACTCAGGTGTGACTCG-TCTGGTAGCATATAGCCGGCAGAGCACGGTCCCCTCATGGTTGGCACGTA-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1310 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA27 | GACGCTTACTCAGGTGTGACTCG-GCCATGCTCACTATATAAGATATGTAAGTTGGACTACATATGTATGGCTG-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1311 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA28 | GACGCTTACTCAGGTGTGACTCG-GCTGTGATCGTATGGACGCTGCAGTTGGATGACGCTATGAGGTATTCCAA-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1312 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA29 | GACGCTTACTCAGGTGTGACTCG-TCGGTCGGGTGGTTGGGGCGGGTGGTCGGTTTTTAAGTTGTGTCATTGTC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1313 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA30 | GACGCTTACTCAGGTGTGACTCG-CGTTTTATTGGTGTGGGGCTGGGGTGGTGGGTGGCTCTACTGGTTCCGTT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1314 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA31 | GACGCTTACTCAGGTGTGACTCG-TCGGTCGGGTGGTTGGGGCGGGTGGTCGGTTTTTAAGTTGTGTCATTGTC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1315 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA32 | GACGCTTACTCAGGTGTGACTCG-CACTATTGTCAAGTCACGAGTTAGGTACCTATGTGATCTGAGGTATCAA-CGAAGGACGCAGATGAAGTCTC | 94 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1316 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA33 | GACGCTTACTCAGGTGTGACTCG-CTACTCAGGTGACCCTCAAACGTATCTAGTTTGGCAGCGAGGTTCCTTCG-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1317 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA34 | GACGCTTACTCAGGTGTGACTCG-TTGCGAATATAGCGACGAGTATCGTCAGAGTCGCCGGGTCCAGGTTCGA-CGAAGGACGCAGATGAAGTCTC | 94 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1318 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA35 | GACGCTTACTCAGGTGTGACTCG-GGTGGTGGGGATTTGGGGTGGTTGGTTCATCTATCTGGTCGTTACCGGGG-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1319 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA36 | GACGCTTACTCAGGTGTGACTCG-CGCGGCACCAGCACGACGGTTCGATTGGCTGCGGAAACCACGCACTGCAT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1320 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA37 | GACGCTTACTCAGGTGTGACTCG-GGTGTTGGTGGGTGGCGGGGTGGTGGTTGGTGTTCCCGAACCTGATGAAT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1321 | 31563315 | 2019 | Rapid identification and quantitation of the viable cells of Lactobacillus casei in fermented dairy products using an aptamer-based strategy powered by a novel cell-SELEX protocol | Apt-1 | ATCGTATACCTAGAAGATATGACCGGCAGTTGATGAGATAGAGGCGCTGGTGGGTAGATA | 60 | 5'-TCAGCACGT-N60-TCCACTGAGAGATCC-3' | ssDNA | Lactobacillus Casei (ATCC 393) | Whole cell | An aptamer-based strategy using PEG and chitosan-modified graphene oxide, with complementary ring-mediated RCA, was developed for qualitative and quantitative detection of viable L. casei in dairy products. | N/A | 8 | Flow Cytometry | 21.1 ± 2.7 nM | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1322 | 31563315 | 2019 | Rapid identification and quantitation of the viable cells of Lactobacillus casei in fermented dairy products using an aptamer-based strategy powered by a novel cell-SELEX protocol | Apt-2 | GGCTCACCTACAGGCTGCGGAGTCATAGCATCGTGACAGAGTCGAGTGTCGACTATACGT | 60 | 5'-TCAGCACGT-N60-TCCACTGAGAGATCC-3' | ssDNA | Lactobacillus Casei (ATCC 393) | Whole cell | An aptamer-based strategy using PEG and chitosan-modified graphene oxide, with complementary ring-mediated RCA, was developed for qualitative and quantitative detection of viable L. casei in dairy products. | Achieved a detection limit of 10(5) cfu/mL and selective detection of L. casei in commercial dairy drinks, with a dynamic range of 10(5) to 10(9) cfu/mL. | 8 | Flow Cytometry | 19.3 ± 3.7 nM | Detection | Whole Cell-SELEX | 3'-Biotinylated (biotin-AAAAAAAAAA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1323 | 31563315 | 2019 | Rapid identification and quantitation of the viable cells of Lactobacillus casei in fermented dairy products using an aptamer-based strategy powered by a novel cell-SELEX protocol | Apt-3 | TCGAAGTGAGCGCGCGGTGTGGTGACTGTGTTGCAGATGGATGCATGGAGGTGATGATGA | 60 | 5'-TCAGCACGT-N60-TCCACTGAGAGATCC-3' | ssDNA | Lactobacillus Casei (ATCC 393) | Whole cell | An aptamer-based strategy using PEG and chitosan-modified graphene oxide, with complementary ring-mediated RCA, was developed for qualitative and quantitative detection of viable L. casei in dairy products. | Achieved a detection limit of 10(5) cfu/mL and selective detection of L. casei in commercial dairy drinks, with a dynamic range of 10(5) to 10(9) cfu/mL. | 8 | Flow Cytometry | 15.6 ± 4.1 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1327 | 31446952 | 2019 | Aptamer-based SERS biosensor for whole cell analytical detection of E. coli O157:H7 | a-aptamer | ATCAAATGTGCAGATATCAAGACGATTTGTACAAGATCCATGCTGAGGTGGTCATAGCTGATCCTACC | 68 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | SERS-based aptasensor using 4-aminothiophenol-gold nanoparticle complexes was developed for the detection of E. coli O157:H7. | Low concentrations of E. coli O157:H7 were detected and quantified within 20 min in both pure culture (∼10(1) CFU/mL) and ground beef samples (∼10(2) CFU/mL), and a linear range from 10(2) to 10(6) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1328 | https://doi.org/10.3390/app9020295 | 2019 | Development of an Electrochemical Biosensor for Rapid and Effective Detection of Pathogenic Escherichia coli in Licorice Extract | Aptamer (Seq.1) | CAGCTCAGAAGCTTGATCCTACCAGTAGACTTTCAACTTTACTGCCATCGTGTGCCCTAAGACTCGAAGTCGTGCATCTG | 80 | N/A | ssDNA | Escherichia Coli (E. Coli) (CICC 10372) | Whole cell | Developed an aptamer-based electrochemical biosensor for the rapid detection of E. coli in liquorice extract. | Concentrations ranging from 5.0 × 10^2 CFU/mL to 5.0 × 10^7 CFU/mL exhibited a linear trend, with a detection limit of 80 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1329 | 31410576 | 2019 | Electrochemical determination of Salmonella typhimurium by using aptamer-loaded gold nanoparticles and a composite prepared from a metal-organic framework (type UiO-67) and graphene | Aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | An aptamer-based assay based on a metal-organic framework-graphene composite of type UiO-67/GR and an aptamer-gold nanoparticles-horseradish peroxidase (Apt-AuNP-HRP) conjugate is described for the determination of S.typhimurium. | Linear detection range from 2 × 10(1) – 2 × 10(8) cfu/mL and a lower detection limit of 5 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | 91.3% of the original current is retained after storage at 4°C for 14 days with the modified electrodes, allowing monitoring of 2 × 10(5) cfu/mL S. typhimurium. | N/A | N/A | N/A |
| ABdb_1330 | 31080198 | 2019 | Polyadenine-mediated Immobilization of Aptamers on a Gold Substrate for the Direct Detection of Bacterial Pathogens | 10A-E1 | AAAAAAAAAA-TTTTT-ATCAAATGTGCAGATATCAAGACGATTTGTACAAGAT | 52 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Developed a SPR-based aptasenor using polyadenine-mediated immobilization of aptamers on a gold substrate for the detection of E. coli or S. aureus. | The detection limit of the current SPR aptasensor is 1 x 10(5) CFU/mL for E. coli. | N/A | N/A | N/A | Biosensor | N/A | 5'-PolyA (10A) and Five thymine (5T) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1331 | 31080198 | 2019 | Polyadenine-mediated Immobilization of Aptamers on a Gold Substrate for the Direct Detection of Bacterial Pathogens | 10A-E2 | AAAAAAAAAA-TTTTT-CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 57 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Developed a SPR-based aptasenor using polyadenine-mediated immobilization of aptamers on a gold substrate for the detection of E. coli or S. aureus. | N/A | N/A | N/A | N/A | Biosensor | N/A | 5'-PolyA (10A) and Five thymine (5T) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1332 | 31080198 | 2019 | Polyadenine-mediated Immobilization of Aptamers on a Gold Substrate for the Direct Detection of Bacterial Pathogens | 10A-S1 | AAAAAAAAAA-TTTTT-TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 77 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed a SPR-based aptasenor using polyadenine-mediated immobilization of aptamers on a gold substrate for the detection of E. coli or S. aureus. | The detection limit of the current SPR aptasensors is 1 x 10(6) CFU/mL for S. aureus. | N/A | N/A | N/A | Biosensor | N/A | 5'-PolyA (10A) and Five thymine (5T) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1333 | 31080198 | 2019 | Polyadenine-mediated Immobilization of Aptamers on a Gold Substrate for the Direct Detection of Bacterial Pathogens | 10A-S2 | AAAAAAAAAA-TTTTT-GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 103 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed a SPR-based aptasenor using polyadenine-mediated immobilization of aptamers on a gold substrate for the detection of E. coli or S. aureus. | N/A | N/A | N/A | N/A | Biosensor | N/A | 5'-PolyA (10A) and Five thymine (5T) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1334 | 31080198 | 2019 | Polyadenine-mediated Immobilization of Aptamers on a Gold Substrate for the Direct Detection of Bacterial Pathogens | 30A-E1 | AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-TTTTT-ATCAAATGTGCAGATATCAAGACGATTTGTACAAGAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Developed a SPR-based aptasenor using polyadenine-mediated immobilization of aptamers on a gold substrate for the detection of E. coli or S. aureus. | N/A | N/A | N/A | N/A | Biosensor | N/A | 5'-PolyA (30A) and Five thymine (5T) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1335 | 31080198 | 2019 | Polyadenine-mediated Immobilization of Aptamers on a Gold Substrate for the Direct Detection of Bacterial Pathogens | 30A-E2 | AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-TTTTT-CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 77 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Developed a SPR-based aptasenor using polyadenine-mediated immobilization of aptamers on a gold substrate for the detection of E. coli or S. aureus. | N/A | N/A | N/A | N/A | Biosensor | N/A | 5'-PolyA (30A) and Five thymine (5T) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1336 | 31080198 | 2019 | Polyadenine-mediated Immobilization of Aptamers on a Gold Substrate for the Direct Detection of Bacterial Pathogens | 30A-S1 | AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-TTTTT-TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 97 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed a SPR-based aptasenor using polyadenine-mediated immobilization of aptamers on a gold substrate for the detection of E. coli or S. aureus. | N/A | N/A | N/A | N/A | Biosensor | N/A | 5'-PolyA (30A) and Five thymine (5T) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1337 | 31080198 | 2019 | Polyadenine-mediated Immobilization of Aptamers on a Gold Substrate for the Direct Detection of Bacterial Pathogens | 30A-S2 | AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-TTTTT-GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 123 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed a SPR-based aptasenor using polyadenine-mediated immobilization of aptamers on a gold substrate for the detection of E. coli or S. aureus. | N/A | N/A | N/A | N/A | Biosensor | N/A | 5'-PolyA (30A) and Five thymine (5T) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1341 | https://doi.org/10.1016/j.snb.2018.12.112 | 2019 | Screening of highly-specific aptamers and their applications in paper-based microfluidic chips for rapid diagnosis of multiple bacteria | A1 | ACAGCACCACAGACCACATATCACATGCTGTCGCCTTGCGATATCAATTCCAGTGATGTTTGTCTTCCTGCC | 72 | 5'-GGCAGGAAGACAAACA-N40-TGGTCTGTGGTGCTGT-3' | ssDNA | Acinetobacter Baumannii | Whole cell | Identify aptamers and develop a dual-aptamer, NC-based microfluidic chip for fast diagnosis of three common nosocomial bacteria. | LOD was estimated to be 10(3) for AB. | 3 | Fluorescence Spectroscopy | 6.8 ± 1.9 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1342 | https://doi.org/10.1016/j.snb.2018.12.112 | 2019 | Screening of highly-specific aptamers and their applications in paper-based microfluidic chips for rapid diagnosis of multiple bacteria | E27 | ACAGCACCACAGACCACAGATCATACCAGTGCGGCCGTTAGCCTCGTTAATCTGGCGTTTGTCTTCCTGCC | 71 | 5'-GGCAGGAAGACAAACA-N40-TGGTCTGTGGTGCTGT-3' | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Identify aptamers and develop a dual-aptamer, NC-based microfluidic chip for fast diagnosis of three common nosocomial bacteria. | LOD was estimated to be 10(4) for EC. | 3 | Fluorescence Spectroscopy | 11.9 ± 3.7 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1343 | https://doi.org/10.1016/j.snb.2018.12.112 | 2019 | Screening of highly-specific aptamers and their applications in paper-based microfluidic chips for rapid diagnosis of multiple bacteria | O28 | GGGGAAGACAAACACCTCATAGTCGGTATCGGCCGTTTGGGCGTTTTTCCGATGGTCTGTGGTGCTGT | 68 | 5'-GGCAGGAAGACAAACA-N40-TGGTCTGTGGTGCTGT-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Whole cell | Identify aptamers and develop a dual-aptamer, NC-based microfluidic chip for fast diagnosis of three common nosocomial bacteria. | LOD was estimated to be 10(5) CFU/μL for MRSA. | 3 | Fluorescence Spectroscopy | 199.6 ± 35.8 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1344 | 31033156 | 2019 | Inkjet Printed Nanopatterned Aptamer-Based Sensors for Improved Optical Detection of Foodborne Pathogens | a-aptamer | ATCAAATGTGCAGATATCAAGACGATTTGTACAAGATCCATGCTGAGGTGGTCATAGCTGATCCTACC | 68 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Developed an inkjet-printed nanopatterned aptamer-based sensor for optical detection of E. coli O157:H7. | Display a LOD of 25 CFU/mL in pure culture and 233 CFU/mL in ground beef. | N/A | Bio-Layer Interferometry (BLI) | N/A | Biosensor | N/A | 5'-Carboxy and 5'-Biotin-TEG | N/A | N/A | N/A | N/A | N/A |
| ABdb_1345 | 30797466 | 2019 | Aptamer surface functionalization of microfluidic devices using dendrimers as multi-handled templates and its application in sensitive detections of foodborne pathogenic bacteria | E. coli O157:H7 aptamer | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | A microfluidic system using a dendrimer-aptamer modified surface was developed for sensitive detection of E. coli O157:H7. | The G7-apatamer modified detection system achieved a low limit of detection of 10(2) cells/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) and 3'-Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1346 | https://doi.org/10.1016/j.foodcont.2018.11.048 | 2019 | Naked-eyes detection of Shigella flexneri in food samples based on a novel gold nanoparticle-based colorimetric aptasensor | Sh. flexneri binding aptamer | CCGGACTAGGGCTGGTTAGCTTCAATACTGCTGGGCGAGG | 40 | N/A | ssDNA | Shigella Flexneri (ATCC 12022) | Whole cell | Developed a colourimetric aptasensor based on an aptamer and gold nanoparticles (AuNPs) for the visual detection of Sh. flexneri. | Achieved a linear range from 10(2) to 10(6) CFU/mL with the detection limit of 80 CFU/mL, and the detection time was 20 min or less. | 14 | N/A | 42.6 ± 7.11 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1347 | 31196418 | 2019 | Functional chimera aptamer and molecular beacon based fluorescent detection of Staphylococcus aureus with strand displacement-target recycling amplification | Aptamer | CACACCGCAGCAGTGGGAACGTTTCAGCCATGCAAGCATCACGCCCGT | 48 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed a fluorescent detection of S. aureus based on a functional chimaera and a molecular beacon. | Display a broad concentration range from 80 CFU/mL to 8 × 10(6) CFU/mL and the detection limit of 39 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1348 | 31318203 | 2019 | Engineering DNA-Nanozyme Interfaces for Rapid Detection of Dental Bacteria | S. mutans-binding aptamer | ATACTATCGCATTCCTTCCGAGGGGGGAGGGGGGGGTGGGGGTCGGT | 47 | N/A | ssDNA | Streptococcus Mutans (ATCC 25175) | Whole cell | Developed a DNA-engineered nanozyme interface using aptamers for the detection of dental bacteria. | The detection limit is 12 CFU/mL, and the linear range is 0 to 10(9) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1350 | 32333113 | 2020 | Inhibitory effects of aptamer targeted teicoplanin encapsulated PLGA nanoparticles for Staphylococcus aureus strains | SA20 | GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT | 45 | N/A | ssDNA | Staphylococcus aureus (S. aureus) susceptible strains and MRSA | Whole cell | Aptamer-PLGA nanoparticles (Apt-teicoplanin-PLGA NPs) for the delivery of teicoplanin antibiotic. | MICs of teicoplanin decreased by 32- and 64-fold for susceptible strains and MRSA strains, respectively. | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1351 | 32981012 | 2020 | Inhibition of enteropathogenic Escherichia coli biofilm formation by DNA aptamer | SELEX 10 colony 5 | CCGGAATTCCTAATACGACTCTACAAAAAGTCGTGGTCCAGTTGCCATGTGTAAAACTGTGTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Interfering with the biofilm formation via abolishing the motility and quorum sensing. | Exhibited the highest biofilm inhibition towards EPEC K1.1 shown by lowest OD value of 0.126. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1352 | 32981012 | 2020 | Inhibition of enteropathogenic Escherichia coli biofilm formation by DNA aptamer | SELEX 8 colony 1 | CCGGAATTCCTAATACGACTCTGCGGACTGTATGCGGTACGGTCGAAAATAGTGAAGGTGCTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Interfering with the biofilm formation via abolishing the motility and quorum sensing. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1353 | 32981012 | 2020 | Inhibition of enteropathogenic Escherichia coli biofilm formation by DNA aptamer | SELEX 8 colony 4 | CCGGAATTCCTAATACGACTCACTACGCACGGCGCGAGTAAATCGATCATGGTACTGTGGCTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Interfering with the biofilm formation via abolishing the motility and quorum sensing. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1354 | 32981012 | 2020 | Inhibition of enteropathogenic Escherichia coli biofilm formation by DNA aptamer | SELEX 8 colony 7 | CCGGAATTCCTAATACGACTCGGTTCCGGTAAGATTAGATCATAACGTATGGCTAGCGCCATATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Interfering with the biofilm formation via abolishing the motility and quorum sensing. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1355 | 32981012 | 2020 | Inhibition of enteropathogenic Escherichia coli biofilm formation by DNA aptamer | SELEX 9 colony 3 | CCGGAATTCCTAATACGACTCGAAAACGTACCACTGGGATGGGTTGTGGGAGAGGGCCAGGTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Interfering with the biofilm formation via abolishing the motility and quorum sensing. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1356 | 32981012 | 2020 | Inhibition of enteropathogenic Escherichia coli biofilm formation by DNA aptamer | SELEX 10 colony 10 | CCGGAATTCCTAATACGACTCATCCAGCAGATGTGCGCGGGTTGGTGGGGGAACGGTGGGATATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Interfering with the biofilm formation via abolishing the motility and quorum sensing. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1357 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20–5 | GCAATGGTACGGTACTTCC-ATTTCGCCCCCGTGTTCCGACTGGTATCTTCACGTCTTCGAGTGT-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | 3.9 ± 0.6 nM | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1358 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20–7 | GCAATGGTACGGTACTTCC-CGCAATACCAAAGTGGCGAGAGCGCTGTCTTGAGTGAGTGGTTGG-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | 8 ± 0.9 nM | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1359 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20–10 | GCAATGGTACGGTACTTCC-TATGGCGTGGCAAGCTTGGCCCGCTTCTCAAGCATGGTTATCTAC-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | 10.1 ± 1.7 nM | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1360 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20-1 | GCAATGGTACGGTACTTCC-GATTAGCTACATTTGGTTGTTTACCGCTCTGCTTTCTATTATTT-CAAAAGTGCACGCTACTTTGCTAA | 87 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | N/A | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1361 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20-2 | GCAATGGTACGGTACTTCC-TGTTAGTGTTTAAGGCCCAAAGTCGGTTCATCAGTACATTCCTCG-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | N/A | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1362 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20-3 | GCAATGGTACGGTACTTCC-TTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAA-CAAAAGTGCACGCTACTTTGCTAA | 85 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | N/A | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1363 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20-4 | GCAATGGTACGGTACTTCC-GATTGTGGTGGGGCCTCGAGATACCTGCGACCGGCATACTTGAAT-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | N/A | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1364 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20-6 | GCAATGGTACGGTACTTCC-TTGCCCGTACACTGTCATCCTCGGCTTATAGCCATTATTGAAATT-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | N/A | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1365 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20-8 | GCAATGGTACGGTACTTCC-GGGCCTATACAGGCTTTTACTTCTGAGTTTGGTAGTTTCTTCGGA-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | N/A | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1366 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20-9 | GCAATGGTACGGTACTTCC-GCGAGGGCCAACGGTGGTTACGTCGCTACGGCGCTACTGGTTGAT-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | N/A | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1367 | 32499557 | 2020 | Identification of two aptamers binding to Legionella pneumophila with high affinity and specificity | R10C5 | GCAATGGTACGGTACTTCCGGACAGTGCTGAAAACTGTGACCCCCCAAAAGTGCACGCTACTTTGCTAA | 69 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Legionella Pneumophila (Lp 120292) | Whole cell | Identify an aptamer against Lp and utilise it as a biorecognition element in a biosensor to detect Lp in real-time and in situ. | Around 60% of lp120292 cells are stained by R10C5 and 20% of Pseudomonas strains. | 10 | Flow Cytometry | 116 nM | Biosensor | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | Patent application no US 16/850,355 |
| ABdb_1368 | 32499557 | 2020 | Identification of two aptamers binding to Legionella pneumophila with high affinity and specificity | R10C1 | GCAATGGTACGGTACTTCCCCACCCCACGCTGCTCCCAAAAGTGCACGCTACTTTGCTAA | 60 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Legionella Pneumophila (Lp 120292) | Whole cell | Identify an aptamer against Lp and utilise it as a biorecognition element in a biosensor to detect Lp in real-time and in situ. | R10C1 shows significantly more binding to Lp than to Pseudomonas. | 10 | Flow Cytometry | 135 nM | Biosensor | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | Patent application no US 16/850,355 |
| ABdb_1369 | 32792573 | 2020 | Electrical antimicrobial susceptibility testing based on aptamer-functionalized capacitance sensor array for clinical isolates | Aptamer 1 | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (U433, U556-ESBL, B12327, U5307, U6267-ESBL) | Whole cell | Electrical AST (e-AST) chips composed of 60 aptamer-functionalized capacitance sensors to detect bacteria and measure the antibiotic susceptibility to 11 antibiotics at five different concentrations. | The discrepancies between e-AST and BMD tests were estimated to be 2.20% mE, 0.38% ME, and 0.38%, which are lower than the FDA requirements (mE ≤ 10%, ME ≤ 3%, and VME ≤ 1.5%). | N/A | N/A | N/A | Diagnostic | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1370 | 32792573 | 2020 | Electrical antimicrobial susceptibility testing based on aptamer-functionalized capacitance sensor array for clinical isolates | Aptamer 2 | TACATGGTCAACCAAATTCTTGCAAATTCTGCATTCCTACTGT | 43 | N/A | ssDNA | Acinetobacter Baumannii (P762, T800, R4197, R4299, R4356) | Whole cell | Electrical AST (e-AST) chips composed of 60 aptamer-functionalized capacitance sensors to detect bacteria and measure the antibiotic susceptibility to 11 antibiotics at five different concentrations. | The discrepancies between e-AST and BMD tests were estimated to be 2.20% mE, 0.38% ME, and 0.38%, which are lower than the FDA requirements (mE ≤ 10%, ME ≤ 3%, and VME ≤ 1.5%). | N/A | N/A | N/A | Diagnostic | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1371 | 32792573 | 2020 | Electrical antimicrobial susceptibility testing based on aptamer-functionalized capacitance sensor array for clinical isolates | Aptamer 3 | N/A | N/A | 5'-GCAATGGTACGGTACTTCC-(N45)-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Klebsiella Pneumoniae (PAE1, PAE2, PAE3, PAE4, PAE5) | Whole cell | Electrical AST (e-AST) chips composed of 60 aptamer-functionalized capacitance sensors to detect bacteria and measure the antibiotic susceptibility to 11 antibiotics at five different concentrations. | The discrepancies between e-AST and BMD tests were estimated to be 2.20% mE, 0.38% ME, and 0.38%, which are lower than the FDA requirements (mE ≤ 10%, ME ≤ 3%, and VME ≤ 1.5%). | N/A | N/A | N/A | Diagnostic | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1372 | 32792573 | 2020 | Electrical antimicrobial susceptibility testing based on aptamer-functionalized capacitance sensor array for clinical isolates | Aptamer 4 | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (KP1-ESBL, KP2-ESBL, KP3, KP4-ESBL, KP5-ESBL) | Whole cell | Electrical AST (e-AST) chips composed of 60 aptamer-functionalized capacitance sensors to detect bacteria and measure the antibiotic susceptibility to 11 antibiotics at five different concentrations. | The discrepancies between e-AST and BMD tests were estimated to be 2.20% mE, 0.38% ME, and 0.38%, which are lower than the FDA requirements (mE ≤ 10%, ME ≤ 3%, and VME ≤ 1.5%). | N/A | N/A | N/A | Diagnostic | N/A | 3'-Thiolated (SH-(CH2)3) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1373 | 32792573 | 2020 | Electrical antimicrobial susceptibility testing based on aptamer-functionalized capacitance sensor array for clinical isolates | Aptamer 5 | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (P101, T82, C970, R4308, R4319) | Whole cell | Electrical AST (e-AST) chips composed of 60 aptamer-functionalized capacitance sensors to detect bacteria and measure the antibiotic susceptibility to 11 antibiotics at five different concentrations. | The discrepancies between e-AST and BMD tests were estimated to be 2.20% mE, 0.38% ME, and 0.38%, which are lower than the FDA requirements (mE ≤ 10%, ME ≤ 3%, and VME ≤ 1.5%). | N/A | N/A | N/A | Diagnostic | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1374 | 32792573 | 2020 | Electrical antimicrobial susceptibility testing based on aptamer-functionalized capacitance sensor array for clinical isolates | Aptamer 6 | ATCCAGAGTGACGCAGCACGACACGTTAGGTTGGTTAGGTTGGTTAGTTTCTTGTGGACACGGTGGCTTA | 70 | N/A | ssDNA | Enterococcus Faecalis (R1238, U554, U5179, U4879, U5064) | Whole cell | Electrical AST (e-AST) chips composed of 60 aptamer-functionalized capacitance sensors to detect bacteria and measure the antibiotic susceptibility to 11 antibiotics at five different concentrations. | The discrepancies between e-AST and BMD tests were estimated to be 2.20% mE, 0.38% ME, and 0.38%, which are lower than the FDA requirements (mE ≤ 10%, ME ≤ 3%, and VME ≤ 1.5%). | N/A | N/A | N/A | Diagnostic | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1383 | 32291246 | 2020 | Dual aptamer assay for detection of Acinetobacter baumannii on an electromagnetically-driven microfluidic platform | Aptamer | ACAGCACCACAGACCACATATCACATGCTGTCGCCTTGCGATATCAATTCCAGTGATGTTTGTCTTCCTGCC | 72 | N/A | ssDNA | Acinetobacter Baumannii | Whole cell | Dual aptamer assay to diagnose AB by using an electromagnetically-driven microfluidic system. | Within 30 minutes, a limit of detection of only 100 CFU/reaction and a range of 10^2 to 10^5 CFU/reaction was obtained. | N/A | N/A | 6.8 ± 1.9 nM | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1384 | 32993865 | 2020 | A universal signal-on electrochemical assay for rapid on-site quantitation of vibrio parahaemolyticus using aptamer modified magnetic metal-organic framework and phenylboronic acid-ferrocene co-immobilized nanolabel | Aptamer | TTTTTTTTTCAACGAAACAGTGACTCGTTG | 30 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a signal-on type electrochemical aptasensor (Fe3O4@NMOF-Apt) to rapidly and on-site detect V.P. | Detects V.P in the range of 10–10(9) cfu/mL with an LOD of 3 cfu/mL and within only 20 min. | N/A | Linearized adsorption isotherm | 16.8 nM (with V.P.) and 2.2 ± 0.2 nM (with Fe3O4@NMOF-Apt) | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | No significant difference in the measured blank and signals was observed over 3 months with aptasensor, when 91.3% of the initial signal was obtained. | N/A | N/A | N/A |
| ABdb_1385 | 32905329 | 2020 | Simple Colorimetric Assay for Vibrio parahaemolyticus Detection Using Aptamer-Functionalized Nanoparticles | V.P. Aptamer | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a visual colorimetric assay using aptamer-conjugated MNPs and AuNPs for the detection of V. parahaemolyticus. | Shows a linear range of 10-10(6) cfu/mL, with a limit of detection of 2.4 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) or Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1386 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF501 | TAGGGAAGAGAAGGACATATGAT-TTTCTCAACGGGACCATCACTTACCTCAAGTACTTGGACG-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1387 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF502 | TAGGGAAGAGAAGGACATATGAT-CCGGCTATCTCCCTACCGTGGCCGAGTACCTCAAACGTTT-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1388 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF503 | TAGGGAAGAGAAGGACATATGAT-GTCAACTCATTTATGGTGCTCCTCGTACCTCAGGTGGTTA-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1389 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF504 | TAGGGAAGAGAAGGACATATGAT-GGCCATACCTCGTGCCTTCTGTGATCATCTCTATCAATTG-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1390 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF505 | TAGGGAAGAGAAGGACATATGAT-CCTCTCTCTTACTGCTACTGGGCAGGGTACTCAATTACGT-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1391 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF506 | TAGGGAAGAGAAGGACATATGAT-CGGTCCCGACTCAATATTGTTCCCTCCCCTTATCAGGCGG-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1392 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF507 | TAGGGAAGAGAAGGACATATGAT-TCCTCTAATCAACTCTATGCCTTATCCCCTTGGTCAGGAC-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1393 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF508 | TAGGGAAGAGAAGGACATATGAT-ACTGGCCTTGACACCCTGTTGTGGCTTGATGACAATAACA-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | EF508 exhibited more than 20- to 800-fold higher binding to E. faecalis target cells than to non-target cells. | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 37 ± 4 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1394 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF509 | TAGGGAAGAGAAGGACATATGAT-CCTCACTCTTGACCCAAAGTGCATGCTCTATTCATTCGGA-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1395 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF510 | TAGGGAAGAGAAGGACATATGAT-GCTTCTGTGCACATTAAGGCACTCGTCTTCACTGTGGTTC-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1396 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF511 | TAGGGAAGAGAAGGACATATGAT-CCTAACTCACTTACCAGCACGAGGTGCCTGTACCATCAAT-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1397 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF512 | TAGGGAAGAGAAGGACATATGAT-CTCTCATCACAGGAATTTGAATTTCCCTTGTGGACAGTAA-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1398 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF513 | TAGGGAAGAGAAGGACATATGAT-GATGTGAATTCCGTCCCTTGGTCAGACACTTCAACACCGG-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1399 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF514 | TAGGGAAGAGAAGGACATATGAT-TCTCGACGCTATGATCAAGACGCAGTATGATGGCACATCA-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1400 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF515 | TAGGGAAGAGAAGGACATATGAT-TTAACCCTCATTTAATGGCCGCGTCAATCCGCAAAGGGTC-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1401 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF516 | TAGGGAAGAGAAGGACATATGAT-TTCCTTCGCAGGACACCGATGGCCAGGCGCGAGTCAATAT-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1402 | 32037808 | 2020 | Gold Nanobones Enhanced Ultrasensitive Surface-Enhanced Raman Scattering Aptasensor for Detecting Escherichia coli O157:H7 | Apt-1 | AAAAAAAAAAAAAAAAAAAACCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 62 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 43888) | Whole cell | Developed a one-pot step method based on capture probe (MNPs + Apt-2) and the signal probe (GNR(Apt‑1+RhB)) for SERS detection of E. coli O157:H7. | Exhibited a linear range of 10-10,000 cfu/mL with a limit of detection of 3 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1403 | 32037808 | 2020 | Gold Nanobones Enhanced Ultrasensitive Surface-Enhanced Raman Scattering Aptasensor for Detecting Escherichia coli O157:H7 | Apt-2 | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 43888) | Whole cell | Developed a one-pot step method based on capture probe (MNPs + Apt-2) and the signal probe (GNR(Apt‑1+RhB)) for SERS detection of E. coli O157:H7. | Exhibited a linear range of 10-10,000 cfu/mL with a limit of detection of 3 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1404 | 32685985 | 2020 | Electrochemical aptasensor using boron-carbon nanorods decorated by nickel nanoparticles for detection of E. coli O157:H7 | Anti-E. coli O157:H7 aptamer | ATCCAGAGTGACGCAGCA-GGGTGGCGAGACTGGGCGGGTGTCGGGAAGTGAACCGGTGGCGTG-TGGACACGGTGGCTTAGT | 81 | 5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Developed a label-free impedimetric aptasensor for the detection of E. coli O157:H7 employing boron-carbon nanorods decorated by nickel nanoparticles (BC-Ni) nanostructured platform. | Detect E. coli O157:H7 selectively with a detection limit of 10 cfu and a dynamic detection range of 10(0) to 10(5) cfu in water, juice, and faecal samples. | 15 | Bio-Layer Interferometry (BLI) | 69.73 nM | Biosensor | Microtiter Plate-based Cell SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1405 | 32810775 | 2020 | Highly adaptable and sensitive FRET-based aptamer assay for the detection of Salmonella paratyphi A | Sal 1 | ATTAGTCAAGAGGTAGACGCACATAAGGGGTCTGGTGTCGGGCCGCGGGTCAGGGGGGTAAGGGATTCTGGTCGTCGTGACTCCTAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Paratyphi A (ATCC 9150) | Whole cell | Identify an aptamer and develop a GO/CdTeQDaptamer-based FRET assay for the detection of Salmonella paratyphi A. | The detection limit was 10 CFU/mL within 15 min with no cross-reactivity with other bacterial species. | 11 | Indirect ELASA (aptamer linked immunosorbent assay) | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1406 | 32810775 | 2020 | Highly adaptable and sensitive FRET-based aptamer assay for the detection of Salmonella paratyphi A | Sal 2 | ATTAGTCAAGAGGTAGACGCACATAAGGAGTCACGACGACCAGAAACGTTTGCGGTGTTGAGCGGTTCTGGTCGTCGTGACTCCTAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Paratyphi A (ATCC 9150) | Whole cell | Identify an aptamer and develop a GO/CdTeQDaptamer-based FRET assay for the detection of Salmonella paratyphi A. | The detection limit was 10(3) CFU/mL. | 11 | Indirect ELASA (aptamer linked immunosorbent assay) | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1407 | 32810775 | 2020 | Highly adaptable and sensitive FRET-based aptamer assay for the detection of Salmonella paratyphi A | Sal 3 | ATTAGTCAAGAGGTAGACGCACATAACGGCGGCAGCGAGGGCGAACCAGGGGGGGCACACCGAGCTTCTGGTCGTCGTGACTCCTAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Paratyphi A (ATCC 9150) | Whole cell | Identify an aptamer and develop a GO/CdTeQDaptamer-based FRET assay for the detection of Salmonella paratyphi A. | N/A | 11 | Indirect ELASA (aptamer linked immunosorbent assay) | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1408 | 32810775 | 2020 | Highly adaptable and sensitive FRET-based aptamer assay for the detection of Salmonella paratyphi A | Sal 4 | ATTAGTCAAGAGGTAGACGCACATAAGTATTTAGCGAACTCGCGGAGGTTCAGTAAAGAATGTACTTCTGGTCGTCGTGACTCCTAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Paratyphi A (ATCC 9150) | Whole cell | Identify an aptamer and develop a GO/CdTeQDaptamer-based FRET assay for the detection of Salmonella paratyphi A. | N/A | 11 | Indirect ELASA (aptamer linked immunosorbent assay) | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1409 | 32810775 | 2020 | Highly adaptable and sensitive FRET-based aptamer assay for the detection of Salmonella paratyphi A | Sal 5 | ATTAGTCAAGAGGTAGACGCACATAGCCACTCGACCCGCCAGAAACGGCGACAGGATGGCCGCGGTTCTGGTCGTCGTGACTCCTAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Paratyphi A (ATCC 9150) | Whole cell | Identify an aptamer and develop a GO/CdTeQDaptamer-based FRET assay for the detection of Salmonella paratyphi A. | N/A | 11 | Indirect ELASA (aptamer linked immunosorbent assay) | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1410 | https://doi.org/10.1007/s12161-020-01821-4 | 2020 | Fluorescent Turn-on Aptasensor of Staphylococcus aureus Based on the FRET Between Green Carbon Quantum Dot and Gold Nanoparticle | Staphylococcus aureus aptamer | GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT | 45 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed FRET-based aptasensor with CQDs and GNPs for the detection of S. aureus. | Linear detection range of 10⁸ to 10¹ CFU/mL with a detection limit (LOD) of 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1411 | 32892935 | 2020 | Naked-eye based point-of-care detection of E.coli O157: H7 by a signal-amplified microfluidic aptasensor | Anti-E.coli O157: H7 aptamer | ATCCGTCACACCTGCTCTGTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCGTGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (BNCC 191201) | Whole cell | Developed an eye-based aptasensor (EA-Sensor) for the detection of E.coli O157:H7. | Display a linear range of 500–5 × 10(7) CFU/mL and LOD of 250 CFU/mL and 400 CFU/mL for buffered and milk samples. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1412 | https://doi.org/10.1111/jfs.12868 | 2020 | Ultrasensitive detection of Listeria monocytogenes using solid-state electrochemiluminescence biosensing based on the quenching effect of ferrocene on ruthenium pyridine | Aptamer (ssDNA) | ATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT | 47 | N/A | ssDNA | Listeria Monocytogenes (ATCC 19115, Serotype 4 b) | Whole cell | Developed an ECL biosensing switch system based on the specific recognition of an aptamer and the destruction of pyridine ruthenium by ferrocene for the detection of L. monocytogenes. | Produced a good linear relationship over the concentration range of 1.4 × 10(1)–1.4 × 10(6) CFU/ml and a detection limit of 4 CFU/ml. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1413 | https://doi.org/10.3390/IECB2020-07079 | 2020 | Detection of Listeria innocua by Acoustic Aptasensor | Aptamer | TACTATCGCGGAGACAGCGCGGGAGGCACCGGGGA | 35 | N/A | ssDNA | Listeria Innocua | Whole cell | QCM-based aptasensor for the detection of pathogenic bacteria Listeria innocua. | The achieved limit of detection was approximately 1.6 × 10(3) CFU/mL and broad range of 5 × 10(3)-10(6) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1414 | https://doi.org/10.1016/j.foodcont.2020.107808 | 2020 | Development of a fluorescence aptasensor for rapid and sensitive detection of Listeria monocytogenes in food | L. monocytogenes Aptamer | GGGAGCTCAGAATAAACGCTCAATACTATCGCGGGACAGCGCGGGAGGCACCGGGGATTCGACATGAGGCCCGGATC | 77 | N/A | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | A fluorescence aptasensor based on aptamer-UCNP and aptamer-MNP complex was developed for the detection of L. monocytogenes. | A low limit of detection of 8 cfu/mL was estimated from the range of 68 to 68 × 10(6) cfu/mL. | N/A | N/A | 48.74 ± 3.11 nM | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1415 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V8 | AGTATACGTATTACCTGCAGC-CAATCATGACCGCCCACCTCACTCG-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell (Cell wall protein) | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | The LOD of the V8 from cytometry is 29.96 CFU/mL, and the linear range is 102–5 × 105 CFU/mL. | 13 | Flow Cytometry | 11.22 ± 1.30 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | V8 and V13 can tolerate diluted serum as well as oyster infusion. | Best Candidate | N/A | N/A |
| ABdb_1416 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V9 | AGTATACGTATTACCTGCAGC-CCTGGACATCATTGAGTACTCGTCT-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1417 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V11 | AGTATACGTATTACCTGCAGC-TCCCAACCAATACCAGTACGTTGTA-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1418 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V12 | AGTATACGTATTACCTGCAGC-TATGGATTTGCGTCATGTTTATGTG-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1419 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V13 | AGTATACGTATTACCTGCAGC-CCAACCCTATGCTTCAACGGTCTTT-GCAAAGATCTCCGAGATATCG | 67 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | 15.47 ± 0.39 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | V8 and V13 can tolerate diluted serum as well as oyster infusion. | Best Candidate | N/A | N/A |
| ABdb_1420 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V18 | AGTATACGTATTACCTGCAGC-TGTGGGTGGGTGGGTGGTATCTGCA-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1421 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V20 | AGTATACGTATTACCTGCAGC-CATCCCCTCTCCTGTTGCCCTGACA-GCAAAGATCTCCGAGATATCG | 67 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1422 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V28 | AGTATACGTATTACCTGCAGC-CCTGGACATCATTGAGTACTCGTCT-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1423 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V31 | AGTATACGTATTACCTGCAGC-TGTGGGTGGGATTAGGTTCGGGTGG-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1424 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V38 | AGTATACGTATTACCTGCAGC-CCAGACTTCAATCGCGTCAACCGTT-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1425 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V39 | AGTATACGTATTACCTGCAGC-TGATGGTTGTATGACTGGATGTCAA-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1426 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V40 | AGTATACGTATTACCTGCAGC-TCCCCTTTGCATGGCGGTGACACTG-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1427 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V41 | AGTATACGTATTACCTGCAGC-CACCTAGAACACATTGCAACATTAG-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1428 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V44 | AGTATACGTATTACCTGCAGC-TGCTCCTCGACTGTTGTTAATCGTG-GCAGATCTCCGAGATATCG | 65 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1429 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V49 | AGTATACGTATTACCTGCAGC-TGACATCGTCTGACCTCCACAAGCA-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1430 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V53 | AGTATACGTATTACCTGCAGC-TGGGTCCGTATGTTGGTGTATGTGA-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1431 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V59 | AGTATACGTATTACCTGCAGC-TGTATACCCGACCGTACCGACGTAA-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1432 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V69 | AGTATACGTATTACCTGCAGC-TCACCTTCACACACTCCCTTCTTCG-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1433 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V71 | AGTATACGTATTACCTGCAGC-CCTGTACAAGCAGTATGTCAGCTGA-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1434 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | TV8 | CAATCATGACCGCCCACCTCACTCG | 25 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | The fluorescent intensity of V. vulnificus was significantly greater than that of other species. | 13 | Flow Cytometry | 17.44 ± 1.30 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1435 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | TV13 | CCAACCCTATGCTTCAACGGTCTTT | 25 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | The fluorescent intensity of V. vulnificus was significantly greater than that of other species. | 13 | Flow Cytometry | 13.21 ± 2.19 nm | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1436 | 32350613 | 2020 | A fluorescent aptasensor for Staphylococcus aureus based on strand displacement amplification and self-assembled DNA hexagonal structure | Aptamer | CACACCGCAGCAGTGGGAACGTTTCAGCCATGCAAGCATCACGCCCGT | 48 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | A fluorescent aptasensor based on MB-apt-cDNA duplex for S. aureus in milk samples. | Exhibits a broad linear range from 7 to 7 × 10(7) CFU/mL, with a detection limit of 1.7 CFU/mL for S. aureus. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1437 | 32594319 | 2020 | SiC-functionalized fluorescent aptasensor for determination of Proteus mirabilis | Aptamer | TTGCTGTAGGGGAGGAGGGTGGGT | 24 | N/A | ssDNA | Proteus Mirabilis (ATCC 12453) | Whole cell | Developed a fluorescent aptasensor based on aptamer-modified SiC quantum dots (DNA-SiC QDs) for the determination of Proteus mirabilis. | The linear range is from 10(3) to 10(8) CFU/mL, and the limit of detection is 526 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1438 | 32070611 | 2020 | Rapid and sensitive detection of Salmonella Typhimurium using nickel nanowire bridge for electrochemical impedance amplification | Aptamer | CAGTCCAGGACAGATTCGCGAGCCCACTCCAAACACGACCAACTCACGCTCTATCAACATCGCTATCCACGTGGATTTCATTCAGCGATT | 90 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Developed an electrochemical aptasensor using an aptamer-coated gold interdigitated microelectrode and antibody-modified NiNWs to detect Salmonella typhimurium. | This electrochemical aptasensor quantitatively detected Salmonella at concentrations ranging from 10(2) to 10(6) CFU/mL within 2 h, with a detection limit of 80 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1440 | 31655050 | 2020 | Rapid and sensitive detection of Salmonella with reduced graphene oxide-carbon nanotube based electrochemical aptasensor | S. Typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Develop a biosensor using reduced graphene oxide-carbon nanotubes (rGO-CNT) nanocomposite via the hydrothermal method for label-free electrochemical detection of S. enterica. | Display a wide linear dynamic range from 10(1) until 10(8) cfu/mL with a 10(1) cfu/mL of the limit of detection. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | ssDNA/rGO-CNT/GCE aptasensor showed good to excellent stability when stored for 20 days in ultrapure water at 4°C. | N/A | N/A | N/A |
| ABdb_1444 | 32724645 | 2020 | Selection of aptamers targeted to food-borne pathogenic bacteria Vibrio parahaemolyticus | S.184004.T1.01 (ID 5) | TTTTTAAGCCCACAGACGWYCGGCAGGCACAGTYYGTCAAGGXCGYGCCATG | 52 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify high‐affinity aptamers that specifically recognize Vp. | N/A | 2 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | AM X‐aptamer kit | W = indole‐dU,Y = phenol‐dU,X = amine‐dU, five additional Ts at the 5'‐end, and 3'-CCATG | N/A | N/A | N/A | N/A | N/A |
| ABdb_1445 | 32724645 | 2020 | Selection of aptamers targeted to food-borne pathogenic bacteria Vibrio parahaemolyticus | S.184004.T1.02 (ID 6) | TTTTTAAGCCCACCYCGCYGTGCAAGGCGAACGCCATCAGTGTGGGCCCATG | 52 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify high‐affinity aptamers that specifically recognize Vp. | N/A | 2 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | AM X‐aptamer kit | Y = phenol‐dU, five additional Ts at the 5'‐end, and 3'-CCATG | N/A | N/A | N/A | N/A | N/A |
| ABdb_1446 | 32724645 | 2020 | Selection of aptamers targeted to food-borne pathogenic bacteria Vibrio parahaemolyticus | S.184004.T1.03 (ID 7) | TTTTTAAGCCCACCYCCGWYCGAAGGCCACAGCYCATGCGCGTGGGCCCATG | 52 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify high‐affinity aptamers that specifically recognize Vp. | N/A | 2 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | AM X‐aptamer kit | Y = phenol‐dU,W = indole‐dU, five additional Ts at the 5'-end, and 3'-CCATG | N/A | N/A | N/A | N/A | N/A |
| ABdb_1447 | 32724645 | 2020 | Selection of aptamers targeted to food-borne pathogenic bacteria Vibrio parahaemolyticus | S.184004.T1.04 (ID 8) | TTTTTAACACGACCCCACYGTGCGAGCCGAACACCACCACGGTGGGCCCATG | 52 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify high‐affinity aptamers that specifically recognize Vp. | N/A | 2 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | AM X‐aptamer kit | Y = phenol‐dU, five additional Ts at the 5'‐end, and 3'-CCATG | N/A | N/A | N/A | N/A | N/A |
| ABdb_1448 | 32724645 | 2020 | Selection of aptamers targeted to food-borne pathogenic bacteria Vibrio parahaemolyticus | S.184004.T1.05 (ID 9) | TTTTTAACACGACXYAGCYGTGWGGGCCGAACACCAGGCACGTGGGCCCATG | 52 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify high‐affinity aptamers that specifically recognize Vp. | N/A | 2 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | AM X‐aptamer kit | X = amine‐dU,Y = phenol‐dU, five additional Ts at the 5'‐end, and CCATG at the 3′‐end, five additional Ts at the 5′‐end, and 3'-CCATG | N/A | N/A | N/A | N/A | N/A |
| ABdb_1449 | 32724645 | 2020 | Selection of aptamers targeted to food-borne pathogenic bacteria Vibrio parahaemolyticus | S.184004.T1.06 (ID 12) | TTTTTAACACGACAGCAGWYCGGCGGGCACAGTGCGTGCGAGXCGYGCCATG | 52 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify high‐affinity aptamers that specifically recognize Vp. | Aptamer ID 12 showed specific binding to Vp. | 2 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | AM X‐aptamer kit | W = indole‐dU,Y = phenol‐dU,X = amine‐dU, five additional Ts at the 5'‐end, and 3'-CCATG | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1450 | 32724645 | 2020 | Selection of aptamers targeted to food-borne pathogenic bacteria Vibrio parahaemolyticus | S.184004.T1.07 (ID 13) | TTTTTAACACGACCAWACYGTGGCAGACGAACGCCGTCACAGTGGGCCCATG | 52 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify high‐affinity aptamers that specifically recognize Vp. | N/A | 2 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | AM X‐aptamer kit | Y = phenol‐dU,W = indole‐dU, five additional Ts at the 5'‐end, and 3'-CCATG | N/A | N/A | N/A | N/A | N/A |
| ABdb_1451 | 32724645 | 2020 | Selection of aptamers targeted to food-borne pathogenic bacteria Vibrio parahaemolyticus | S.184004.T1.08 (ID 14) | TTTTTAAGCCCACGCGGCYGTGAGXCGCACAGCCAWAGCACGTGGGCCCATG | 52 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify high‐affinity aptamers that specifically recognize Vp. | N/A | 2 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | AM X‐aptamer kit | W = indole‐dU,Y = phenol‐dU,X = amine‐dU, five additional Ts at the 5'‐end, and 3'-CCATG | N/A | N/A | N/A | N/A | N/A |
| ABdb_1452 | 32724645 | 2020 | Selection of aptamers targeted to food-borne pathogenic bacteria Vibrio parahaemolyticus | S.184004.T1.09 (ID 15) | GCCCACTGAACTGTGGCGGGCACAGGATGTGGAAGTGGGC | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify high‐affinity aptamers that specifically recognize Vp. | N/A | 2 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | AM X‐aptamer kit | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1462 | 32663006 | 2020 | Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in Food | CJA1 | CTGCGATCAAGTTACGCACCTCGCCATGTTCCCCGCCCGGCATGTGTTATGCCCCTGTG | 59 | 5'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3' | ssDNA | Campylobacter Jejuni | Whole cell | Identify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples. | C. jejuni can be detected from 1.7 × 10(1) to 1.7 × 10(6) CFU/mL. The limit of detection (LOD) is obtained as 10 CFU/mL in PBS and 13 CFU/mL in contaminated milk samples. | 12 | Fluorescence Binding Assay | 1.37 ± 0.28 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1463 | 32663006 | 2020 | Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in Food | CJA2 | GTTGGGTGCGGCGGGAGGGTCCCATCGGAAACCAAGCTGTGCTGAGATTTTTCCGCGAT | 59 | 5'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3' | ssDNA | Campylobacter Jejuni | Whole cell | Identify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples. | N/A | 12 | Fluorescence Binding Assay | 1.78 ± 0.88 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1464 | 32663006 | 2020 | Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in Food | CJA3 | CACGCAAGTTAATCAGCGTGACATCAGGTCTAGATTCCGGCTTATAGCGCCAGGTTTCC | 59 | 5'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3' | ssDNA | Campylobacter Jejuni | Whole cell | Identify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples. | N/A | 12 | Fluorescence Binding Assay | 2.01 ± 0.90 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1465 | 32663006 | 2020 | Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in Food | CJA4 | GGTGGGCTCTGTTCGGGAGGGGTATTGTTAGGACCGAGAGGCTGCATTCCGCCAGCTGC | 59 | 5'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3' | ssDNA | Campylobacter Jejuni | Whole cell | Identify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples. | N/A | 12 | Fluorescence Binding Assay | 2.26 ± 0.91 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1466 | 32663006 | 2020 | Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in Food | CJA5 | GCTCTGTCTTTTCAGCTTTATCCGGGTGTGGTGGGGGGGGGATTTGCTTGGTCGGTTCT | 59 | 5'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3' | ssDNA | Campylobacter Jejuni | Whole cell | Identify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples. | N/A | 12 | Fluorescence Binding Assay | 3.53 ± 1.38 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1468 | 32095939 | 2020 | A fluorometric assay for rapid enrichment and determination of bacteria by using zirconium-metal organic frameworks as both capture surface and signal amplification tag | Ab-Apt | TACATGGTCAACCAAATTCTTGCAAATTCTGCATTCCTACTGT | 43 | N/A | ssDNA | Acinetobacter Baumannii | Whole cell | A fluorometric assay was developed to determine A. baumannii in blood samples by utilizing Zr-MOFs as capture probe (denoted as Zr-mMOF-p-Ab-Apt) and signal probe (denoted as F@UIO-66-NH2-p-LPS-Apt). | The limit of detection of A. baumannii in blood samples is 10 cfu/mL with a linear range of 10(1)–10(5) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Phosphate and 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1475 | 32774812 | 2020 | Point-of-care detection of Escherichia coli O157:H7 in water using AuNPs-based aptasensor | Apt 2 | ATCAAATGTGCAGATATCAAGACGATTTGTACAAGAT | 37 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (EHEC) (NTCC 12900) | Whole cell | Developed an aptamer-based AuNPs bioassay to detect EHEC in contaminated water. | Exhibited a good linear response over a wide concentration range of 876 to 107 CFU/mL and a low detection limit (LOD) of 263 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1476 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap1 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 18.10 ± 6.2 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1477 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap2 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 13.38 ± 3.8 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1478 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap3 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 11.46 ± 4.1 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1479 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap4 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 14.18 ± 4.3 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1480 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap5 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 21.78 ± 9.2 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1481 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap6 | TAGGGAAGAGAAGGACATATGAT-GCGCTGTGCGGATGTCATGATGTGCCTCTTCCCTGTGTCCGC-TTGACTAGTACATGACCACTTGA | 88 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | The detection limit of this aptasensor was as low as 10(5) CFU/ml within 10 minutes and a linear range of 10(5)-10(8) CFU/ml. | 10 | Flow Cytometry | 9.82 ± 3.6 nM | Biosensor | Whole Cell-SELEX | FITC Labeled | N/A | N/A | Best Candidate | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1482 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap7 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 12.85 ± 4.1 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1483 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap8 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 32.90 ± 17.4 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1484 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap9 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 12.18 ± 4.3 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1485 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap10 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 32.85 ± 12.2 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1486 | 32151909 | 2020 | Surface-enhanced Raman spectroscopic-based aptasensor for Shigella sonnei using a dual-functional metal complex-ligated gold nanoparticles dimer | S. Sonnei aptamer | TGAGCCCAAGCCCTGGTATGTTCTTCCCTTTTATTAGTCCTGTATTCCTCTACTGTTGCCGGCAGGTCTACTTTGGGATC | 80 | N/A | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Developed a SERS aptasensor using a composite material integrated with the Raman active 4-MBA ligand of the Eu-complex and citrate-stabilised Au nanoparticles (cit-Au NPs) for the detection of S. sonnei. | Showed a good linear relationship in the range of 10–10(6) cfu/mL with a limit of detection (LOD) as low as 10 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1487 | 32347530 | 2020 | A sensitive and rapid bacterial antibiotic susceptibility test method by surface enhanced Raman spectroscopy | E. coli O157:H7 aptamer | GCAATGGTACGGTACTTCCCGCAGTTTGGGAAGGGTGATCGCACTATCAGAGGATTCCGTTCGGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (CICC: 21530) | Whole cell | Developed a rapid antibiotic susceptibility test (AST) method and determined the MIC value by the Bacteria-aptamer@AgNPs-SERS method. | When treated with 2(−3) μg/mL tigecycline for 1 h, the Raman peak intensity of E. coli O157: H7 was 882 a.u., and when the concentration of antibiotics was sub-MIC (2(−4) and 2(−5) μg/mL), the peak value of 735 cm−1 increased, and the Raman intensity was 3382 a.u. and 4213 a.u. | N/A | N/A | N/A | Detection | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1488 | 32347530 | 2020 | A sensitive and rapid bacterial antibiotic susceptibility test method by surface enhanced Raman spectroscopy | S. aureus aptamer | TCCCTACGGCGCTAACCTCCCAACCGCTCCACCCTGCCTCCGCCTCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CICC 21600) | Whole cell | Developed a rapid antibiotic susceptibility test (AST) method and determined the MIC value by the Bacteria-aptamer@AgNPs-SERS method. | When treated with 2(−1) μg/mL vancomycin for 1 h, the Raman peak intensity of S. aureus was 556 a.u., and when the concentration of antibiotics was sub-MIC (2(−2) and 2(−3) μg/mL), the peak value of 735 cm−1 increased, and the Raman intensity was 2177 a.u. and 2903 a.u. | N/A | N/A | N/A | Detection | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1489 | https://doi.org/10.1016/j.foodcont.2019.106761 | 2020 | Designing an aptamer based magnetic and upconversion nanoparticles conjugated fluorescence sensor for screening Escherichia coli in food | E.coli aptamer | ATCCGTCACACCTGCTCTGTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCGTGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC 8739) | Whole cell | A novel upconversion fluorescence sensor using magnetic nanoparticles (MNPs) and cDNA-upconversion nanoparticles (UCNPs) for E.coli was developed. | Achieved a lower limit of detection (10 cfu/mL) in the linear range of 58–58 × 10(6) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1490 | 35516186 | 2020 | Selection of potential aptamers for specific growth stage detection of Yersinia enterocolitica | M1 | AGCAGCACAGAGGTCAGATGATATAACCTTAATAAATAAAATATAAATTATTTAATCTTACCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-40N-TTCACGGTAGCACGCATAGG-3' | ssDNA | Yersinia Enterocolitica (CICC 21669) | Whole cell | Identified aptamers bound to the different growth stages of Y. enterocolitica. | Showed good affinity to all different stages of bacteria (adjustment phase, log phase, and pre-stationary phase). | 10 | Flow Cytometry | 37.93 ± 7.88 nM | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1491 | 35516186 | 2020 | Selection of potential aptamers for specific growth stage detection of Yersinia enterocolitica | M5 | AGCAGCACAGAGGTCAGATGCTTGGTTCCACCGTACTGACTGTAGTAAAATCTGATCACTCCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-40N-TTCACGGTAGCACGCATAGG-3' | ssDNA | Yersinia Enterocolitica (CICC 21669) | Whole cell | Identified aptamers bound to the different growth stages of Y. enterocolitica. | Showed good affinity to all different stages of bacteria (adjustment phase, log phase, and pre-stationary phase). | 10 | Flow Cytometry | 74.96 ± 21.34 nM | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1492 | 35516186 | 2020 | Selection of potential aptamers for specific growth stage detection of Yersinia enterocolitica | M7 | AGCAGCACAGAGGTCAGATGTAGTCGGTCTTCTTGTTTGAAACTGCTAATTTTGAAAAAACCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-40N-TTCACGGTAGCACGCATAGG-3' | ssDNA | Yersinia Enterocolitica (CICC 21669) | Whole cell | Identified aptamers bound to the different growth stages of Y. enterocolitica. | Showed good affinity to all different stages of bacteria (adjustment phase, log phase, and pre-stationary phase). | 10 | Flow Cytometry | 73.02 ± 18.76 nM | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1494 | 32994896 | 2020 | Aptamer-nanobody based ELASA for detection of Vibrio cholerae O1 | V.ch27 | GCCTGTTGTGAGCCTCCTAAC-GGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCAC-CATGCTTATTCTTGTCTCC | 81 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Vibrio Cholerae O1 [Inaba (ATCC 39315) and Ogawa] | Whole cell | Identify aptamers and develop aptamer-nanobody-based ELISA for V. cholerae O1 detection. | The binding efficiency for V.ch27 was 53.3%. | 12 | Flow Cytometry | 20.186 ± 3.655 pM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1495 | 32994896 | 2020 | Aptamer-nanobody based ELASA for detection of Vibrio cholerae O2 | V.ch47 | GCCTGTTGTGAGCCTCCTAAC-CGTATTAGAGCTTGGCGTAATCATGGTCATAGCTGTTTC-CATGCTTATTCTTGTCTCC | 79 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Vibrio Cholerae O1 [Inaba (ATCC 39315) and Ogawa] | Whole cell | Identify aptamers and develop aptamer-nanobody-based ELISA for V. cholerae O1 detection. | Identify 10(4) CFU/ml with 25 pM of biotinylated aptamer and only 20 μg/ml of VHH without any cross-reactivity. | 12 | Flow Cytometry | 15.404 ± 4.776 pM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1496 | https://doi.org/10.1016/j.sbsr.2019.100313 | 2020 | Aptamer-NanoZyme mediated sensing platform for the rapid detection of Escherichia coli in fruit juice | Aptamer P12–31(EC 12–31 TRUNC) | CCCTCCGGGGGGGTCATCGGGATACCTGGTAAGGATA | 37 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | An aptamer and NanoZyme-based colorimetric and electrochemical assay was developed for EC detection in fruit juice. | Displayed superior linearity in the range of 10–10(9) CFUs/mL and a low-end detection limit of ~10 CFU within 5 min. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1497 | https://doi.org/10.1016/j.foodcont.2020.107281 | 2020 | A novel AuNPs colorimetric sensor for sensitively detecting viable Salmonella typhimurium based on dual aptamers | Apt1 | GAGGAAAGTCTATAGCAGAGGAGATGTGTGAACCGAGTAA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a colorimetric aptasensor based on AuNPs for visual detection of viable S. typhimurium. | Showed a linear range from 3.3 × 10(1) to 3.3 × 10(6) CFU/mL and the detection limit of 33 CFU/mL in pure culture and 95 CFU/mL in spiked milk. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1498 | https://doi.org/10.1016/j.foodcont.2020.107281 | 2020 | A novel AuNPs colorimetric sensor for sensitively detecting viable Salmonella typhimurium based on dual aptamers | Apt2 | CTCCTCTGACTGTAACCACGGAGTTAATCAATACAAGGCGGGAACATCCTTGGCGGTGCCGCATAGGTAGTCCAGAAGCC | 80 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a colorimetric aptasensor based on AuNPs for visual detection of viable S. typhimurium. | Showed a linear range from 3.3 × 10(1) to 3.3 × 10(6) CFU/mL and the detection limit of 33 CFU/mL in pure culture and 95 CFU/mL in spiked milk. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1500 | 32000058 | 2020 | A SERS aptasensor for simultaneous multiple pathogens detection using gold decorated PDMS substrate | Apt 1 | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a SERS aptasensor using Apt-Au-PDMS film for simultaneous multiple-pathogen detection. | Can selectively detect 18 cfu/mL cells. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1501 | 32000058 | 2020 | A SERS aptasensor for simultaneous multiple pathogens detection using gold decorated PDMS substrate | Apt 2 | AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a SERS aptasensor using Apt-Au-PDMS film for simultaneous multiple-pathogen detection. | Can selectively detect 27 cfu/mL cells. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1503 | 34347427 | 2021 | Aptamer-Functionalized DNA-Silver Nanocluster Nanofilm for Visual Detection and Elimination of Bacteria | Apt-G | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAACGGGTGGGGTGGGGTGGGG | 80 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | DNA-templated silver nanoclusters (N4-AgNC/Apt-G) for the visual detection and effective elimination of bacteria. | After treatment with 5 μM N4-AgNCs/Apt-G, a significantly reduced number of colonies was observed. At the lowest inhibitory concentration of 6.25 μM, the number of colonies decreased by only 4-fold, which is significantly less than the 7-fold reduction observed at 5 μM. Obtained recovery rates ranging from 88% to 115% of S. aureus. | N/A | N/A | N/A | Diagnostic/Therapeutics | N/A | N/A | N4-AgNCs/Apt-G was found to be nontoxic at low concentrations, and cell viability was more than 80% at a concentration of 6.25 μM. | N/A | N/A | N/A | N/A |
| ABdb_1525 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-2 | AAGGAGCAGCGTGGAGGTTA-CCAGGAGGACCCTATTCTCGTGTATCGACGAGATCCAGTG-ACCACGACGACACACCCTAA | 80 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | Limit of detection (LOD) of HPA-2 was 88 cfu/mL. | 9 | Fluorescence Spectroscopy | 19.3 ± 3.2 nM | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1526 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-1 | AAGGAGCAGCGTGGAGGTTA-CGCCTGATCCAGGTGCTATCTTCCGCCCTGTTTCTTTGGT-ACCACGACGACACACCCTAA | 80 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | N/A | 9 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1527 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-3 | AAGGAGCAGCGTGGAGGTTA-CTCCTCGGTCCTTTCAGGTAGACGCTCTTACGCCCTCAGT-ACCACGACGACACACCCTAA | 80 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | The binding ability order was HPA-2 > HPA-3 > HPA-5 > HPA-9. | 9 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1528 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-4 | AAGGAGCAGCGTGGAGGTTA-CGTGTATCCCCTGTGTGTTTGTACTCGGCTACTGTATCCG-ACCACGACGACACACCCTAA | 80 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | N/A | 9 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1529 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-5 | AAGGAGCAGCGTGGAGGTTA-CTCGTTTGGATACGTCATCGGTAGGACTACGGTACCTAAAC-ACCACGACGACACACCCTAA | 81 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | The binding ability order was HPA-2 > HPA-3 > HPA-5 > HPA-9. | 9 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1530 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-6 | AAGGAGCAGCGTGGAGGTTA-GCACAGGAGACAGGGGGAGATGATACTCGGCGTTTCAAGG-ACCACGACGACACACCCTAA | 80 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | N/A | 9 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1531 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-7 | AAGGAGCAGCGTGGAGGTTA-CTCGCGCCCTTCTTTCAGTAGCAGTGTACGGATCTTGCGG-ACCACGACGACACACCCTAA | 80 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | N/A | 9 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1532 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-8 | AAGGAGCAGCGTGGAGGTTA-TGCATATCGCTAGCTGATAAGCTGATGCCATCGTGTCTAC-ACCACGACGACACACCCTAA | 80 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | N/A | 9 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1533 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-9 | AAGGAGCAGCGTGGAGGTTA-GCATCTTTGAGGAATTTTCGTCAAAGGACCGAGTAACGGC-ACCACGACGACACACCCTAA | 80 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | The binding ability order was HPA-2 > HPA-3 > HPA-5 > HPA-9. | 9 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1534 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-10 | AAGGAGCAGCGTGGAGGTTA-AGTTGCTCTTGATCGTCGACCAGTCGCTATGCAGCACCCC-ACCACGACGACACACCCTAA | 80 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | N/A | 9 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1535 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-11 | AAGGAGCAGCGTGGAGGTTA-CTGCACGAATGATCCCCCGCCATGCTGTAGTTCCGTCTTA-ACCACGACGACACACCCTAA | 80 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | N/A | 9 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1536 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-12 | AAGGAGCAGCGTGGAGGTTA-CTGTAACGCCCCGCTGATTCTTTCTCAGCGTGCTAGGCGG-ACCACGACGACACACCCTAA | 80 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | N/A | 9 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1537 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-13 | AAGGAGCAGCGTGGAGGTTA-ATCGCTCCGTCCAGTAAGAGTTGCCTACAATGCCCGCCGGC-ACCACGACGACACACCCTAA | 81 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | N/A | 9 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1538 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-14 | AAGGAGCAGCGTGGAGGTTA-CAAATGAGCCTTAGAGCTGTGCAGAGTTCGAAGCTTGGTG-ACCACGACGACACACCCTAA | 80 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | N/A | 9 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1539 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-15 | AAGGAGCAGCGTGGAGGTTA-CCTCGGTGTTCGTTCTGACTACGTTCCCTGGGACCCGCGT-ACCACGACGACACACCCTAA | 80 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | N/A | 9 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1540 | 34664941 | 2021 | Efficient Eradication of Bacterial Biofilms with Highly Specific Graphene-Based Nanocomposite Sheets | S. Typhimurium aptamer (ST-NH2) | TTTTTAAGCCCACTGGCGTTCGGACATCACAGCTCGTGCAGGTCGTGCCATG | 52 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (CMCC 50115) | Whole cell | ICG@GO-Apt nanosheets for eradication of biofilm associated with Salmonella Typhimurium. | Shows an efficient biofilm elimination with an efficiency of greater than 99.99% in an abscess formation model. | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 3'-Amidation (NH₂) or TAMRA, 5'-FAM Labeled or Amidation (NH₂) | ICG@GO-Apt NSs had almost no cytotoxicity to HEK 293 cells, with more than 90% and lacked hemolytic activities. | N/A | N/A | N/A | N/A |
| ABdb_1541 | 33285125 | 2021 | An aptamer biosensor based dual signal amplification system for the detection of salmonella typhimurium | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ASI 1174) | Whole cell | Developed a signal-cascade-amplification method named “immuno-HCR-SERS” for the detection of S. typhimurium. | Highly sensitive detection showing a linear range from 10 to 10(5) CFU/mL, with a limit of detection (LOD) of 6 CFU/mL in 3.5 h. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1542 | 34828820 | 2021 | A Colorimetric Strategy Based on Aptamer-Catalyzed Hairpin Assembly for the On-Site Detection of Salmonella typhimurium in Milk | Capture aptamer (Bapt) | GAGGAAAGTCTATAGCAGAGGAGATGTGTGAACCGAGTAA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a colourimetric assay based on aptamer-catalysed hairpin assembly signal amplification strategy (Y-CHA ) for the detection of S. typhimurium in milk. | Exhibited a concentration range of 10(2) to 10(6) CFU/mL, with a sensitivity of 2.4 × 10(2) CFU/mL under optimal conditions and 2.8 × 10(3) CFU/mL in real milk samples. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1543 | 34828820 | 2021 | A Colorimetric Strategy Based on Aptamer-Catalyzed Hairpin Assembly for the On-Site Detection of Salmonella typhimurium in Milk | Target aptamer (Tapt) | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a colourimetric assay based on aptamer-catalysed hairpin assembly signal amplification strategy (Y-CHA ) for the detection of S. typhimurium in milk. | Exhibited a concentration range of 10(2) to 10(6) CFU/mL, with a sensitivity of 2.4 × 10(2) CFU/mL under optimal conditions and 2.8 × 10(3) CFU/mL in real milk samples. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1544 | 34051601 | 2021 | Sensitive detection of S. Aureus using aptamer- and vancomycin -copper nanoclusters as dual recognition strategy | Aptamer | GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT | 45 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed an aptamer- and antibiotic-based dual detection sensor, combines copper nanoclusters (CuNCs) for the detection of S. aureus. | Showed a linear range of 10(2)-10(8) CFU/mL, and a detection limit of 80 CFU/mL after 45 min. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1545 | https://doi.org/10.1016/j.electacta.2021.139633 | 2021 | A new electrochemical aptasensor based on gold/nitrogen-doped carbon nano-onions for the detection of Staphylococcus aureus | Anti-S. aureus aptamer | TCGGCACGTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTC | 43 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed an electrochemical aptasensor based on SPEs modified with AuNPs and NCNOs for the detection of S. aureus. | Measured S. aureus quickly with a limit of detection of 3 CFU/mL in the linear range of 10–10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1546 | 34660993 | 2021 | Detection of Listeria monocytogenes Using Luminol-Functionalized AuNF-Labeled Aptamer Recognition and Magnetic Separation | Aptamer | ATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT | 47 | N/A | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Developed an aptamer-linked biofunctional magnetic nanomaterial system for highly sensitive and specific LM detection. | Display a linear concentration range 1.0 × 10(1)-1.0 × 10(5) CFU/mL and detect L. monocytogenes at levels as low as 6 CFU/mL in milk samples. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1547 | 34107210 | 2021 | A Low-Field Magnetic Resonance Imaging Aptasensor for the Rapid and Visual Sensing of Pseudomonas aeruginosa in Food, Juice, and Water | Anti-P. aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Developed a low-field magnetic resonance imaging (LF-MRI) aptasensor based on the difference in magnetic behaviour of two magnetic nanoparticles with diameters of 10 (MN10) and 400 nm (MN400) for the rapid detection of P. aeruginosa. | Show a detection limit of 100 cfu/mL with a wide linear range from 3.1 × 10(2) to 3.1 × 10(7) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1548 | 34396009 | 2021 | DNA Aptamer-Conjugated Magnetic Graphene Oxide for Pathogenic Bacteria Aggregation: Selective and Enhanced Photothermal Therapy for Effective and Rapid Killing | MRSA aptamer | ATCCAGACGTGACGCAGC-ATGCGGTTGGTTGCGGTTGGGCATGATGTATTTCTGTG-TGGACACGGTGGCTTAGTA | 75 | 5'-ATCCAGACGTGACGCAGC-N38-TGGACACGGTGGCTTAGTA-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Whole cell | Apt@MGO nanoplatform for selective and rapid eradication of MRSA under NIR laser irradiation. | Apt@MGO resulted in ∼78% MRSA and over >97% MRSA cell inactivation in dispersed and aggregated states, respectively, under 200 seconds of exposure to NIR irradiation (808 nm, 1.1 W cm–2). | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 3'-Amidation (NH₂) and 5'-FITC Labeled | The aptamer itself did not cause any cell activation when incubated with MRSA cells, and also under no NIR laser illumination. | N/A | N/A | N/A | N/A |
| ABdb_1549 | 33076089 | 2021 | Enhancement of the peroxidase-like activity of aptamers modified gold nanoclusters by bacteria for colorimetric detection of Salmonella typhimurium | Aptamer1 | AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a colorimetric aptasensor using gold nanoclusters (aptamers@BSA-AuNCs) for the detection of S. typhimurium. | Exhibited a wide linear range of 10(1)-10(6) cfu/mL with a detection limit as low as 1 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 3'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1550 | 33076089 | 2021 | Enhancement of the peroxidase-like activity of aptamers modified gold nanoclusters by bacteria for colorimetric detection of Salmonella typhimurium | Aptamer2 | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a colorimetric aptasensor using gold nanoclusters (aptamers@BSA-AuNCs) for the detection of S. typhimurium. | Exhibited a wide linear range of 10(1)-10(6) cfu/mL with a detection limit as low as 1 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 3'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1551 | 33076147 | 2021 | Ratiometric fluorescence resonance energy transfer aptasensor for highly sensitive and selective detection of Acinetobacter baumannii bacteria in urine sample using carbon dots as optical nanoprobes | Ab aptamer | CAGCACCACAGACCACATATCACATGCTGTCGCCTTGCGATATCAATTCCAGTGATGTTTGTCTTCCTGCC | 71 | N/A | ssDNA | Acinetobacter Baumannii | Whole cell | Develop an ingenious ratiometric fluorescent aptasensor for the detection of (Ab) bacteria based on FRET between ortho-phenylenediamine carbon dots (o-CD), nitrogen-doped carbon nanodots (NCND), and graphene oxide (GO). | Display linear range from 2.0 × 10(3) to 4.5 × 10(7) cfu/mL and the low detection limit of 3.0 × 10(2) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | After a storage period of 4 weeks, over 90% of the initial response remained of the aptasenosr. | N/A | N/A | N/A |
| ABdb_1552 | https://doi.org/10.1016/j.microc.2021.106388 | 2021 | Rapid and sensitive determination of Pseudomonas aeruginosa by using a glassy carbon electrode modified with gold nanoparticles and aptamer-imprinted polydopamine | Aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa | Whole cell | Develop an electrochemical sensor based on a combination of aptasensing and molecular imprinting employing GCE/AuNP/Aptamer-MIP for ultrasensitive detection of P. aeruginosa. | Exhibited a wide linear dynamic concentration range of 10(1) to 10(7) CFU/ml with a low detection limit of 1 CFU/ml. | N/A | N/A | N/A | Detection | N/A | 5'-Amidation (NH₂) | N/A | The GCE/AuNP/Aptamer-MIP aptasensor signal remained unchanged, and only a 3% decrease in the peak current occurred after 50 repetitive cycles. | N/A | N/A | N/A |
| ABdb_1555 | 34553439 | 2021 | The systemic characterization of aptamer cocktail for bacterial detection studied by graphene oxide-based fluorescence resonance energy transfer aptasensor | E18R-42 | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) (CICC 10899) | Whole cell | Developed a fluorescence resonance energy transfer polyaptasensor based on an aptamer cocktail/graphene oxide for bacterial detection. | Detection limit as low as 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1556 | 34553439 | 2021 | The systemic characterization of aptamer cocktail for bacterial detection studied by graphene oxide-based fluorescence resonance energy transfer aptasensor | E17F-37 | ATCAAATGTGCAGATATCAAGACGATTTGTACAAGAT | 37 | N/A | ssDNA | Escherichia Coli (E. Coli) (CICC 10899) | Whole cell | Developed a fluorescence resonance energy transfer polyaptasensor based on an aptamer cocktail/graphene oxide for bacterial detection. | Detection limit as low as 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1557 | 34553439 | 2021 | The systemic characterization of aptamer cocktail for bacterial detection studied by graphene oxide-based fluorescence resonance energy transfer aptasensor | A1 | TAGAGATATGACAGCGGGGAAGGTTAAGAGGCGCTAGGAG | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (CICC 21617) | Whole cell | Developed a fluorescence resonance energy transfer polyaptasensor based on an aptamer cocktail/graphene oxide for bacterial detection. | Detection limit as low as 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1558 | 34553439 | 2021 | The systemic characterization of aptamer cocktail for bacterial detection studied by graphene oxide-based fluorescence resonance energy transfer aptasensor | A3 | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (CICC 21617) | Whole cell | Developed a fluorescence resonance energy transfer polyaptasensor based on an aptamer cocktail/graphene oxide for bacterial detection. | Detection limit as low as 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1559 | 34553439 | 2021 | The systemic characterization of aptamer cocktail for bacterial detection studied by graphene oxide-based fluorescence resonance energy transfer aptasensor | A18P | ATAGGAGTCACGACGACCAGAAGCGGGCAGCTCCACCGGTAGGCTCCGAGTCATCACGGTCGTATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Vibrio Parahaemolyticus (CICC 21617) | Whole cell | Developed a fluorescence resonance energy transfer polyaptasensor based on an aptamer cocktail/graphene oxide for bacterial detection. | Detection limit as low as 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1560 | 34553439 | 2021 | The systemic characterization of aptamer cocktail for bacterial detection studied by graphene oxide-based fluorescence resonance energy transfer aptasensor | B1P | ATAGGAGTCACGACGACCAGGGGGGCGGGCGGGCCAGGCGAGGGGCAGGGCGTGGAGGGCTATGTGCGTCTACCTCTTGA | 80 | N/A | ssDNA | Cronobacter Sakazakii (CICC 21562) | Whole cell | Developed a fluorescence resonance energy transfer polyaptasensor based on an aptamer cocktail/graphene oxide for bacterial detection. | Detection limit as low as 10 CFU/mL. | N/A | N/A | 56.56 ± 10.51 nM | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1561 | 34553439 | 2021 | The systemic characterization of aptamer cocktail for bacterial detection studied by graphene oxide-based fluorescence resonance energy transfer aptasensor | B16P | ATAGGAGTCACGACGACCAGGGATGGGGCCGCGCGGGGTGGGGGCGCGAGGGCCGGCGGGTATGTGCGTCTACCTCTTGA | 80 | N/A | ssDNA | Cronobacter Sakazakii (CICC 21562) | Whole cell | Developed a fluorescence resonance energy transfer polyaptasensor based on an aptamer cocktail/graphene oxide for bacterial detection. | Detection limit as low as 10 CFU/mL. | N/A | N/A | 49.83 ± 7.69 nM | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1562 | 34553439 | 2021 | The systemic characterization of aptamer cocktail for bacterial detection studied by graphene oxide-based fluorescence resonance energy transfer aptasensor | B25P | ATAGGAGTCACGACGACCAGGCCGCCCGGGGACGGGGGCGGCGGGGAGGAGGGCGGCGGGTATGTGCGTCTACCTCTTGA | 80 | N/A | ssDNA | Cronobacter Sakazakii (CICC 21562) | Whole cell | Developed a fluorescence resonance energy transfer polyaptasensor based on an aptamer cocktail/graphene oxide for bacterial detection. | Detection limit as low as 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1563 | 34553439 | 2021 | The systemic characterization of aptamer cocktail for bacterial detection studied by graphene oxide-based fluorescence resonance energy transfer aptasensor | A6 | GGGCAGGTGTTATGTGTACTGCTACAGTGTGGTTG | 35 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (CICC 21484) | Whole cell | Developed a fluorescence resonance energy transfer polyaptasensor based on an aptamer cocktail/graphene oxide for bacterial detection. | Show a linear range for monoaptasensor in the range of 1 × 10(1) to 1 × 10(9) CFU/mL and for polyaptasensor ranging from 1 × 10(1) to 1 × 10(7) CFU/mL with an LOD of 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1564 | 34553439 | 2021 | The systemic characterization of aptamer cocktail for bacterial detection studied by graphene oxide-based fluorescence resonance energy transfer aptasensor | A16 | GGCAGGACAACAGCGTGTAGTATCAGCTTACGGTG | 35 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (CICC 21484) | Whole cell | Developed a fluorescence resonance energy transfer polyaptasensor based on an aptamer cocktail/graphene oxide for bacterial detection. | Show a linear range for monoaptasensor in the range of 1 × 10(1) to 1 × 10(9) CFU/mL and for polyaptasensor ranging from 1 × 10(1) to 1 × 10(7) CFU/mL with an LOD of 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1565 | 34553439 | 2021 | The systemic characterization of aptamer cocktail for bacterial detection studied by graphene oxide-based fluorescence resonance energy transfer aptasensor | A18P | CCCTGCGGGGCTGCCCGATATGTGTCCAAGTGGTG | 35 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (CICC 21484) | Whole cell | Developed a fluorescence resonance energy transfer polyaptasensor based on an aptamer cocktail/graphene oxide for bacterial detection. | Show a linear range for monoaptasensor in the range of 1 × 10(1) to 1 × 10(9) CFU/mL and for polyaptasensor ranging from 1 × 10(1) to 1 × 10(7) CFU/mL with an LOD of 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1567 | 33780852 | 2021 | Microfluidic thread-based electrochemical aptasensor for rapid detection of Vibrio parahaemolyticus | Aptamer | ATAGGAGTCACGACGACCAGAATCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACTTATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a thread-based microfluidic nano-aptasensor based on MoS2 modified threaded electrodes for V. parahaemolyticus detection. | The proposed aptasensor has a dynamic detection range of 10–10(6) CFU/mL, a detection limit of 5.74 CFU/mL, and an assay time of 30 min. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1568 | 33421762 | 2021 | Controllable design of a nano-bio aptasensing interface based on tetrahedral framework nucleic acids in an integrated microfluidic platform | Aptamer | ATCCGTCACACCTGCTCTATCAAATGTGCAGATATCAAGACGATTTGTACAAGATGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) O157: H7 (ATCC 43889) | Whole cell | Developed a tetrahedral framework nucleic acids-based aptasensing interface in the microfluidic system for E. coli O157: H7 detection and antimicrobial susceptibility testing (AST) determination. | A calibration curve was constructed over 10(1) to 10(5) CFU/mL, with a limit of detection of 10(1) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-CGGAATTCCG) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1569 | 33479797 | 2021 | A turn-on-type fluorescence resonance energy transfer aptasensor for vibrio detection using aptamer-modified polyhedral oligomeric silsesquioxane-perovskite quantum dots/Ti3C2 MXenes composite probes | VP aptamer | TTTTTTTTTCAACGAAACAGTGACTCGTTG | 30 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a turn-on–type aptasensor based on FRET pair using aptamer modified polyhedral oligomeric silsesquioxane-perovskite quantum dots (POSS-PQDs-Apt) as signal probe and titanium carbide (Ti3C2) MXenes as quencher for Vibrio parahaemolyticus (VP) determination. | Under optimized conditions, the assay can determine VP in the concentration range 10(2) - 10(6) cfu/mL with the detection limit (LOD) of 30 cfu/mL and 100 cfu/mL by naked eye in aquaculture water. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1570 | 33582948 | 2021 | Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples | SHI05 | TAGCTCACTCATTAGGCACGACTCACTCTTGAAGGGGTGAGGCATGGTGGTATCAGCATAGTTAAGCCAGCC | 72 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Shigella Flexneri (ATCC 9199) | Whole cell | Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples. | N/A | 10 | Flow Cytometry | 144.4 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1571 | 33582948 | 2021 | Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples | SHI08 | TAGCTCACTCATTAGGCACATGCACCGAGGTCAGAAGTGCCTGTAATACACACCCCTCGGCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Shigella Flexneri (ATCC 9199) | Whole cell | Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples. | N/A | 10 | Flow Cytometry | 301.4 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1572 | 33582948 | 2021 | Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples | SHI 9 | TAGCTCACTCATTAGGCACCGAGTGCAAGATGTCCTACCCGATGAAGTAGGTTGGGTCTGCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Shigella Flexneri (ATCC 9199) | Whole cell | Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples. | N/A | 10 | Flow Cytometry | 279.7 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1573 | 33582948 | 2021 | Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples | SHI23 | TAGCTCACTCATTAGGCACCTTGGCTTAAAATGATAGCTAGTGGCAGATTGTTAATTTGGCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Shigella Flexneri (ATCC 9199) | Whole cell | Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples. | The assay is able to detect 10(2) CFU/mL cells. | 10 | Flow Cytometry | 231.2 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1574 | 33582948 | 2021 | Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples | SHI27 | TAGCTCACTCATTAGGCACATGGCAAGGTTGCCTTTTTGAGCGCGCTGCATAGTTAAGCCAGCC | 64 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Shigella Flexneri (ATCC 9199) | Whole cell | Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples. | N/A | 10 | Flow Cytometry | 328.9 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1575 | 33582948 | 2021 | Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples | SHI31 | TAGCTCACTCATTAGGCACCAGCCGGAAGGACCAGCTAGCTCACTCATTAGGCACCGAAGTGTGGTGCATAGTTAAGCCAGCC | 83 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Shigella Flexneri (ATCC 9199) | Whole cell | Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples. | N/A | 10 | Flow Cytometry | 186.1 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1576 | 33582948 | 2021 | Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples | SHI37 | TAGCTCACTCATTAGGCACGAACGGGCTTGTCTTTCCATAATTCGTGCGAAAGTGCCGCATAGTTAAGCCAGCC | 74 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Shigella Flexneri (ATCC 9199) | Whole cell | Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples. | N/A | 10 | Flow Cytometry | 176.7 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1577 | 33582948 | 2021 | Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples | SHI42 | TAGCTCACTCATTAGGCACTAGCGGAAGCTTAGTGTAAACGAGTGATAATGTGTTATGTGCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Shigella Flexneri (ATCC 9199) | Whole cell | Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples. | N/A | 10 | Flow Cytometry | 173.6 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1578 | 33836431 | 2021 | Ultra-sensitive photoelectrochemical aptamer biosensor for detecting E. coli O157:H7 based on nonmetallic plasmonic two-dimensional hydrated defective tungsten oxide nanosheets coupling with nitrogen-doped graphene quantum dots (dWO3•H2O@N-GQDs) | E.coli O157:H7 aptamer | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Developed a novel PEC aptasensor based on dWO3•H2O@N-GQDs for ultrasensitive detection of E. coli O157:H7. | Achieved a limit of detection of 0.05 CFU/mL and a wide linear detection range from 0.1 to 10(4) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1579 | https://doi.org/10.1016/j.snb.2021.130337 | 2021 | Electrochemical aptasensor for simultaneous detection of foodborne pathogens based on a double stirring bars-assisted signal amplification strategy | Apt-V.P | TGGCTAGCTCAGTCATCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACTCCGCG | 60 | N/A | ssDNA | Vibrio Parahaemolyticus | Whole cell | Developed a double stirring bar-based signal-amplified strategy using aptamer-embedded tetrahedral DNA nanostructures for the simultaneous electrochemical detection of Vibrio parahaemolyticus (V.P) and Salmonella typhimurium (S.T). | Display a lower detection limit of 4 CFU/mL for V.P. within a detection range of 10–10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1580 | https://doi.org/10.1016/j.snb.2021.130337 | 2021 | Electrochemical aptasensor for simultaneous detection of foodborne pathogens based on a double stirring bars-assisted signal amplification strategy | Apt-S.T | TGGCTAGCTCAGTCATATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAGCCGCG | 60 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Developed a double stirring bar-based signal-amplified strategy using aptamer-embedded tetrahedral DNA nanostructures for the simultaneous electrochemical detection of Vibrio parahaemolyticus (V.P) and Salmonella typhimurium (S.T). | Display a lower detection limit of 7 CFU/mL for S.T. within a detection range of 10–10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1581 | 33303152 | 2021 | Hollow carbon nanocapsules-based nitrogen-doped carbon nanofibers with rosary-like structure as a high surface substrate for impedimetric detection of Pseudomonas aeruginosa | Aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa | Whole cell | Developed an electrochemical aptasensor based on hollow carbon nanocapsule-based nitrogen-doped carbon nanofibers (CNCNF) with a rosary-like structure for the detection of PA. | The linear range and LOD of the aptasensor were 101-107 CFU/ml and 1 CFU/ml. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | After 8 days of storage in Fe(CN)6 3-/4- at 4°C, the electrode was found to be 89% of its initial activity. | N/A | N/A | N/A |
| ABdb_1582 | https://doi.org/10.1016/j.microc.2021.106132 | 2021 | A novel photoelectrochemical aptamer sensor based on rare-earth doped Bi2WO6 and Ag2S for the rapid detection of Vibrio parahaemolyticus | Aptamer | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a novel photoelectrochemical aptasensor based on rare-earth doped Bi2WO6 and Ag2S for the detection of V. parahaemolyticus. | Showed a wide linear range from 3.2 × 10(2) CFU/mL to 3.2 × 10(8) CFU/mL, and a detection limit of 40 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | After 2 weeks of storage at 4°C in a refrigerator, the biosensor retained 95% of its initial response. | N/A | N/A | N/A |
| ABdb_1583 | 34945447 | 2021 | A Novel Photoelectrochemical Aptamer Sensor Based on CdTe Quantum Dots Enhancement and Exonuclease I-Assisted Signal Amplification for Listeria monocytogenes Detection | Aptamer | ATACCAGCTTATTCAATTCCAAAAGCGCACCCATATATGTTCTATGTCCCCCACCTCGAGATTGCACTTACTATCT | 76 | N/A | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Developed a photoelectrochemical aptasensor based on WO3, CdTe QDs, and Exo I auxiliary signal amplification for the detection of L. monocytogenes. | Showed a detection limit of 45 CFU/mL over the concentration range of 1.3 × 10(1) - 1.3 × 10 (7) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1584 | 34053767 | 2021 | A novel smartphone-based colorimetric aptasensor for on-site detection of Escherichia coli O157:H7 in milk | Aptamer (Apt) | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 43888) | Whole cell | A colorimetric aptasensor was developed using GNP-Apt coupling with an MWCNT@CIP probe for detecting E. coli O157:H7 in milk. | Display a concentration of 8.43 × 10(3) cfu/mL in pure culture, and 5.24 × 10(2) cfu/mL in artificially contaminated milk after 1h. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (SH-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1585 | 34970724 | 2021 | Colorimetric determination of Listeria monocytogenes using aptamer and urease dual-labeled magnetic nanoparticles and cucurbit[7]uril-mediated supramolecular assembly of gold nanoparticle | Aptamer | TTTTTTTTTTATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT | 57 | N/A | ssDNA | Listeria Monocytogenes (ATCC 19111) | Whole cell | Developed a colorimetric strategy using apt-MNP-urease conjugate for the detection of L. monocytogenes. | Achieved a concentration range from 10 to 10(6) cfu/mL, and the visual determination can be done down to 10 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1586 | 34074432 | 2021 | One-step colorimetric detection of Staphylococcus aureus based on target-induced shielding against the peroxidase mimicking activity of aptamer-functionalized gold-coated iron oxide nanocomposites | Aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | Developed a colorimetric sensor using apt-Fe3O4/Au nanocomposites for the detection of Staphylococcus aureus. | Display a linear range from 10 to 10(6) CFU/mL, with the visible limit of detection as low as 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1587 | 33590378 | 2021 | Sensitive colorimetric aptasensor based on g-C3N4@Cu2O composites for detection of Salmonella typhimurium in food and water | Aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | A colorimetric aptasensor using graphitic carbon nitride (g-C3N4) nanosheets and copper oxide(I) (Cu2O) nanocrystals was developed for detecting S. typhimurium. | Exhibited linear range from 1.5 × 10(1) to 1.5 × 10(5) CFU/ml, with a detection limit of 15 CFU/ml. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1588 | 34753577 | 2021 | An efficient SERS platform for the ultrasensitive detection of Staphylococcus aureus and Listeria monocytogenes via wheat germ agglutinin-modified magnetic SERS substrate and streptavidin/aptamer co-functionalized SERS tags | S. aureus-aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed an aptasensor using WGA modified-Fe3O4@Au MNPs and Streptavidin (SA)/aptamer co-functionalized SERS tags for S. aureus and L. mono detection. | The LOD for S. aureus was 3 cells/mL and a favorable linear relation (10-10(7) cells/mL). | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1589 | 34753577 | 2021 | An efficient SERS platform for the ultrasensitive detection of Staphylococcus aureus and Listeria monocytogenes via wheat germ agglutinin-modified magnetic SERS substrate and streptavidin/aptamer co-functionalized SERS tags | L. mono-aptamer | ATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT | 47 | N/A | ssDNA | Listeria Monocytogenes | Whole cell | Developed an aptasensor using WGA modified-Fe3O4@Au MNPs and Streptavidin (SA)/aptamer co-functionalized SERS tags for S. aureus and L. mono detection. | The LOD for L. mono was 5 cells/mL and a favorable linear relation (10-10(7) cells/mL). | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1593 | 34041580 | 2021 | Fabrication of gold/silver nanodimer SERS probes for the simultaneous detection of Salmonella typhimurium and Staphylococcus aureus | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Developed an aptamer-facilitated gold/silver nanodimer SERS probe for the simultaneous detection of the two bacteria with the help of magnetic separation enrichment. | Achieved a linear range of 10(2) to 10(7) cfu/mL, with a detection limit of 50 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5′-SH-A-Cy3 and 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1594 | 34041580 | 2021 | Fabrication of gold/silver nanodimer SERS probes for the simultaneous detection of Salmonella typhimurium and Staphylococcus aureus | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed an aptamer-facilitated gold/silver nanodimer SERS probe for the simultaneous detection of the two bacteria with the help of magnetic separation enrichment. | Achieved a linear range of 3.2 × 10(2) to 3.2 × 10(7) cfu/mL, with a detection limit of 96 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5′-SH-A-Rox and 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1595 | 34869216 | 2021 | Electrochemical Biosensing Interface Based on Carbon Dots-Fe3O4 Nanomaterial for the Determination of Escherichia coli O157:H7 | Aptamer | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | A carbon dots-Fe3O4 nanomaterial (CDs-Fe3O4)-based electrochemical aptasensor for E. coli O157:H7 detection was developed. | Exhibited the detection range of 10–10(8) CFU/ml, and the detection limit of 6.88 CFU/ml. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1596 | 34406747 | 2021 | Upconversion Nanoprobes Based on a Horseradish Peroxidase-Regulated Dual-Mode Strategy for the Ultrasensitive Detection of Staphylococcus aureus in Meat | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed a colorimetric and fluorescent dual-mode nanoprobe using apt-MNPs and HRP-UCNPs-cDNA for the detection of S. aureus. | Obtained limits of detection of 22 CFU/mL for fluorescence and 20 CFU/mL for colorimetry in a linear range of 56–5.6 × 10(6) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1597 | https://doi.org/10.1007/s13738-021-02384-9 | 2021 | Rapid and sensitive detection of Escherichia coli O157:H7 based on silver nanocluster fluorescent probe | E. coli O157:H7 aptamer | TGAGCCCAAGCCCTGGTATGCGGATAACGAGGTATTCACGACTGGTCGTCAGGTATGGTTGGCAGGTCTACTTTGGGATC | 80 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Detection of E. coli O157:H7 in food based on aptamer-modified silver nanocluster fluorescent probes. | The linear range was 10–10(6) CFU/mL, and the detection limit was 0.2549 CFU/mL in the buffer and 0.6031 CFU/mL in the milk simulation sample. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1598 | 10.33263/BRIAC112.87028715 | 2021 | Novel Competitive Voltammetric Aptasensor Based on Electrospun Carbon Nanofibers-Gold Nanoparticles Modified Graphite Electrode for Salmonella enterica serovar Detection | Aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Developed an electrochemical aptasensor based on aptamer-linked GNPs/CNF-Chi/GEs for the detection of Salmonella enterica Serovar. | Exhibited a linear range of 10 to 10(5) CFU/mL with the limit of detection (LOD) 1.223 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1599 | https://doi.org/10.1016/j.snb.2020.129100 | 2021 | Naked eye colorimetric detection of Escherichia coli using aptamer conjugated graphene oxide enclosed Gold nanoparticles | E1 | TAGGGAAGAGAAGGACATATGA-CGATTACCGGAGCTGTGTCACCGGGCGCCAGTTGATGTGG-TTGACTAGTACATGACCACTTGA | 85 | 5'-TAGGGAAGAGAAGGACATATGA-46N-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Escherichia Coli (E. Coli) (MTCC no.1698) | Whole cell | Identify an aptamer against E.coli and develop a detection platform using gold nanoparticles and graphene oxide with aptamer conjugation. | N/A | 7 | Fluorescence Microplate Reader (Fluorescence Spectroscopy) | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1600 | https://doi.org/10.1016/j.snb.2020.129100 | 2021 | Naked eye colorimetric detection of Escherichia coli using aptamer conjugated graphene oxide enclosed Gold nanoparticles | E2 | TAGGGAAGAGAAGGACATATGA-TATGATGGGAGTAACGATTGTCCGACATGGTACCACCCCA-TTGACTAGTACATGACCACTTGA | 85 | 5'-TAGGGAAGAGAAGGACATATGA-46N-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Escherichia Coli (E. Coli) (MTCC no.1698) | Whole cell | Identify an aptamer against E.coli and develop a detection platform using gold nanoparticles and graphene oxide with aptamer conjugation. | N/A | 7 | Fluorescence Microplate Reader (Fluorescence Spectroscopy) | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1601 | https://doi.org/10.1016/j.snb.2020.129100 | 2021 | Naked eye colorimetric detection of Escherichia coli using aptamer conjugated graphene oxide enclosed Gold nanoparticles | E3 | TAGGGAAGAGAAGGACATATGA-GGTGCACCTCTCGCCCGAATCAGATCCCCACGGCGCCCCCTA-TTGACTAGTACATGACCACTTGA | 87 | 5'-TAGGGAAGAGAAGGACATATGA-46N-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Escherichia Coli (E. Coli) (MTCC no.1698) | Whole cell | Identify an aptamer against E.coli and develop a detection platform using gold nanoparticles and graphene oxide with aptamer conjugation. | N/A | 7 | Fluorescence Microplate Reader (Fluorescence Spectroscopy) | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1602 | https://doi.org/10.1016/j.snb.2020.129100 | 2021 | Naked eye colorimetric detection of Escherichia coli using aptamer conjugated graphene oxide enclosed Gold nanoparticles | E4 | TAGGGAAGAGAAGGACATATGA-ATCGGCTACGAGGTCCCGACTGCCGGACTGGCCCTTGGTC-TTGACTAGTACATGACCACTTGA | 85 | 5'-TAGGGAAGAGAAGGACATATGA-46N-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Escherichia Coli (E. Coli) (MTCC no.1698) | Whole cell | Identify an aptamer against E.coli and develop a detection platform using gold nanoparticles and graphene oxide with aptamer conjugation. | N/A | 7 | Fluorescence Microplate Reader (Fluorescence Spectroscopy) | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1603 | https://doi.org/10.1016/j.snb.2020.129100 | 2021 | Naked eye colorimetric detection of Escherichia coli using aptamer conjugated graphene oxide enclosed Gold nanoparticles | E5 | TAGGGAAGAGAAGGACATATGA-ACACCGCCACGATGCAACTGCCAAACGCACCGTACGCCTG-TTGACTAGTACATGACCACTTGA | 85 | 5'-TAGGGAAGAGAAGGACATATGA-46N-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Escherichia Coli (E. Coli) (MTCC no.1698) | Whole cell | Identify an aptamer against E.coli and develop a detection platform using gold nanoparticles and graphene oxide with aptamer conjugation. | N/A | 7 | Fluorescence Microplate Reader (Fluorescence Spectroscopy) | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1604 | https://doi.org/10.1016/j.snb.2020.129100 | 2021 | Naked eye colorimetric detection of Escherichia coli using aptamer conjugated graphene oxide enclosed Gold nanoparticles | E6 | TAGGGAAGAGAAGGACATATGA-CGAGAGGCCGCTGGGTCTAGACGTCCGGGTGCCACTCGCG-TTGACTAGTACATGACCACTTGA | 85 | 5'-TAGGGAAGAGAAGGACATATGA-46N-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Escherichia Coli (E. Coli) (MTCC no.1698) | Whole cell | Identify an aptamer against E.coli and develop a detection platform using gold nanoparticles and graphene oxide with aptamer conjugation. | N/A | 7 | Fluorescence Microplate Reader (Fluorescence Spectroscopy) | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1605 | https://doi.org/10.1016/j.snb.2020.129100 | 2021 | Naked eye colorimetric detection of Escherichia coli using aptamer conjugated graphene oxide enclosed Gold nanoparticles | E7 | TAGGGAAGAGAAGGACATATGA-TAACGCCTGTAGTACTCCACCTTAATCCGTTGCCAGGAAT-TTGACTAGTACATGACCACTTGA | 85 | 5'-TAGGGAAGAGAAGGACATATGA-46N-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Escherichia Coli (E. Coli) (MTCC no.1698) | Whole cell | Identify an aptamer against E.coli and develop a detection platform using gold nanoparticles and graphene oxide with aptamer conjugation. | N/A | 7 | Fluorescence Microplate Reader (Fluorescence Spectroscopy) | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1606 | https://doi.org/10.1016/j.snb.2020.129100 | 2021 | Naked eye colorimetric detection of Escherichia coli using aptamer conjugated graphene oxide enclosed Gold nanoparticles | E8 | TAGGGAAGAGAAGGACATATGA-CATTCTGCACCGCCATCAGTCTTTCTTCGATACCGCGTTT-TTGACTAGTACATGACCACTTGA | 85 | 5'-TAGGGAAGAGAAGGACATATGA-46N-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Escherichia Coli (E. Coli) (MTCC no.1698) | Whole cell | Identify an aptamer against E.coli and develop a detection platform using gold nanoparticles and graphene oxide with aptamer conjugation. | The limit of detection observed visually was 10(2) cells/mL with GO coating and 10(3) cells/mL without GO. The detection limit in real-time coconut water samples was also 10(2) cells/mL. | 7 | Fluorescence Microplate Reader (Fluorescence Spectroscopy) | 15.90 ± 3.07 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled, 5'-Thiolated and 5'-Amidation (NH₂) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1607 | 35846753 | 2022 | Selection and Identification of a DNA Aptamer for Multidrug-Resistant Acinetobacter baumannii Using an In-House Cell-SELEX Methodology | A01 | CAGGGGACGCACCAAGG-TTTTGTTTTTTCTTTGCTTCTTTTTGCTTTTTTTT-CCATGACCCGCGTGCTGCGTGA | 74 | 5'-CAGGGGACGCACCAAGG-N35-CCATGACCCGCGTGCTGCGTGAT-3' | ssDNA | Multidrug-resistant (MDR) Acinetobacter Baumannii | Whole cell | Identify aptamers against MDR A. baumannii. | Preferential binding to A. baumannii over other species. 25% of positive events for A. baumannii above the 12.66% of the negative control. | 7 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | Aptamer binding does not seem to interfere with the A. baumannii cell growth even after 24h (5.88E+02 x 1.45E+03; p=0.700). | N/A | N/A | N/A | N/A |
| ABdb_1608 | 35745014 | 2022 | The Ability of Nuclease-Resistant RNA Aptamer against Streptococcus suis Serotype 2, Strain P1/7 to Reduce Biofilm Formation In Vitro | R8-su12 | GGGAGUCGACCGACCAGAA-CAUACUGAGUAAGAUCGGAAAUUUCGGUGUAAGGCCACGG-UAUGUGCGUCUACAUCUAGACUCAU | 84 | 5'-AGTAATACGACTCACTATAGGGAGTCGACCGACCAGAA-N40-TATGTGCGTCTACATCTAGACTCAT-3' | ssRNA | Streptococcus Suis serotype 2, strain P1/7 | Whole cell | Identify aptamers that inhibit the biofilm formation of the S. suis target strain. | Significantly reduced biofilm formation by 61.2%. | 8 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Therapeutics | Whole Cell-SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1609 | 35745014 | 2022 | The Ability of Nuclease-Resistant RNA Aptamer against Streptococcus suis Serotype 2, Strain P1/7 to Reduce Biofilm Formation In Vitro | R8-su057 | GGGAGUCGACCGACCAGAA-UGGAUGUAUGGAACUUGCAGAUCUUAACUGCACGAAGCGU-UAUGUGCGUCUACAUCUAGACUCAU | 84 | 5'-AGTAATACGACTCACTATAGGGAGTCGACCGACCAGAA-N40-TATGTGCGTCTACATCTAGACTCAT-3' | ssRNA | Streptococcus Suis serotype 2, strain P1/7 | Whole cell | Identify aptamers that inhibit the biofilm formation of the S. suis target strain. | N/A | 8 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Therapeutics | Whole Cell-SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1610 | 35745014 | 2022 | The Ability of Nuclease-Resistant RNA Aptamer against Streptococcus suis Serotype 2, Strain P1/7 to Reduce Biofilm Formation In Vitro | R8-su15 | GGGAGUCGACCGACCAGAA-ACACGUUGCUGAAACAUACCGAGUAACAUAAAGCGGGUG-UAUGUGCGUCUACAUCUAGACUCAU | 83 | 5'-AGTAATACGACTCACTATAGGGAGTCGACCGACCAGAA-N40-TATGTGCGTCTACATCTAGACTCAT-3' | ssRNA | Streptococcus Suis serotype 2, strain P1/7 | Whole cell | Identify aptamers that inhibit the biofilm formation of the S. suis target strain. | N/A | 8 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Therapeutics | Whole Cell-SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1611 | 35573794 | 2022 | Aptamer-Targeted Drug Delivery for Staphylococcus aureus Biofilm | SA31 | GCAATGGTACGGTACTTCC-TCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGA-CAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (DSM 20231) | Whole cell | Aptamer-targeted liposomes encapsulating antibiotics for accumulation and delivery to eradicate S. aureus biofilm. | SA31-modified liposomes fully eradicated all viable, culturable bacteria in all biofilm samples. | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 3'-5-propargylamino-ddUTP-Cy5 or 3'-N3 modified | N/A | SA23 appeared more stable than the other aptamers in plasma over a 16-hour incubation period. | N/A | N/A | N/A |
| ABdb_1628 | 35842460 | 2022 | DNA-aptamer-nanographene oxide as a targeted bio-theragnostic system in antimicrobial photodynamic therapy against Porphyromonas gingivalis | Aptamer | TATGCCAGCATTTCGCCAACGGTGGTCATACAGTGTGAA | 39 | N/A | ssDNA | Porphyromonas Gingivalis | Whole cell | DNA-aptamer-NGO, a targeted bio-theragnostic system against P. gingivalis for antimicrobial photodynamic therapy (aPDT). | MIC of DNA-aptamer-NGO was 62.5 nM, and MBC was 125 nM. aPDT using 1/2 × and 1/4 × MBC of DNA-aptamer-NGO plus irradiation of the diode laser light (1 min) has a significantly anti-biofilm effect; percentage of apoptosis cells treated with DNA-aptamer-NGO at 1/2 × and 1/4 × MIC plus diode laser were 13.9% and 12.7%; and 1/2 × MIC of DNA-aptamer-NGO, resulted in 40.3% inactivation of metabolic activity compared to 1/4 × MBC of DNA-aptamer-NGO, where only 22.2% inactivation. | N/A | N/A | N/A | Diagnostic/Therapeutics | N/A | FAM Labeled | At high concentrations of DNA-aptamer-NGO, incubated for 24 hours with human red blood cells, the percentage did not exceed 5%. Also, at different concentrations, the mean percentage of HGF cell viability ranges from 95.2% to 87.6%. | N/A | N/A | N/A | N/A |
| ABdb_1648 | 35934373 | 2022 | A surface-enhanced Raman scattering aptasensor for Escherichia coli detection based on high-performance 3D substrate and hot spot effect | E. coli Apt | CCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCG | 45 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Developed SERS aptasensor composed of Apt-AgNPs-CS gel and GNS@4-MBA-Apt NPs for detection of E. coli in food. | Display a detection limit of 3.46 CFU/mL with a wide dynamic linear range from 3.2 × 10(1) to 3.2 × 10(7) CFU/mL and a good recovery rate (>90%). | N/A | N/A | N/A | Biosensor | N/A | 3'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1650 | 35869107 | 2022 | An innovative dual recognition aptasensor for specific detection of Staphylococcus aureus based on Au/Fe3O4 binary hybrid | Apt | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 6538) | Whole cell | Developed an imprinted aptasensor (apt-AuNPs@ Fe3O4) for the quantification of S. aureus. | Exhibited a wide linear range of 10(1)-10(7) CFU/mL with a Limit of Detection (LOD ) of 1 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | The aptasensor retained approximately 95% of its original activity for four weeks. | N/A | N/A | N/A |
| ABdb_1651 | 35829778 | 2022 | An ultrasensitive sandwich-type electrochemical aptasensor using silver nanoparticle/titanium carbide nanocomposites for the determination of Staphylococcus aureus in milk | Apts | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CICC 23656) | Whole cell | Developed a novel sandwich-type electrochemical aptasensor using AgNPs@Ti3C2 nanocomposites for the detection of S. aureus. | Showed a low detection limit (LOD) of 1 CFU/mL and a linear range of 52–5.2 × 10(7) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | 92.68% of the initial current of the aptasensor was reserved when stored for 15 days at 4°C. | N/A | N/A | N/A |
| ABdb_1652 | 35870283 | 2022 | An ultrasensitive and dual-recognition SERS biosensor based on Fe3O4@Au-Teicoplanin and aptamer functionalized Au@Ag nanoparticles for detection of Staphylococcus aureus | S. aureus Apt | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | The SERS biosensor based on Fe3O4@Au-Tcp NPs as a capture probe and Au@Ag-DTNB-Apt NPs as a signal probe for the detection of S. aureus. | Showed detection limit of 1.09 CFU/mL with a broad dynamic linear range of 7.6 × 10(1)-7.6 × 10(7) CFU/mL within 50 min. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1653 | 35200347 | 2022 | Paper-Based Electrodes Conjugated with Tungsten Disulfide Nanostructure and Aptamer for Impedimetric Detection of Listeria monocytogenes | Aptamer | ATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT | 47 | N/A | ssDNA | Listeria Monocytogenes | Whole cell | Developed an aptasensor based on ePAD that employs a tungsten disulfide (WS2)/aptamer hybrid for the detection of L. monocytogenes. | The limit of detection (LoD) was 10 CFU/mL, with a linear range of 10(1)-10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | Aptasensor gives a stable impedance response over a period of 15 days. | N/A | N/A | N/A |
| ABdb_1654 | 35934342 | 2022 | Sandwich fluorometric method for dual-role recognition of Listeria monocytogenes based on antibiotic-affinity strategy and fluorescence quenching effect | Aptamer | TTTTTTTTTTATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT | 57 | N/A | ssDNA | Listeria Monocytogenes (ATCC 19111) | Whole cell | Developed a sandwich fluorimetric method (MNPs-Van) for dual-role recognition of L. monocytogenes. | Achieved a low detection limit (LOD) of 2.8 × 10(2) CFU/mL in 1.5 h with a concentration range over 10(2)-2 × 10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1655 | https://doi.org/10.1016/j.snb.2022.131654 | 2022 | Dual recognition and highly sensitive detection of Listeria monocytogenes in food by fluorescence enhancement effect based on Fe3O4@ZIF-8-aptamer | L. monocytogenes aptamer | TACTATCGCGGAGACAGCGCGGGAGGCACCGGGGA | 35 | N/A | ssDNA | Listeria Monocytogenes (ATCC 15313) | Whole cell | Developed a fluorescence enhancement effect-based detection strategy based on Fe3O4@ZIF-8@aptamer for L. monocytogenes. | The linear range for detection of pure culture was 1.4 × 10(1) to 1.4 × 10(7) CFU/mL, with a detection limit of 0.88 CFU/mL in about 70 min. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1656 | 36418544 | 2022 | Colorimetric detection of Pseudomonas aeruginosa by aptamer-functionalized gold nanoparticles | Aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Developed a colorimetric biosensor using aptamer-functionalized AuNPs for identifying P. aeruginosa. | P. aeruginosa was detected after 5 h for concentrations from 10(8) to 10(5) CFU/mL, with 10(5) and 10(4) CFU/mL being the detection limits for colour change by the naked eye and UV-Vis spectrometry, respectively. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1658 | https://doi.org/10.48022/mbl.2206.06001 | 2022 | Antibiofilm Activity and Binding Specificity of Polyclonal DNA Aptamers on Staphylococcus aureus and Escherichia coli | S15K3 | CCGGAATTCCTAATACGACTCCCAGCAGCAAGGTGCGGTACCCGGGGATGCGGGCTTGCTGTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 and Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Determine the antibiofilm activity and binding specificity of the polyclonal DNA aptamers on S. aureus BPA-12 and E. coli EPEC 4. | Showed the percentage of antibiofilm activity against S. aureus BPA-12 (25.8%) and E. coli EPEC 4 (0.3%). | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1659 | https://doi.org/10.48022/mbl.2206.06001 | 2022 | Antibiofilm Activity and Binding Specificity of Polyclonal DNA Aptamers on Staphylococcus aureus and Escherichia coli | S15K4 | CCGGAATTCCTAATACGACTCCCCGGGCCCACAGGGTACGCGTCTGCGGCTGGCCGGTCCCTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 and Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Inhibition of biofilm formation by folding into unique three-dimensional structures and attaching to a specific target. | Showed the percentage of antibiofilm activity against S. aureus BPA-12 (26.3%) and E. coli EPEC 4 (2.8%). | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1660 | https://doi.org/10.48022/mbl.2206.06001 | 2022 | Antibiofilm Activity and Binding Specificity of Polyclonal DNA Aptamers on Staphylococcus aureus and Escherichia coli | S15K6 | CCGGAATTCCTAATACGACTCGCGGGACGGGGAGTGCGCTGGGCATGTGGGCGCCGGGGGATATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 and Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Inhibition of biofilm formation by folding into unique three-dimensional structures and attaching to a specific target. | Showed the highest percentage of antibiofilm activity against S. aureus BPA-12 (37.4%). | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1661 | https://doi.org/10.48022/mbl.2206.06001 | 2022 | Antibiofilm Activity and Binding Specificity of Polyclonal DNA Aptamers on Staphylococcus aureus and Escherichia coli | S15K13 | CCGGAATTCCTAATACGACTCCACGCGCAGGCAGCCACCGACCAGGTGCTCGTATGGTTGGTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 and Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Inhibition of biofilm formation by folding into unique three-dimensional structures and attaching to a specific target. | Showed the percentage of antibiofilm activity against S. aureus BPA-12 (31.8%) and E. coli EPEC 4 (9.4%). | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1662 | https://doi.org/10.48022/mbl.2206.06001 | 2022 | Antibiofilm Activity and Binding Specificity of Polyclonal DNA Aptamers on Staphylococcus aureus and Escherichia coli | S15K15 | CCGGAATTCCTAATACGACTCCAGGACAGTACTCTGGACGGCAATACGTATATACGTACGGTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 and Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Inhibition of biofilm formation by folding into unique three-dimensional structures and attaching to a specific target. | Showed the percentage of antibiofilm activity against S. aureus BPA-12 (19.1%) and E. coli EPEC 4 (-1.3%). | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1663 | https://doi.org/10.48022/mbl.2206.06001 | 2022 | Antibiofilm Activity and Binding Specificity of Polyclonal DNA Aptamers on Staphylococcus aureus and Escherichia coli | S15K20 | CCGGAATTCCTAATACGACTCCCGGCGCCACGACATGGGCGCTGCCGGTGTGGTCGCGGGATATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 and Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Inhibition of biofilm formation by folding into unique three-dimensional structures and attaching to a specific target. | Showed the highest percentage of antibiofilm activity against E. coli EPEC 4 (15.4%). | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1671 | 34329020 | 2022 | Targeted mesoporous silica nanoparticles for improved inhibition of disinfectant resistant Listeria monocytogenes and lower environmental pollution | A15-HP-Am | TACTATCGCGGAGACAGCGCGGGAGGCACCGGGGATAGTA | 40 | N/A | ssDNA | Listeria Monocytogenes (ATCC 19115 and ATCC 7644) | Whole cell | BAC-encapsulated, aptamer-functionalized silica nanoparticles (AptBACNP) effectively killed only the target bacterium, L. monocytogenes, at lower doses, but not other bacteria. | Inhibition (MIC value) of BAC resistant Listeria strains with 8 times less the usual disinfectant dose. | N/A | N/A | N/A | Therapeutics | N/A | 5'-Amidation (NH₂) | MSNPs are slightly cytotoxic to erythrocytes and MCF-7 cells at concentrations more than 25 µg/ml. | N/A | N/A | N/A | N/A |
| ABdb_1672 | 35850461 | 2022 | Aptamer decorated emodin nanoparticles-assisted delivery of dermcidin-derived peptide DCD-1L: Photoactive bio-theragnostic agent for Enterococcus faecalis biofilm destruction | Aptamer | TAGGGAAGAGAAGGACATATGATACTGGCCTTGACACCCTGTTGTGGCTTGATGACAATAACATTGACTAGTACATGACCACTTGA | 86 | N/A | ssDNA | Enterococcus Faecalis | Whole cell | Apt@EmoNp-DCD-1L that binds E. faecalis, enabling targeted delivery of emodin nanoparticles and DCD-1L for anti-biofilm activity. | aPDT using Apt@EmoNp-DCD-1L caused ≈99.99% reduction of E. faecalis viability and strong biofilm disruption at sub-MIC concentrations (7.8 and 15.6 µM). | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 5'-FAM Labeled and 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1679 | 35031253 | 2022 | Architecting of an aptasensor for the staphylococcus aureus analysis by modification of the screen-printed carbon electrode with aptamer/Ag-Cs-Gr QDs/NTiO2 | Aptamer | TCGGCACGTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTC | 43 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | An electrochemical aptasensor employing Apt/Ag–Cs-Gr QDs/NTiO2/SPCE was developed for the detection of S. aureus. | Limit of Detection (LOD) of 3.3 CFU/mL and dynamic range of 10–5 × 10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | Compared with the initial current response, the aptsensor response changed less than 10% after 100 cycles’ continuous CV scans. | N/A | N/A | N/A |
| ABdb_1680 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K3 | CCGGAATTCCTAATACGACTC-CCAGCAGCAAGGTGCGGTACCCGGGGATGCGGGCTTGCTG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 36,70 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1681 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K4 | CCGGAATTCCTAATACGACTC-CCCGGGCCCACAGGGTACGCGTCTGCGGCTGGCCGGTCCC-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1682 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K6 | CCGGAATTCCTAATACGACTC-GCGGGACGGGGAGTGCGCTGGGCATGTGGGCGCCGGGGGA-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | S15K6 has the highest binding affinity to S. aureus BPA-12. | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 17,01 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1683 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K13 | CCGGAATTCCTAATACGACTC-CACGCGCAGGCAGCCACCGACCAGGTGCTCGTATGGTTGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 60,69 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1684 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K15 | CCGGAATTCCTAATACGACTC-CAGGACAGTACTCTGGACGGCAATACGTATATACGTACGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 20,90 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1685 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K20 | CCGGAATTCCTAATACGACTC-CCGGCGCCACGACATGGGCGCTGCCGGTGTGGTCGCGGGA-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1686 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K3 | CCGGAATTCCTAATACGACTC-CCAGCAGCAAGGTGCGGTACCCGGGGATGCGGGCTTGCTG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 28,06 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1687 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K4 | CCGGAATTCCTAATACGACTC-CCCGGGCCCACAGGGTACGCGTCTGCGGCTGGCCGGTCCC-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1688 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K6 | CCGGAATTCCTAATACGACTC-GCGGGACGGGGAGTGCGCTGGGCATGTGGGCGCCGGGGGA-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 31,99 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1689 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K13 | CCGGAATTCCTAATACGACTC-CACGCGCAGGCAGCCACCGACCAGGTGCTCGTATGGTTGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | S15K13 and S15K15 have high binding affinity to E. coli EPEC 4. | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 5,21 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1690 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K15 | CCGGAATTCCTAATACGACTC-CAGGACAGTACTCTGGACGGCAATACGTATATACGTACGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | S15K13 and S15K15 have high binding affinity to E. coli EPEC 4. | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 8,89 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1691 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K20 | CCGGAATTCCTAATACGACTC-CCGGCGCCACGACATGGGCGCTGCCGGTGTGGTCGCGGGA-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1692 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K3 | CCGGAATTCCTAATACGACTC-CCAGCAGCAAGGTGCGGTACCCGGGGATGCGGGCTTGCTG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Streptococcus Agalactiae | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | S15K3 and S15K13 have a high binding affinity for S. agalactiae. | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 6,84 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1693 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K4 | CCGGAATTCCTAATACGACTC-CCCGGGCCCACAGGGTACGCGTCTGCGGCTGGCCGGTCCC-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Streptococcus Agalactiae | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1694 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K6 | CCGGAATTCCTAATACGACTC-GCGGGACGGGGAGTGCGCTGGGCATGTGGGCGCCGGGGGA-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Streptococcus Agalactiae | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 20,79 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1695 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K13 | CCGGAATTCCTAATACGACTC-CACGCGCAGGCAGCCACCGACCAGGTGCTCGTATGGTTGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Streptococcus Agalactiae | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | S15K3 and S15K13 have a high binding affinity for S. agalactiae. | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 6,53 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1696 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K15 | CCGGAATTCCTAATACGACTC-CAGGACAGTACTCTGGACGGCAATACGTATATACGTACGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Streptococcus Agalactiae | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 45,36 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1697 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K20 | CCGGAATTCCTAATACGACTC-CCGGCGCCACGACATGGGCGCTGCCGGTGTGGTCGCGGGA-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Streptococcus Agalactiae | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1698 | 35896842 | 2022 | Gold nanoparticles (AuNP)-based aptasensor for enteropathogenic Escherichia coli detection | S8-7 | CCGGAATTCCTAATACGACTCGGTTCCGGTAAGATTAGATCATAACGTATGGCTAGCGCCATATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | An AuNP-based aptasensor was developed for the detection of enteropathogenic Escherichia coli. | N/A | N/A | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 17.18 nM | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1699 | 35896842 | 2022 | Gold nanoparticles (AuNP)-based aptasensor for enteropathogenic Escherichia coli detection | S8-7.2 | GGTTCCGGTAAGATTAGATCATAACGTATGGCTAGCGCCATATTGAAAACGCGGCCGCGG | 60 | N/A | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | An AuNP-based aptasensor was developed for the detection of enteropathogenic Escherichia coli. | LOD value of AuNP-based aptasensor after overnight incubation with a value of 10(5) CFU/mL. | N/A | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1700 | 35896842 | 2022 | Gold nanoparticles (AuNP)-based aptasensor for enteropathogenic Escherichia coli detection | S10-5 | N/A | N/A | N/A | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | An AuNP-based aptasensor was developed for the detection of enteropathogenic Escherichia coli. | LOD of AuNP-based aptasensor was achieved at overnight incubation with a value of 10(6) CFU/mL. | N/A | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 34.14 nM | Biosensor | N/A | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1701 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S8-1 | CCGGAATTCCTAATACGACTC-TGCGGACTGTATCGGTCGGTCGAAAATAGTGAAGTGC-TATTGAAACGCGGCCGCGG | 77 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1702 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S8-4 | CCGGAATTCCTAATACGACTC-ACTACGCACGGCGCGAGTAAATCGATCATGGTACTGTGGC-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1703 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S8-7 | CCGGAATTCCTAATACGACTC-GGTTCCGGTAAGATTAGATCATAACGTATGGCTAGCGCCA-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1704 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S9-3 | CCGGAATTCCTAATACGACTC-GAAAACGTACCACTGGGATGGGTTGTGGGAGAGGGCCAGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | G-quadruplex sequence motifs are found in the S9-3, S10-10 and S10-15 aptamer sequences, with G-scores of 40, 20 and 10 (2 motifs), and 13, respectively. | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1705 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-1 | CCGGAATTCCTAATACGACTC-TATGGAGTTTGTCCGTATGATTACGTGATATCGCGACGGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1706 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-2 | CCGGAATTCCTAATACGACTC-CAGCAAACGCAGTCCAACAGCCGACAAACGGTCTTGAGGC-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1707 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-5 | CCGGAATTCCTAATACGACTC-TACAAAAAGTCGTGGTCCAGTTGCCATGTGTAAAACTGTG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1708 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-6 | CCGGAATTCCTAATACGACTC-AACCAGACCACGCGAGAGGGCTCACAGTGAGACGTGAAGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1709 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-7 | CCGGAATTCCTAATACGACTC-TGGTGGGTAAAGACACCATACTGATAGTTACAAGGATGTT-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1710 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-8 | CCGGAATTCCTAATACGACTC-GCAACTTCAGTTCAGCAAGGTGCCGGCCACGCGACGGTCC-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1711 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-10 | CCGGAATTCCTAATACGACTC-ATCCAGCAGATGTGCGCGGGTTGGTGGGGGAACGGTGGGA-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | G-quadruplex sequence motifs are found in the S9-3, S10-10 and S10-15 aptamer sequences, with G-scores of 40, 20 and 10 (2 motifs), and 13, respectively. | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1712 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-15 | CCGGAATTCCTAATACGACTC-GTAGCACTATAGGCAGCACGAATATGGCCGTCGGAGTTGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | G-quadruplex sequence motifs are found in the S9-3, S10-10 and S10-15 aptamer sequences, with G-scores of 40, 20 and 10 (2 motifs), and 13, respectively. | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1715 | 35448289 | 2022 | Aptamer-Based Fluorescence Detection and Selective Disinfection of Salmonella Typhimurium by Using Hollow Carbon Nitride Nanosphere | S. typhimurium Apt | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Develop an off-on fluorescence aptasensor for the detection of S. typhimurium and use HCNS-Cap for disinfection. | The fluorescence assay showed a linear range of 30 to 3 × 10(4) CFU/mL and a detection limit of 13 CFU/mL. The bactericidal efficiency of HCNS-Cap (95.0%) within 12 h was better than that of HCNS (85.1%) and Cap (72.9%). | N/A | N/A | N/A | Diagnostic/Therapeutics | N/A | Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1716 | 36205828 | 2022 | Aptamer-AuNP-conjugated carboxymethyl chitosan-functionalized graphene oxide for colorimetric identification of Salmonella typhimurium | S. typhimurium Aptamer | GCGCTCGGCCTCCTCTGCCATCTCATTCGCGAGCC | 35 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Develop a novel aptamer-AuNP-conjugated carboxymethyl chitosan–functionalized graphene oxide (CMC/GO@Apt-Au NP) probe for the determination of S. typhimurium. | Achieved a linear range from 10(2) to 10(7) CFU/mL with a limit of detection (LOD) of 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | The relative response of aptasensor decreased to ~ 77% within 11 days of storage. | N/A | N/A | N/A |
| ABdb_1717 | 34693471 | 2022 | Electrochemical biosensor for detecting pathogenic bacteria based on a hybridization chain reaction and CRISPR-Cas12a | Aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | An electrochemical biosensor platform based on HCR-based CRISPR-Cas12a for specific detection of S. typhimurium. | Selectively and sensitively quantify S. typhimurium in samples with detection limits of 20 CFU/mL and a linear range of 10-10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1718 | 36058939 | 2022 | Multiple amplification-based fluorometric aptasensor for highly sensitive detection of Staphylococcus aureus | Aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | Developed a fluorometric aptasensor for the detection of S. aureus using magnetic nanoparticles (MNPs). | The proposed fluorometric aptasensor displays LOD of (1.23 cfu/mL, a wide linear range (1 ~ 10(8) cfu/mL), and a fast detection speed (~ 1.5 h). | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (Biotin-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1719 | 34986439 | 2022 | Potentiometric aptasensing of Escherichia coli based on electrogenerated chemiluminescence as a highly sensitive readout | Aptamer | GTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCG | 36 | N/A | ssDNA | Escherichia Coli (E. Coli) O157: H7 | Whole cell | Developed a potentiometric aptasensor by electrogenerated chemiluminescence (ECL) using SWCNTs-aptamer modified electrode to detect E. coli. | Shows a highly sensitive response to E. coli O157: H7 in the linear range of 5-1000 CFU/mL with a low detection limit of 2 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1720 | 34809985 | 2022 | Surface plasmon resonance aptasensor for Brucella detection in milk | B46 | GGCGGCGATGAGGATGAC-GAGAGTAAAGGCCATCGGCGGCCATTTATGTTGTACCC-ACCACTGCGTGACTGCC | 73 | 5'-GGCGGCGATGAGGATGAC-N38-ACCACTGCGTGACTGCC-3' | ssDNA | Brucella Melitensis | Whole cell | Developed a surface plasmon resonance (SPR) aptasensor for the detection of B. melitensis in milk samples. | LOD value as low as 27 ± 11 cells. | 15 | Fluorescence Binding Assay | 616 ± 13 cells/ml | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1721 | 34809985 | 2022 | Surface plasmon resonance aptasensor for Brucella detection in milk | B48 | GGCGGCGATGAGGATGAC-ACTATTTACGTTGGAACTTAAGTCCCACATGCACTGCC-ACCACTGCGTGACTGCC | 73 | 5'-GGCGGCGATGAGGATGAC-N38-ACCACTGCGTGACTGCC-3' | ssDNA | Brucella Melitensis | Whole cell | Developed a surface plasmon resonance (SPR) aptasensor for the detection of B. melitensis in milk samples. | N/A | 15 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1722 | 34809985 | 2022 | Surface plasmon resonance aptasensor for Brucella detection in milk | B70 | GGCGGCGATGAGGATGAC-CTATAGTGCTCAAGTGCGATGCCAAGCTGGCACGATAG-ACCACTGCGTGACTGCC | 73 | 5'-GGCGGCGATGAGGATGAC-N38-ACCACTGCGTGACTGCC-3' | ssDNA | Brucella Melitensis | Whole cell | Developed a surface plasmon resonance (SPR) aptasensor for the detection of B. melitensis in milk samples. | B70 showed about 35% higher affinity for Brucella cells than the B46 aptamer, and the SPR sensor showed an LOD of 27 ± 11 cells. | 15 | Fluorescence Binding Assay | 632 ± 132 cells/ml | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1723 | 34809985 | 2022 | Surface plasmon resonance aptasensor for Brucella detection in milk | B72 | GGCGGCGATGAGGATGAC-TCCGTGACAAGTGCGATGCCATTCCGCGTGACAGTGAT-ACCACTGCGTGACTGCC | 73 | 5'-GGCGGCGATGAGGATGAC-N38-ACCACTGCGTGACTGCC-3' | ssDNA | Brucella Melitensis | Whole cell | Developed a surface plasmon resonance (SPR) aptasensor for the detection of B. melitensis in milk samples. | N/A | 15 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1724 | 35270999 | 2022 | Detection of E. coli Bacteria in Milk by an Acoustic Wave Aptasensor with an Anti-Fouling Coating | Aptamer | ATCCGTCACACCTGCTCTACGGCGCTCCCCAACAGGCCTCTCCTTACGGCATATTATGGTGTTGGCTCCCGTAT | 74 | N/A | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Developed an electromagnetic piezoelectric acoustic sensor device (EMPAS) based on SiO2-MEG-NH2-Aptamer for the detection of E.coli. in milk samples. | Selective measurement of E. coli in PBS and in cow’s milk samples down to limits of detection of 35 and 8 CFU/mL, respectively, with a linear range of 10–10(7) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1725 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA37 (SA-10R-37) | GCTTCCAGCTTATTGAAT-AAAGACGGGGGGGGGGACCGGCGTATGAGTGAAGATGGGG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | Achieved a limit of detection (LOD) of 39 CFUs and 414 CFUs in buffer and spiked tap water samples, respectively, with the cognate pair of SA37@Cy5 and SA81@FAM. | 10 | Flow Cytometry | 16.5 ± 3.41 nM | Biosensor | Whole Cell-SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1726 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA81 (SA-10R-81) | GCTTCCAGCTATTGAA-AACGAGGCGCAGGGGGAGGGGGTGGTACAGATAAGATGGGG-GCGCTGAAGCGCGGAAGC | 75 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | Achieved a limit of detection (LOD) of 39 CFUs and 414 CFUs in buffer and spiked tap water samples, respectively, with the cognate pair of SA37@Cy5 and SA81@FAM. | 10 | Flow Cytometry | 14.47 ± 8.18 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1727 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA25 (SA-9R-25) | GCTTCCAGCTTATTGAAT-GGGGAAGGTCGTCCGACGAACCCGGTCAGATAGGGTGGGG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | 44.92 ± 1.36 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1728 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA28 (SA-10R-28) | GCTTCCAGCTTATTGAAT-GCGGCCACGGAGGGGGTGCCGGGCGTGGAATAAGATGTGG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | 77 ± 1.22 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1729 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA35 (SA-10R-35) | GCTTCCAGCTTATTGAAT-CACAGGTGTGGGGAGGTCCCCATGGAGGTGGTTCAATG-GCGCTGAAGCGCGGAAGC | 74 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | 58.77 ± 0.73 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1730 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA40 (SA-10R-40) | GCTTCCAGCTTATTGAAT-CGACGTGAAGCAATCATGGGTGGGGTACGTCGGGTCATGG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | 126.95 ± 0.51 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1731 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA-9R-12 | GCTTCCAGCTTTATGAAT-TGGGCGTGGCGACGGTGTCAGGTCGGGGCGGTAAGACGAGG-GCGCTGAAGCGCGGAAGC | 77 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1732 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA-9R-57 | GCTTCCAGCTTATTGAAT-GGAACGAGATGGGGCATGGCGCCACGGAGGGGAATCAAGG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1733 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA-10R-1 | GCTTCCAGCTTATTGAAT-CGAGGGTAAGGGAAGTATGGCCGGTGCCCTGGAGTCAATG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1734 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA-10R-18 | GCTTCCAGCTTATTGAAT-CGGGTGGGGGGAGCGACAGACGGAAAAGCCTGGGTCAATAG-GCGCTGAAGCGCGGAAGC | 77 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1735 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA-10R-55 | GCTTCCAGCTTATTGAAT-GGAGGGGCAGGGCATGGAGCTCGACATTCATGAGATGGGG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1736 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA-10R-59 | GCTTCCAGCTTATGGAAT-GTGCCGAGGCGATACATGCACAGGCATGGTGGGATAAGGTCGGG-GCGCTGAAGCGCGGAAGC | 80 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1737 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA-10R-69 | GCTTCCAGCTTATTGAAT-CGGAGAGTCTGGCGCAGCCCTACGCCGATGTAAGATGGGG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1738 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA-10R-72 | GCTTCCAGCTTATTGAAT-CGAGGTGTGGGAGACAACGCTCCGTGACCGAGGGGAAATG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1739 | https://doi.org/10.1016/j.snb.2021.130933 | 2022 | Introducing an SPRi-based titration assay using aptamers for the detection of Legionella pneumophila | R10C5 | GCAATGGTACGGTACTTCCGGACAGTGCTGAAAACTGTGACCCCCCAAAAGTGCACGCTACTTTGCTAA | 69 | N/A | ssDNA | Legionella Pneumophila (Lp) strain Lp02 | Whole cell | SPRi-based titration assay using Lp aptamer for detecting L. pneumophila. | The limit of detection for this system was 10(4.4) cells/ml, with a linear dynamic range of 10(4.3) –10(7.7) cells/ml. | N/A | N/A | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | Patent application no US 16/850,355 |
| ABdb_1740 | 36108985 | 2022 | Naked-eye detection of Staphylococcus aureus in powdered milk and infant formula using gold nanoparticles | Anti-S. aureus aptamer (Apt1) | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (FPR3757 USA300) | Whole cell | Developed a colorimetric LSPR aptasensor using gold nanoparticles for the detection of S. aureus in milk and infant formula. | Could be visually detected within 30 min, with detection limits of 7.5 × 10(4) CFU/mL and 8.4 × 10(4) CFU/mL in milk and infant formula, respectively. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1741 | 34802926 | 2022 | Rapid and selective detection of Bacillus cereus in food using cDNA-based up-conversion fluorescence spectrum copy and aptamer modified magnetic separation | Aptamer | AGCAGCACAGAGGTCAGATGCCCCCCTTTTATCCGTCGGCATGATGTCTCCCGATCCGGTCCTATGCGTGCTA | 73 | N/A | ssDNA | Bacillus Cereus | Whole cell | Developed an aptansensor for Bacillus cereus detection based on up-conversion and magnetic nanomaterials (UCNPs-cDNA-Apt-MNPs complex). | Display a linear range of 49-49 × 10(6) cfu/mL under the optimal conditions with a detection limit of 22 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1743 | 36192057 | 2022 | Aptamer-based colorimetric detection of methicillin-resistant Staphylococcus aureus by using a CRISPR/Cas12a system and recombinase polymerase amplification | Aptamer 2 | CCTCCCTCCCTCCCTTTTTCCCACCCACCCACC | 33 | N/A | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Whole cell | Developed an aptamer-based colorimetry sensor using a CRISPR/Cas12a system and recombinase polymerase amplification (RPA) for sensitive detection of MRSA. | MRSA was detected as low as 8 CFU/mL and can be quantified with a linear range of 10 CFU/mL to 10(5) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1744 | 35275270 | 2022 | DNAzyme-controlled plasmonic coupling for SERS-based determination of Salmonella typhimurium using hybridization chain reaction self-assembled G-quadruplex | Apt | AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (KCTC 1925) | Whole cell | Developed a SERS aptasensor based on hybridization chain reaction (HCR) self-assembled G-quadruplex DNAzyme (GQH DNAzyme)-controlled plasmonic coupling for S. typhimurium detection. | Display a linear range from 5 to 5.0 × 10(5) cfu/mL and the limit of detection (LOD) of 4 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1745 | https://doi.org/10.1016/j.snb.2021.130839 | 2022 | A dual-mode aptasensor for foodborne pathogens detection using Pt, phenylboric acid and ferrocene modified Ti3C2 MXenes nanoprobe | V.P-Apt | TTTTTTCACCCCACCTCGCTCCCGTGACACTAATGCTA | 38 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a dual-mode aptasensor based on electrochemical and colorimetric modes using PBA-Fc@Pt@MXenes nanoprobe for the detection of V.P in shrimps. | Showed a LOD and linear range of 5 CFU/mL and 10(1) to 10 (8) CFU/mL by electrochemical mode and 30 CFU/mL and 10(2) to 10 (8) CFU/mL by coulometric mode. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | The electrochemical signal retained 89.6% of its original value after 2 weeks. | N/A | N/A | N/A |
| ABdb_1746 | https://doi.org/10.1016/j.snb.2021.130879 | 2022 | Aptamer-conjugated magnetic Fe3O4@Au core-shell multifunctional nanoprobe: A three-in-one aptasensor for selective capture, sensitive SERS detection and efficient near-infrared light triggered photothermal therapy of Staphylococcus aureus | Apt | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CMCC 26003) | Whole cell | Developed an aptasensor based on Fe3O4@Au nanocomposites (NCs) for capture, SERS detection, and photothermal therapy (PTT) of S. aureus. | The detection limit is 25 cfu/mL, the cell capture efficiency (CCE) is as high as 68% and it has a high photothermal conversion efficiency of 39.28%. | N/A | N/A | N/A | Diagnostic/Therapeutics | N/A | 5'-Thiolated | The cytotoxicity of Fe3O4@Au-Apt NCs to S. aureus is negligible. | The SERS intensity of S. aureus on the Fe3O4@Au-Apt NCs remains almost unchanged within 12 days. | N/A | N/A | N/A |
| ABdb_1747 | 37512948 | 2023 | Alpha-Gal Bound Aptamer and Vancomycin Synergistically Reduce Staphylococcus aureus Infection In Vivo | αSA31 | ATGATCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGA | 49 | N/A | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) (ATCC 33591) | Whole cell | αSA31 rescue α-1, 3-galactosyltransferase (−/−) knockout (GTKO) mice from induced MRSA sepsis. | 3.5-fold more (p < 0.05) pretreated MRSA were phagocytized when also treated with αSA31 and 7/12 mice treated with vancomycin plus αSA31 survived in-vivo. | N/A | N/A | N/A | Therapeutics | N/A | 5'-α-gal and 5'-Amidation (NH₂-(CH2)6) | No toxicity was observed, even at 10,000 µg/kg/day. | αSA31NH2 was significantly more stable (p < 0.01) in human serum, as no degradation was observed after 24 h at 37°C. | N/A | 5.222 h in Human serum. | N/A |
| ABdb_1768 | https:doi.org10.1016j.snb.2023.134218 | 2023 | Dual-mode sensing platform based on aptamer-tunable catalytic activity of mesoporous polydopamine/MnO2 nanozymes for detecting S. aureus | SA31 | GCAATGGTACGGTACTTCCTCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGACAAAAGTGCACGCTACTTTGCTA | 87 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Colourimetric-electrochemical sensing platform to detect S. aureus based on a dual-modal strategy. | Shows a low detection limit in 3 CFU/mL with a linear range between 5 and 10(7) CFU/mL and in a real sample with the recovery of 95.15%− 115.28%. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1770 | 38157041 | 2023 | A point-of-care aptasensor based on the upconversion nanoparticles/MoS2 FRET system for the detection of Pseudomonas aeruginosa infection | Aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa | Whole cell | Develop an aptasensor based on FRET between UCNPs-apt/MoS2 for rapid detection of P. aeruginosa. | Exhibit a wide linear detection range 8.7 × 10 ~ 8.7 × 10(7) cfu/mL, and a low limit of detection (LOD) of 15.5 cfu/mL within 1.5 h. | N/A | N/A | N/A | Biosensor | N/A | 5'-COOH (Carboxylated) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1771 | https://doi.org/10.1016/j.colsurfa.2023.131955 | 2023 | MoS2 nanosheets based label-free colorimetric aptasensor for Escherichia coli O157: H7 detection | Aptamer | ATCCGTCACACCTGCTCTGTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCGTGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Developed colorimetric aptasensor based on aptamer-functionalized MoS2 nanosheets for the detection of E. coli O157: H7. | Detection of E. coli O157: H7 with a Limit of detection (LOD) of 116 CFU/mL and a linear concentration range of 500–5000 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1772 | 37286753 | 2023 | An ultrasensitive aptamer-based fluorescent on/off system for trace amount evaluation of Yersinia enterocolitica in food samples | Aptamer | AGCAGCACAGAGGTCAGATGCTTGGTTCCACCGTACTGACTGTAGTAAATCTGATCACTCCTATGCGTGCTACCGTGAA | 79 | N/A | ssDNA | Yersinia Enterocolitica (PTCC 1786) | Whole cell | Fluorescence-based aptasensor using graphene oxide (GO) as a quenching platform was developed for the detection of Y. enterocolitica. | Exhibited a wide linear response in the concentration range 10 to 1.0 × 10(9) CFU/mL and the limit of detection (LOD) was 3 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | FAM-aptamer-GO shows better stability in acidic environments, and pH 7 showed the greatest increase. It shows no obvious changes in fluorescence intensity within 60 days. | N/A | N/A | N/A |
| ABdb_1774 | 37244192 | 2023 | High-throughput, highly sensitive and rapid SERS detection of Escherichia coli O157:H7 using aptamer-modified Au@macroporous silica magnetic photonic microsphere array | Aptamer | TGGTCGTGGTGAGGTGCGTGTATGGGTGGTGGATGAGTGTGTGGC | 45 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (CICC 21530) | Whole cell | An aptamer-Au@MMSPM SERS array biochip method was developed for the detection of E. coli O157:H7. | Gave a wide linear detection range (10–10(6) CFU/mL) and low limit of detection (2.20 CFU/mL) for E. coli O157:H7. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (SH-C12) (of Aptamer 1) and 3'-Amidation (NH₂-(CH2)6) (for Aptamer 2) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1776 | 36906992 | 2023 | An ultrasensitive electrochemical aptasensor using Tyramide-assisted enzyme multiplication for the detection of Staphylococcus aureus | SA37 | GCTTCCAGCTTATTGAATAAAGACGGGGGGGGGGACCGGCGTATGAGTGAAGATGGGGGCGCTGAAGCGCGGAAGC | 76 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | An electrochemical aptasensor based on the tyramide signal amplification (TSA) technology was developed for the detection of S. aureus. | Achieved a limit of detection (LOD) of 3 CFU/mL in buffer and 8 CFU/mL in both tap water and beef broth. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1777 | 36832038 | 2023 | Applicability of a Green Nanocomposite Consisted of Spongin Decorated Cu2WO4(OH)2 and AgNPs as a High-Performance Aptasensing Platform in Staphylococcus aureus Detection | Apt | TCGGCACGTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTC | 43 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed an aptasensing Platform based on a Green Nanocomposite consisting of Spongin Decorated Cu2WO4(OH)2 and AgNPs for Staphylococcus aureus detection. | Measured S. aureus under a linear concentration range of 10–10(8) CFU/mL and a limit of quantification and detection of 12 and 1 CFU/mL, respectively. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1782 | 36549213 | 2023 | Ultrasensitive dual-enhanced sandwich strategy for simultaneous detection of Escherichia coli and Staphylococcus aureus based on optimized aptamers-functionalized magnetic capture probes and graphene oxide-Au nanostars SERS tags | Apt1 | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | A SERS platform using aptamers modified-Fe3O4@SiO2-Au NCs was developed for simultaneous detection of E. coli and S. aureus. | The detection limit for E. coli was as low as 10 cfu/mL, and the linear concentration ranged from 10(1)-10(8) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) or 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1783 | 36549213 | 2023 | Ultrasensitive dual-enhanced sandwich strategy for simultaneous detection of Escherichia coli and Staphylococcus aureus based on optimized aptamers-functionalized magnetic capture probes and graphene oxide-Au nanostars SERS tags | Apt2 | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CMCC 26003) | Whole cell | A SERS platform using aptamers modified-Fe3O4@SiO2-Au NCs was developed for simultaneous detection of E. coli and S. aureus. | The detection limit for S. aureus was as low as 10 cfu/mL, and the linear concentration ranged from 10(1)-10(8) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) or 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1784 | https://doi.org/10.1016/j.snb.2023.133554 | 2023 | A novel Aptamer-induced CHA amplification strategy for ultrasensitive detection of Staphylococcus aureus and NIR-triggered photothermal bactericidal Activity based on aptamer-modified magnetic Fe3O4@AuNRs | Aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed a Fe3O4 @AuNRs-aptasensor based on CHA for ultrasensitive detection of S. aureus. | Achieved a linear response ranging from 10(2) to 10(6) CFU/mL and a detection limit of 10(1) CFU/mL under optimal conditions. | N/A | N/A | N/A | Biosensor | N/A | 3'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1785 | https://doi.org/10.1016/j.cclet.2022.108102 | 2023 | Rapid detection of pathogenic bacteria based on a universal dual-recognition FRET sensing system constructed with aptamer-quantum dots and lectin-gold nanoparticles | Aptamer | ATCCGTCACACCTGCTCTATCAAATGTGCAGATATCAAGACGATTTGTACAAGATGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) (CICC 21530) | Whole cell | Developed a dual-recognition-based sandwich FRET sensor using Aptamer-QDs and Con A-AuNPs for the detection of E. coli. | Achieved a linear detection range from 10(2) cfu/mL to 2 × 10(8) cfu/mL with the detection limit of 45 cfu/mL for E. coli, and LOD in the milk and orange juice was 300 cfu/mL and 200 cfu/mL, respectively. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1786 | https://doi.org/10.1016/j.snb.2023.133745 | 2023 | Dual recognition strategy for the rapid and precise detection of Bacillus cereus using post-modified nano-MOF and aptamer | Aptamer | AGCAGCACAGAGGTCAGATGCCCCCCTTTTATCCGTCGGCATGATGTCTCCCGATCCGGTCCTATGCGTGCTA | 73 | N/A | ssDNA | Bacillus Cereus (CICC 10041) | Whole cell | A dual-recognition strategy using a fluorescent probe, FcMBL-coated nano-MIL-53(Al)-NH2, for detecting B. cereus was developed. | Shows a linear range of 20–2 × 10(8) CFU/mL with a limit of detection of 4 CFU/mL within 60 min. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1787 | 37196408 | 2023 | A SERS bioassay based on vancomycin-modified PEI-interlayered nanocomposite and aptamer-functionalized SERS tags for synchronous detection of Acinetobacter baumannii and Klebsiella pneumoniae | K2 | AATCAGGCTCAGCATGGAGTTGCGAGGCCAATATCCGGTTAAGCG | 45 | N/A | ssDNA | Klebsiella Pneumoniae (KP) | Whole cell | A double-edged sword SERS aptasensor was developed using SPION-PEI-Au-Van nanocomposites for synchronous detection of K. pneumoniae and A. baumannii in food and clinical samples. | Shows a limit of detection was 10 cells/mL with a linear range of 50-10(5) cells/mL for both KP and AB. | N/A | N/A | 5.377 nM | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1788 | 37196408 | 2023 | A SERS bioassay based on vancomycin-modified PEI-interlayered nanocomposite and aptamer-functionalized SERS tags for synchronous detection of Acinetobacter baumannii and Klebsiella pneumoniae | AB | ACAGCACCACAGACCACATATCACATGCTGTCGCCTTGCGATATCAATTCCAGTGATGTTTGTCTTCCTGCC | 72 | N/A | ssDNA | Acinetobacter Baumannii | Whole cell | A double-edged sword SERS aptasensor was developed using SPION-PEI-Au-Van nanocomposites for synchronous detection of K. pneumoniae and A. baumannii in food and clinical samples. | Shows a limit of detection was 10 cells/mL with a linear range of 50-10(5) cells/mL for both KP and AB. | N/A | N/A | 6.8 nM | Biosensor | N/A | 5'-Cyanine5 (Cy5) Labeled and 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1792 | https://doi.org/10.1016/j.snb.2022.132860 | 2023 | A HCR based multivalent aptamer amplifier for ultrasensitive detection of Salmonella | Apt (mono-apt) | GAGAGAGAATATAAGGGAAAAAAAAAAAAAAAAAAAAGTCAACACGAGAGGAGGGGAGTGGAATCAGGATAGGTGTGTAGGG | 82 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a hybridization chain reaction (HCR) based multivalent aptamer (multi-Apt) as an effective signal amplifier for the sensitive detection of Salmonella. | N/A | N/A | Enzyme-Linked Immunosorbent Assay (ELISA) | 389.63 nM (with mono-apt) | Biosensor | N/A | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1793 | https://doi.org/10.1016/j.snb.2022.132860 | 2023 | A HCR based multivalent aptamer amplifier for ultrasensitive detection of Salmonella | Apt1 (multi-apt) | GAAGTGTACGTAGCCTGATTAAAAAAAAAAAAGTCAACACGAGAGGAGGGGAGTGGAATCAGGATAGGTGTGTAGGG | 77 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a hybridization chain reaction (HCR) based multivalent aptamer (multi-Apt) as an effective signal amplifier for the sensitive detection of Salmonella. | Could detect Salmonella with multi-apt as low as 7 cfu/mL with a broad detection range of 10 to 10(7) cfu/mL. | N/A | Enzyme-Linked Immunosorbent Assay (ELISA) | 11.72 nM (with multi-apt) | Biosensor | N/A | 5'-Biotinylated and 5'-FAM Labeled | N/A | The signals generated by the multi-Apt amplifier with different storage times at 4°C have remained unchanged over the past month. | N/A | N/A | N/A |
| ABdb_1794 | https://doi.org/10.1016/j.snb.2022.132860 | 2023 | A HCR based multivalent aptamer amplifier for ultrasensitive detection of Salmonella | Apt2 (multi-apt) | TCGTCTACACTACTGCTCTTAAAAAAAAAAAAGTCAACACGAGAGGAGGGGAGTGGAATCAGGATAGGTGTGTAGGG | 77 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a hybridization chain reaction (HCR) based multivalent aptamer (multi-Apt) as an effective signal amplifier for the sensitive detection of Salmonella. | Could detect Salmonella with multi-apt as low as 7 cfu/mL with a broad detection range of 10 to 10(7) cfu/mL. | N/A | Enzyme-Linked Immunosorbent Assay (ELISA) | 11.72 nM (with multi-apt) | Biosensor | N/A | 5'-Biotinylated and 5'-FAM Labeled | N/A | The signals generated by the multi-Apt amplifier with different storage times at 4°C have remained unchanged over the past month. | N/A | N/A | N/A |
| ABdb_1795 | https://doi.org/10.1016/j.snb.2022.132860 | 2023 | A HCR based multivalent aptamer amplifier for ultrasensitive detection of Salmonella | Apt3 (multi-apt) | TCTCCAATGACGTACCTGTTAAAAAAAAAAAAGTCAACACGAGAGGAGGGGAGTGGAATCAGGATAGGTGTGTAGGG | 77 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a hybridization chain reaction (HCR) based multivalent aptamer (multi-Apt) as an effective signal amplifier for the sensitive detection of Salmonella. | Could detect Salmonella with multi-apt as low as 7 cfu/mL with a broad detection range of 10 to 10(7) cfu/mL. | N/A | Enzyme-Linked Immunosorbent Assay (ELISA) | 11.72 nM (with multi-apt) | Biosensor | N/A | 5'-Biotinylated and 5'-FAM Labeled | N/A | The signals generated by the multi-Apt amplifier with different storage times at 4°C have remained unchanged over the past month. | N/A | N/A | N/A |
| ABdb_1796 | https://doi.org/10.1016/j.snb.2022.132860 | 2023 | A HCR based multivalent aptamer amplifier for ultrasensitive detection of Salmonella | Apt4 (multi-apt) | GTTGCAGTACTCTACGAGTTAAAAAAAAAAAAGTCAACACGAGAGGAGGGGAGTGGAATCAGGATAGGTGTGTAGGG | 77 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a hybridization chain reaction (HCR) based multivalent aptamer (multi-Apt) as an effective signal amplifier for the sensitive detection of Salmonella. | Could detect Salmonella with multi-apt as low as 7 cfu/mL with a broad detection range of 10 to 10(7) cfu/mL. | N/A | Enzyme-Linked Immunosorbent Assay (ELISA) | 11.72 nM (with multi-apt) | Biosensor | N/A | 5'-Biotinylated and 5'-FAM Labeled | N/A | The signals generated by the multi-Apt amplifier with different storage times at 4°C have remained unchanged over the past month. | N/A | N/A | N/A |
| ABdb_1797 | https://doi.org/10.1016/j.snb.2022.132860 | 2023 | A HCR based multivalent aptamer amplifier for ultrasensitive detection of Salmonella | Apt5 (multi-apt) | TGTACTGGACAAGTGACGTTAAAAAAAAAAAAGTCAACACGAGAGGAGGGGAGTGGAATCAGGATAGGTGTGTAGGG | 77 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a hybridization chain reaction (HCR) based multivalent aptamer (multi-Apt) as an effective signal amplifier for the sensitive detection of Salmonella. | Could detect Salmonella with multi-apt as low as 7 cfu/mL with a broad detection range of 10 to 10(7) cfu/mL. | N/A | Enzyme-Linked Immunosorbent Assay (ELISA) | 11.72 nM (with multi-apt) | Biosensor | N/A | 5'-Biotinylated and 5'-FAM Labeled | N/A | The signals generated by the multi-Apt amplifier with different storage times at 4°C have remained unchanged over the past month. | N/A | N/A | N/A |
| ABdb_1799 | 36961921 | 2023 | Dual Synthetic Receptor-Based Sandwich Electrochemical Sensor for Highly Selective and Ultrasensitive Detection of Pathogenic Bacteria at the Single-Cell Level | S. aureus aptamer | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | An electrochemical sandwich sensor was developed for the detection of a single bacterial cell based on dual recognition by the bacteria-imprinted polymer film (BIF) and aptamer (Au@Fc-Apt). | The sensor could detect as low as 10 CFU/mL in a milk sample and 1 CFU/mL in PBS with a linear range from 10 to 10(5) CFU/mL for S. aureus. | N/A | N/A | N/A | Biosensor | N/A | 3'-Thiolated (HS-(CH2)6) | N/A | After storage at 4°C for 17 days, the sensor still retained about 92% of the initial detection signal. | N/A | N/A | N/A |
| ABdb_1800 | https://doi.org/10.1002/celc.202300257 | 2023 | Rolling Circle Amplification/G-Quadruplex-Based Dual-Signal Ratiometric Electrochemical Aptasensor for Ultrasensitive Detection of Pathogenic Bacteria | Aptamer (P1) | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 87 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923 and ATCC 29213) | Whole cell | Developed a ratiometric dual-signal electrochemical biosensor for ultrasensitive detection of S. aureus based on an aptamer recognition-induced rolling circle amplification (RCA)/G-quadruplex strategy. | Showed a good linear relationship between 10–10(6) CFU/mL with a detection limit of 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | Ferrocene (Fc) conjugated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1801 | https://doi.org/10.1016/j.aac.2023.07.005 | 2023 | DNA aptamers selection and characterization for development of impedimetric aptasensor for Bacillus cereus at different growing stages | B3 | AGCAGCACAGAGGTCAGATG-AGGCCCGGGTTTGGTTCTGGGGTTGGCGGGCTGCGTGAGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bacillus Cereus (CICC 10041) | Whole cell | Identify aptamers against B. cereus across different growth phases and develop an impedance-based aptasensor immobilized on a GCE/Au surface for its detection. | N/A | 16 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1802 | https://doi.org/10.1016/j.aac.2023.07.005 | 2023 | DNA aptamers selection and characterization for development of impedimetric aptasensor for Bacillus cereus at different growing stages | B4 | AGCAGCACAGAGGTCAGATG-GAAGGGTTTGGTGGTAAATTGCGTGGTTGGCTGTTGATGG-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bacillus Cereus (CICC 10041) | Whole cell | Identify aptamers against B. cereus across different growth phases and develop an impedance-based aptasensor immobilized on a GCE/Au surface for its detection. | N/A | 16 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1803 | https://doi.org/10.1016/j.aac.2023.07.005 | 2023 | DNA aptamers selection and characterization for development of impedimetric aptasensor for Bacillus cereus at different growing stages | B6 | AGCAGCACAGAGGTCAGATG-GGCGGGTTTGGATCTTTGGTTGGCGCTTGTTTCTTTATGA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bacillus Cereus (CICC 10041) | Whole cell | Identify aptamers against B. cereus across different growth phases and develop an impedance-based aptasensor immobilized on a GCE/Au surface for its detection. | N/A | 16 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1804 | https://doi.org/10.1016/j.aac.2023.07.005 | 2023 | DNA aptamers selection and characterization for development of impedimetric aptasensor for Bacillus cereus at different growing stages | B7 | AGCAGCACAGAGGTCAGATG-TCGGTCGGGTTTGGGTGTTGGTTGGCGATAAAGATAACTG-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bacillus Cereus (CICC 10041) | Whole cell | Identify aptamers against B. cereus across different growth phases and develop an impedance-based aptasensor immobilized on a GCE/Au surface for its detection. | N/A | 16 | Flow Cytometry | 19.64 ± 4.11 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1805 | https://doi.org/10.1016/j.aac.2023.07.005 | 2023 | DNA aptamers selection and characterization for development of impedimetric aptasensor for Bacillus cereus at different growing stages | B11 | AGCAGCACAGAGGTCAGATG-GTGTAGGTCAATCGACGCCACCCATAGCAACCATCCTGCG-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bacillus Cereus (CICC 10041) | Whole cell | Identify aptamers against B. cereus across different growth phases and develop an impedance-based aptasensor immobilized on a GCE/Au surface for its detection. | N/A | 16 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1806 | https://doi.org/10.1016/j.aac.2023.07.005 | 2023 | DNA aptamers selection and characterization for development of impedimetric aptasensor for Bacillus cereus at different growing stages | B14 | AGCAGCACAGAGGTCAGATG-GTGGGCAGTGGGGGGAGGGGGAGGTGGAGGTTAGACGTGA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bacillus Cereus (CICC 10041) | Whole cell | Identify aptamers against B. cereus across different growth phases and develop an impedance-based aptasensor immobilized on a GCE/Au surface for its detection. | N/A | 16 | Flow Cytometry | 28.64 ± 3.10 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1807 | https://doi.org/10.1016/j.aac.2023.07.005 | 2023 | DNA aptamers selection and characterization for development of impedimetric aptasensor for Bacillus cereus at different growing stages | B15 | AGCAGCACAGAGGTCAGATG-GGCGGGTTTGGATCTTTGGTTGGCGCCTGTTTCTTTATGA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bacillus Cereus (CICC 10041) | Whole cell | Identify aptamers against B. cereus across different growth phases and develop an impedance-based aptasensor immobilized on a GCE/Au surface for its detection. | Achieve highly sensitive detection of B. cereus as low as 10 cfu/mL. | 16 | Flow Cytometry | 16.13 ± 4.98 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1808 | https://doi.org/10.1016/j.aac.2023.07.005 | 2023 | DNA aptamers selection and characterization for development of impedimetric aptasensor for Bacillus cereus at different growing stages | B16 | AGCAGCACAGAGGTCAGATG-ATATGTTTACGCCAGTGGTATTATTGGGGTTGATATGTCA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bacillus Cereus (CICC 10041) | Whole cell | Identify aptamers against B. cereus across different growth phases and develop an impedance-based aptasensor immobilized on a GCE/Au surface for its detection. | Achieve highly sensitive detection of B. cereus as low as 10 cfu/mL. | 16 | Flow Cytometry | 20.67 ± 5.23 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1809 | 37619902 | 2023 | Development of a label-free impedimetric aptasensor for the detection of Acinetobacter baumannii bacteria | Aptamer | ACAGCACCACAGACCACATATCACATGCTGTCGCCTTGCGATATCAATTCCAGTGATGTTTGTCTTCCTGCC | 72 | N/A | ssDNA | Acinetobacter Baumannii (ATCC 19606) | Whole cell | An electrochemical aptasensor was developed using an aptamer immobilized on the surface of a CSPE modified with the nanocomposite Fe3O4@SiO2@Glyoxal (Gly) for A. baumannii detection. | Specifically detect A. baumannii in the concentration range from 1.0 × 10(3)–1.0 × 10(8) CFU/mL and with a detection limit of 150 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | The current response from 0 day to 28 days was 94.3%, 90%, and 86.5% of the primary Rct response of the aptasensor remained at 4°C after 14, 21 and 28 days, respectively. | N/A | N/A | N/A |
| ABdb_1810 | 37437266 | 2023 | Specific Instantaneous Detection of Klebsiella pneumoniae for UTI Diagnosis with a Plasmonic Gold Nanoparticle Conjugated Aptasensor | KPBA1 | GGCTGGATGGGGCGTGT-GGAGCCCCGTTAGAATATCAGAGGTGGTGG-CAACGGTGCGGACAGCG | 64 | 5'-GGCTGGATGGGGCGTGT-30N-CAACGGTGCGGACAGCG-3' | ssDNA | Klebsiella Pneumoniae (MTCC-7028) | Whole cell | Developed localized surface plasmon resonance (LSPR) aptasensor using a tailor-made plasmonic aptamer-gold nanoparticle (AuNP) for detection of Klebsiella pneumoniae. | LoD as low as 3.4 × 10(3) CFU/mL within 5 min. | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5′-Thiolated (5′-/5ThioMC6-D) and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1811 | https://doi.org/10.3390/fishes8100477 | 2023 | A Novel Method for Sensitive Detection of Vibrio alginolyticus Based on Aptamer and Hybridization Chain Reaction in Aquaculture | Aptamer | GAGAGAGAATATAAGGGAAAAAAAATCAGTCGCTTCGCCGTCTCCTTCGGGGGCGCGGTGAGGGGCTGCACAAGAGGGAGGCACAAGAGGGAGACCCCAGAGGG | 104 | N/A | ssDNA | Vibrio Alginolyticus (ATCC 17749) | Whole cell | Developed a method using an HCR-based multivalent aptamer (multi-Apt) for the detection of Vibrio alginolyticus. | Obtained a linear range from 10 to 10(7) CFU/mL, and the limit of detection (LOD) is 3 CFU/mL. | N/A | N/A | N/A | Detection | N/A | SA-HRP or 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1812 | 37893744 | 2023 | A Colorimetric/Fluorescent Dual-Mode Aptasensor for Salmonella Based on the Magnetic Separation of Aptamers and a DNA-Nanotriangle Programmed Multivalent Aptamer | Apt1 | GAAGTGTACGTAGCCTGATTCTTGGGCGGTTGGTGTGATGGGCTTTTTTCGTTGGGCCGG | 60 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a colorimetric/fluorescent dual-mode method based on a DNA-nanotriangle programmed multivalent aptamer (NTri-Multi-Apt) for the detection of Salmonella. | Achieved a linear range of 1.0 × 10(2)–1.0 × 10(7) CFU/mL and LODs of 316 and 60 CFU/mL for colorimetric and fluorescent detection, respectively. | N/A | Enzyme-Linked Immunosorbent Assay (ELISA) | 11.89 nM | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1813 | 37893744 | 2023 | A Colorimetric/Fluorescent Dual-Mode Aptasensor for Salmonella Based on the Magnetic Separation of Aptamers and a DNA-Nanotriangle Programmed Multivalent Aptamer | Apt2 | TACTGCTCTTCTTGGGCGGTTGGTGTGATGGGCTTTTTTCGTTGGGCCGG | 50 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a colorimetric/fluorescent dual-mode method based on a DNA-nanotriangle programmed multivalent aptamer (NTri-Multi-Apt) for the detection of Salmonella. | Achieved a linear range of 1.0 × 10(2)–1.0 × 10(7) CFU/mL and LODs of 316 and 60 CFU/mL for colorimetric and fluorescent detection, respectively. | N/A | Enzyme-Linked Immunosorbent Assay (ELISA) | 11.89 nM | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1814 | 37893744 | 2023 | A Colorimetric/Fluorescent Dual-Mode Aptasensor for Salmonella Based on the Magnetic Separation of Aptamers and a DNA-Nanotriangle Programmed Multivalent Aptamer | Apt3 | CGTACCTGTTCTTGGGCGGTTGGTGTGATGGGCTTTTTTCGTTGGGCCGG | 50 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a colorimetric/fluorescent dual-mode method based on a DNA-nanotriangle programmed multivalent aptamer (NTri-Multi-Apt) for the detection of Salmonella. | Achieved a linear range of 1.0 × 10(2)–1.0 × 10(7) CFU/mL and LODs of 316 and 60 CFU/mL for colorimetric and fluorescent detection, respectively. | N/A | Enzyme-Linked Immunosorbent Assay (ELISA) | 11.89 nM | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1815 | https://doi.org/10.1016/j.cej.2023.143099 | 2023 | Design nanoprobe based on DNA tetrahedron supported hybridization chain reaction and its application to in situ analysis of bacteria | Aptamer (AA) | AGTGCGCAGCTAGCAAGGCCTTTTTTTTTTGCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 118 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 6538) | Whole cell | Developed a nanoprobe (DTAAT) based on DNA tetrahedral supported hybridization chain reaction (HCR) for in situ analysis of SA. | Detect SA with the detection limit as low as 26 CFU/mL and linear range of 50-5×10(6) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled and 3'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1816 | 36493674 | 2023 | Sandwich-Type Electrochemical Aptasensor for Highly Sensitive and Selective Detection of Pseudomonas Aeruginosa Bacteria Using a Dual Signal Amplification Strategy | F23 | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 15442) | Whole cell | Developed a sandwich-type electrochemical aptasensor using a carbon screen-printed electrode (MIL101(Cr)/MWCNT) and AgNPs/C-g-C3N4/Apt for P. aeruginosa detection. | Display a limit of detection of 1 CFU/mL and a linear range of 10 to 10(7) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | The DPV current intensity of the aptasensor for 10(5) CFU/mL of P. aeruginosa was approximately 92.4% of its initial signals after 21 days stored at 4°C. | N/A | N/A | N/A |
| ABdb_1817 | 36705734 | 2023 | A universal approach for sensitive and rapid detection of different pathogenic bacteria based on aptasensor-assisted SERS technique | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CICC 10473) | Whole cell | Developed an assembled aptasensor based on Fe3O4@Au@Ag nanocomposites for the detection of various pathogenic bacteria. | Showed a linear range of 10-10(7) CFU/mL, with a detection limit of 5.70 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1818 | 36705734 | 2023 | A universal approach for sensitive and rapid detection of different pathogenic bacteria based on aptasensor-assisted SERS technique | E. coli aptamer | CAGCTCAGAAGCTTGATCCTACCAGTAGACTTTCAACTTTACTGCCATCGTGTGCCCTAAGACTCGAAGTCGTGCATCTG | 80 | N/A | ssDNA | Escherichia Coli (E. Coli) (CICC 10372) | Whole cell | Developed an assembled aptasensor based on Fe3O4@Au@Ag nanocomposites for the detection of various pathogenic bacteria. | Showed a linear range of 10-10(7) CFU/mL, with a detection limit of 2.10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1819 | 36705734 | 2023 | A universal approach for sensitive and rapid detection of different pathogenic bacteria based on aptasensor-assisted SERS technique | S. flexneri aptamer | CAGCAACACTGCAACACTGTATAGTCCTGTGTGCC | 35 | N/A | ssDNA | Shigella Flexneri (CGMCC 1.1868) | Whole cell | Developed an assembled aptasensor based on Fe3O4@Au@Ag nanocomposites for the detection of various pathogenic bacteria. | Showed a linear range of 10-10(7) CFU/mL, with a detection limit of 2.72 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1820 | 36705734 | 2023 | A universal approach for sensitive and rapid detection of different pathogenic bacteria based on aptasensor-assisted SERS technique | P. aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (CICC 21636) | Whole cell | Developed an assembled aptasensor based on Fe3O4@Au@Ag nanocomposites for the detection of various pathogenic bacteria. | Showed a linear range of 10-10(7) CFU/mL, with a detection limit of 3.84 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1821 | 36705734 | 2023 | A universal approach for sensitive and rapid detection of different pathogenic bacteria based on aptasensor-assisted SERS technique | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed an assembled aptasensor based on Fe3O4@Au@Ag nanocomposites for the detection of various pathogenic bacteria. | Showed a linear range of 10-10(7) CFU/mL, with a detection limit of 2.27 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1822 | 36705734 | 2023 | A universal approach for sensitive and rapid detection of different pathogenic bacteria based on aptasensor-assisted SERS technique | L. monocytogenes aptamer | TACTATCGCGGAGACAGCGCGGGAGGCACCGGGGA | 35 | N/A | ssDNA | Listeria Monocytogenes (CICC 21635) | Whole cell | Developed an assembled aptasensor based on Fe3O4@Au@Ag nanocomposites for the detection of various pathogenic bacteria. | Showed a linear range of 10-10(7) CFU/mL, with a detection limit of 3.16 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1823 | 36166924 | 2023 | Ultrasensitive multicolor electrochromic sensor built on closed bipolar electrode: Application in the visual detection of Pseudomonas aeruginosa | Aptamer | TTTTTCCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 65 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 10145) | Whole cell | An ultrasensitive multicolour electrochromic platform based on a closed bipolar electrode (BPE) was developed for visual sensing of P. aeruginosa. | The detection limit was as low as 0.33 CFU/mL, and the linear range was 10(0)-10(8) CFU/mL within 30 min by the naked eye. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1824 | https://doi.org/10.1016/j.microc.2023.108605 | 2023 | A SERS biosensor based on aptamer-based Fe3O4@SiO2@Ag magnetic recognition and embedded SERS probes for ultrasensitive simultaneous detection of Staphylococcus aureus and Escherichia coli | S. aureus aptamer (P1) | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (BNCC 186335) | Whole cell | Developed a SERS biosensor based on aptamer-modified Fe3O4@SiO2@Ag and Au-MPBA/DTNB@Ag for simultaneous detection of S.aureus and E.coli. | Rapidly detect S. aureus with the limit of detection (LOD) of 1 CFU/mL in 20 min and a linear range from 10(1) ∼ 10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1825 | https://doi.org/10.1016/j.microc.2023.108605 | 2023 | A SERS biosensor based on aptamer-based Fe3O4@SiO2@Ag magnetic recognition and embedded SERS probes for ultrasensitive simultaneous detection of Staphylococcus aureus and Escherichia coli | E. coli aptamer (P2) | ATCCGTCACACCTGCTCTACTGGCCGGCTCAGCATGACTAAGAAGGAAGTTATGTGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) (BNCC 336902) | Whole cell | Developed a SERS biosensor based on aptamer-modified Fe3O4@SiO2@Ag and Au-MPBA/DTNB@Ag for simultaneous detection of S.aureus and E.coli. | Rapidly detect E. coli with the limit of detection (LOD) of 1 CFU/mL in 20 min and a linear range from 10(1) ∼ 10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1826 | https://doi.org/10.1016/j.microc.2023.108681 | 2023 | An electrochemical and colorimetric dual-mode aptasensor for Staphylococcus aureus based on a multifunctional MOF and magnetic separation technique | S. aureus Aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | Developed a colorimetric and electrochemical dual-mode aptasensor based on ssDNA-Au/CuMOF and MB-Apt for S. aureus detection. | Display a broad linear range from 10 to 10(8) CFU/mL, with colorimetric minimum resolution of 48 CFU/mL, and electrochemical detection limit of 5 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1827 | 37311299 | 2023 | Joint concanavalin A-aptamer enabled dual recognition for anti-interference visual detection of Salmonella typhimurium in complex food matrices | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | A dual recognition platform based on Concanavalin A (Con A)-aptamer joint strategy for sensitive determination of S. typhimurium. | Exhibited linear range of 7.0 × 10(1) ∼ 7.0 × 10(9) CFU/mL, along with a detection limit as low as 23 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1828 | 37466698 | 2023 | A signal-off aptasensor for the determination of Acinetobacter baumannii by using methylene blue as an electrochemical probe | Apt | ACAGCACCACAGACCACATATCACATGCTGTCGCCTTGCGATATCAATTCCAGTGATGTTTGTCTTCCTGCC | 72 | N/A | ssDNA | Acinetobacter Baumannii (ATCC 19606) | Whole cell | Developed an electrochemical aptasensor with Apt/MWCNT@Fe3O4@SiO2-Cl/CSPE nanocomposite to detect A. baumannii. | Display a linear range of 10.0–1.0 × 10(7) CFU/mL and a detection limit of 1 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | The current density of the aptasensor for 10(5) CFU/mL of A. baumannii was approximately 92.3% of its initial signals after 21 days. | N/A | N/A | N/A |
| ABdb_1830 | 38250355 | 2024 | Rapid Detection and Identification of Vancomycin-Sensitive Bacteria Using an Electrochemical Apta-Sensor | Apt1 | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (RN4220) | Whole cell | A portable electrochemical biosensor was developed for the identification of Gram-positive bacteria based on a vancomycin-modified screen-printed carbon electrode. | Demonstrated that capture was achieved in 10 min, with a limit of detection of only 2.7 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1831 | 38250355 | 2024 | Rapid Detection and Identification of Vancomycin-Sensitive Bacteria Using an Electrochemical Apta-Sensor | Sp14 | AGCAGCACAGGGTCAGATGATATGTTTACGCCAGTGGTATTATTGGGGTTGATATGTCACCTATGCGTG | 69 | N/A | ssDNA | Bacillus Cereus (ATCC 14579) | Whole cell | A portable electrochemical biosensor was developed for the identification of Gram-positive bacteria based on a vancomycin-modified screen-printed carbon electrode. | Demonstrated that capture was achieved in 10 min, with a limit of detection of only 2.4 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1832 | 38898115 | 2024 | Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1 | AY-19 | TCCCTACGGCGCTAAC-GACATGATGGTGCCAAACAACATTCGGAAAGCCTGACCGT-CCACCGTGCTACAAC | 71 | 5'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3' | ssDNA | Legionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152) | Whole cell | Identify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection. | Limit of Detection (LOD): 4.6 CFU/mL and linear trend ranging from 10 to 10(8) CFU/mL. | 10 | Fluorescence Binding Assay | 14.19 nM | Detection | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1833 | 38898115 | 2024 | Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1 | AY-3 | TCCCTACGGCGCTAAC-TGGCAAATAATGCAATTGAAGAAAGCCCCCCCCTGCCCGA-CCACCGTGCTACAAC | 71 | 5'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3' | ssDNA | Legionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152) | Whole cell | Identify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection. | N/A | 10 | Fluorescence Binding Assay | 15.61 nM | Detection | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1834 | 38898115 | 2024 | Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1 | AY-29 | TCCCTACGGCGCTAAC-TGTGAAACAAGGCAAGGGAACTGACGTCATAAGGATAGCA-CCACCGTGCTACAAC | 71 | 5'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3' | ssDNA | Legionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152) | Whole cell | Identify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection. | N/A | 10 | Fluorescence Binding Assay | 17.38 nM | Detection | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1835 | 38898115 | 2024 | Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1 | AY-37 | TCCCTACGGCGCTAAC-AAGATGAAAGACGACCGGACAGTACATATAGCGCTCTCGC-CCACCGTGCTACAAC | 71 | 5'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3' | ssDNA | Legionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152) | Whole cell | Identify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection. | N/A | 10 | Fluorescence Binding Assay | 17.96 nM | Detection | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1836 | 38898115 | 2024 | Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1 | AY-31 | TCCCTACGGCGCTAAC-ACCTGCAGTAGGGAATGCGAATGATGAGACGCCTGATTGG-CCACCGTGCTACAAC | 71 | 5'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3' | ssDNA | Legionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152) | Whole cell | Identify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection. | N/A | 10 | Fluorescence Binding Assay | 68.83 nM | Detection | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1837 | 38898115 | 2024 | Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1 | AY-24 | TCCCTACGGCGCTAAC-ACAGACAGAATGAGTGAACATAGGCCAATAACGCACGTCC-CCACCGTGCTACAAC | 71 | 5'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3' | ssDNA | Legionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152) | Whole cell | Identify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection. | N/A | 10 | Fluorescence Binding Assay | 75.24 nM | Detection | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1838 | https://doi.org/10.1002/adfm.202403440 | 2024 | Next-Generation Wound Care: Aptamer-Conjugated Polydiacetylene/Polyurethane Nanofibrous Biosensors for Selective In Situ Colorimetric Detection of Pseudomonas | F23 | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Developed an aptamer-modified polydiacetylene-based electrospun nanofibrous wound dressing for the detection of Pseudomonas aeruginosa. | The LOD for the aptamer-modified membrane P-F23 was 1.42 × 10(6) CFU/cm^2. | N/A | N/A | N/A | Biosensor | N/A | Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1839 | https://doi.org/10.1002/adfm.202403440 | 2024 | Next-Generation Wound Care: Aptamer-Conjugated Polydiacetylene/Polyurethane Nanofibrous Biosensors for Selective In Situ Colorimetric Detection of Pseudomonas | St21Lp17 | AAGCGTCGGTGTTCTATCGGTAGTTGACACCGACGCCT | 38 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Developed an aptamer-modified polydiacetylene-based electrospun nanofibrous wound dressing for the detection of Pseudomonas aeruginosa. | The LOD for the aptamer-modified membrane P-St21Lp17 was 4.46 × 10(6) CFU/cm^2. | N/A | N/A | N/A | Biosensor | N/A | Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1840 | 38770656 | 2024 | Sensitive and on-Site Detection of Staphylococcus aureus Based on CRISPR/Cas 13a-Assisted Chemiluminescence Resonance Energy Transfer | S. aureus Aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Develop a CRISPR/Cas 13a-assisted CRET-based strategy for the detection of S. aureus in real samples. | Successfully detected S. aureus in drinking water and milk with detection limits of 20 and 30 cfu/mL, respectively, within the recovery of 90.07–105.50%. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1842 | 39533298 | 2024 | Rapid detection of Brucella cells using a gold nanoparticle-based aptasensor via a simple colorimetric method | B. melitensis-specific aptamer | GAGAGTAAAGGCCATCGGCGGCCATTTATGTTGTACCC | 38 | N/A | ssDNA | Brucella Melitensis strain Rev. 1 vaccine and Brucella Abortus strain RB51 vaccine | Whole cell | Detection of Brucella cells using a biosensor, based on gold nanoparticles (GNPs) and a specific aptamer, via a colorimetric reaction. | Able to detect 1.5 × 10(1) CFU/mL with a linear range of 1.5 × 10(1)-1.5 × 10(8) CFU/mL of the bacterial cells. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1843 | 39212695 | 2024 | Visual fluorescence detection of Listeria monocytogenes with CRISPR-Cas12a aptasensor | Aptamer | ATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT | 47 | N/A | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Developed an aptasensor utilizing carboxylated magnetic beads and Cas12a to detect L. monocytogenes. | Demonstrates excellent sensitivity towards L. monocytogenes, with a lowest detection limit (LOD) of 57.15 CFU/mL and a linear range of 4×10(2) to 4×10(7) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1844 | 38150965 | 2024 | Colourimetric and SERS dual-mode aptasensor using Au@Ag and magnetic nanoparticles for the detection of Campylobacter jejuni | ONS-23 | GCAAGATCTCCGAGATATCGTGCTGGGGGGTGGTTTGTTTGGGTCGGTTGTTTTGGTTGGGCTGCAGGTAATACGTATACT | 81 | N/A | ssDNA | Campylobacter Jejuni (ATCC 33291) | Whole cell | Developed a dual-mode aptasensor using aptamer-conjugated Au@Ag NPs for the effective detection of C. jejuni. | Exhibit a wider linear range (1.8 × 10(1)–10(8) CFU/mL and a lower limit of detection of 6 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (for apt-1) and 5′–NH2 (for apt-2) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1846 | 38169279 | 2024 | "Five birds one stone" tri-modal monitoring driven lab-on-magnetic aptasensor for accurate pathogen detection and enhanced germicidal application | Anti-S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 65389) | Whole cell | A fluorescence-colorimetric-photothermal tri-modal sensing platform was developed for the detection of S. aureus by apt/KCl@CDs and magnetic multi-walled carbon nanotube composites (M-MWCNTs). | The detection limits of fluorescence, colorimetric and photothermal models were 4.81 cfu/mL, 3.40 cfu/mL and 6.74 cfu/mL, respectively with the same linear range of 10 - 1.0 ×10(7) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1847 | 38040292 | 2024 | One-pot rapid visual detection of E. coli O157:H7 by label-free AuNP-based plasmonic-aptasensor in water sample | (PGM) aptamer | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 43895) | Whole cell | A label-free biosensor was developed using an aptamer and single-pot Au nanoparticle (AuNP) for the detection of E. coli O157:H7. | Could identify target bacteria with as few as 250 CFU/ml in 15 min or less. | N/A | N/A | N/A | Biosensor | N/A | 5'-Dodeca-G (G12) | N/A | After five days (stored at 4°C) from synthesizing PG-apt-AuNPs, its performance in detecting 10(5) CFU/ml of E. coli O157:H7 is similar to that of newly synthesized biosensor. | N/A | N/A | N/A |
| ABdb_1848 | 38452591 | 2024 | Aptamer-mediated double strand displacement amplification with microchip electrophoresis for ultrasensitive detection of Salmonella typhimurium | Aptamer (Apt) | CTCCTCTGACTGTAACCACGGTGGTTTGATCACTATTGGGCCTTTGTGATGTCGGTAGT | 59 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed an aptamer-mediated double SDA-MCE method for ultrasensitive detection of S. typhimurium. | Achieved a linear range of 30–1.0 × 10(5) CFU/mL and the limit of detection for S. typhimurium down to 6 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1850 | https://doi.org/10.1016/j.electacta.2024.144240 | 2024 | Label-free electrochemical aptasensor for detection of Acinetobacter baumannii: Unveiling the kinetic behavior of reduced graphene oxide v/s graphene oxide | Aptamer | ACAGCACCACAGACCACATATCACATGCTGTCGCCTTGCGATATCAATTCCAGTGATGTTTGTCTTCCTGCC | 72 | N/A | ssDNA | Acinetobacter Baumannii (ATCC BAA-2800) | Whole cell | Developed an electrochemical aptasensor that employed a screen-printed carbon electrode modified with both graphene oxide (GO) and reduced graphene oxide (rGO) for the detection of AB. | Achieved an impressive limit of detection of 10 CFU/mL and a linear range of 10 to 10(9) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | The current response of aptasensor exhibited negligible changes in the CV signal even after the 4-week storage period. | N/A | N/A | N/A |
| ABdb_1851 | 38180496 | 2024 | Development of an electrochemical sensitive aptasensor based on a zeolite imidazolate framework-8 and gold nanoparticles for the determination of Staphylococcus aureus bacteria | Aptamer | TCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTC | 46 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed an electrochemical aptasensor based on a glassy carbon electrode (GCE) modified with zeolite imidazolate framework-8 (ZIF 8) and gold nanoparticles (AuNPs) for the detection of S. aureus. | Showed a linear response in the concentration range of 1.5 × 10(1) to 1.5 × 10(7) CFU mL−1 and a detection limit of 3.4 CFU/mL. | N/A | N/A | (9.04 ± 1.27) × 10(−1) nM | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | Response of the proposed aptasensor reached 98.9%, 94.3%, and 92.8% of the initial response on the first, second, and third days, respectively, when kept at 4°C. | N/A | N/A | N/A |
| ABdb_1852 | 37751632 | 2024 | A novel paper-based electrochemiluminescence biosensor for non-destructive detection of pathogenic bacteria in real samples | Aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTGCTAACCCCCCTTAATCCCCCC | 104 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed a paper-based electrochemiluminescence (ECL) aptasensor based on a Ru-MOF-5 NFs modified Indium tin oxide (ITO) electrode for the detection of S. aureus. | Exhibited a linear range from 5 to 10(8) CFU/mL, and a limit of detection (LOD) of 1 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-COOH (Carboxylated) | N/A | After 9 days at 4°C, the ECL signal of aptsensor retained 95.8% of its initial value, suggesting satisfactory storage stability. | N/A | N/A | N/A |
| ABdb_1854 | 39096325 | 2024 | Colorimetric aptasensor for Listeria monocytogenes detection using dual functional Fe3O4@MIL-100(Fe) with magnetic separation and oxidase-like activities in food samples | Aptamer | TACTATCGCGGGAGACAGCGCGGGAGGCACCGGGGA | 36 | N/A | ssDNA | Listeria Monocytogenes (ATCC 15313) | Whole cell | Developed a colorimetric aptasensor based on magnetic responsiveness and oxidase-like activity of Fe3O4@MIL-100(Fe) for the detection of L.monocytogenes. | The linear range was from 10(2) to 10(7) CFU/mL, with the limit of detection as low as 14 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1855 | 38805947 | 2024 | Aptamer-functionalized Fe3O4/MWCNTs@Mo-CDs nanozyme for rapid colorimetric detection toward Escherichia coli | E. coli aptamer | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC 8099) | Whole cell | Peroxidase (POD)-like Fe3O4/MWCNTs@Mo-CDs (FMMC) nanozyme was developed for the colorimetric detection of E. coli. | Had a wide linear range of 10(1)–10(6) CFU/mL, low LOD of 0.978 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1856 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | Ab1 (A00) | TGGTGCGTGCTATTCAGAGT-GAGGGACGCATGATTGGGTGACTCCGGGAGATCATGCAAG-GAACCTGTAGCCACGAATAC | 80 | 5'-TGGTGCGTGCTATTCAGAGT-N40-GAACCTGTAGCCACGAATAC-3' | ssDNA | Aliarcobacter Butzerli (ATCC 49616) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | N/A | 12 | Fluorescence Binding Assay | 14.12 ± 2.31 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1857 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | Ab2 | TGGTGCGTGCTATTCAGAGT-GGGGTGGACCGGGGGGATCGAATAACGCATCGCGCCTAGT-GAACCTGTAGCCACGAATAC | 80 | 5'-TGGTGCGTGCTATTCAGAGT-N40-GAACCTGTAGCCACGAATAC-3' | ssDNA | Aliarcobacter Butzerli (ATCC 49616) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | N/A | 12 | Fluorescence Binding Assay | 26.26 ± 9.87 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1858 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | Ab3 | TGGTGCGTGCTATTCAGAGT-CCTCTAGGCGGTAAGGATCGGACCTTGGTCTGATGGTGAG-GAACCTGTAGCCACGAATAC | 80 | 5'-TGGTGCGTGCTATTCAGAGT-N40-GAACCTGTAGCCACGAATAC-3' | ssDNA | Aliarcobacter Butzerli (ATCC 49616) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | N/A | 12 | Fluorescence Binding Assay | 66.51 ± 24.28 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1859 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | Ab4 | TGGTGCGTGCTATTCAGAGT-GACGGATACGGATTCAGGGCGGAGTGCCAAGATACGGATG-GAACCTGTAGCCACGAATAC | 80 | 5'-TGGTGCGTGCTATTCAGAGT-N40-GAACCTGTAGCCACGAATAC-3' | ssDNA | Aliarcobacter Butzerli (ATCC 49616) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | N/A | 12 | Fluorescence Binding Assay | 97.98 ± 37.42 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1860 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | Ab5 | TGGTGCGTGCTATTCAGAGT-GTTGAGGATTAGGATCGCTTTAAACGATTAGGATCCGAAT-GAACCTGTAGCCACGAATAC | 80 | 5'-TGGTGCGTGCTATTCAGAGT-N40-GAACCTGTAGCCACGAATAC-3' | ssDNA | Aliarcobacter Butzerli (ATCC 49616) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | N/A | 12 | Fluorescence Binding Assay | 142.2 ± 39.3 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1861 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | A01 | GCGCGGGCTATTCAGAGTGAGGGCCGCGTGAGCGGGCGACTCCGGGAGATCGCGCGCG | 58 | N/A | ssDNA | Aliarcobacter Butzerli (ATCC 49616) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | N/A | 12 | Fluorescence Binding Assay | 27.91 ± 13.34 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1862 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | A02 | GAGCGGGCGACTCCGGGAGATCGCGCGCGG | 30 | N/A | ssDNA | Aliarcobacter Butzerli (ATCC 49616) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | Exhibited a wide detection range of up to 1 × 10(7) CFU/mL and the lowest limit of detection (LOD) of 1 CFU/mL, for each bacterium. | 12 | Fluorescence Binding Assay | 6.86 ± 5.77 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1863 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | A03 | CGACTCCGGGAGATCG | 16 | N/A | ssDNA | Aliarcobacter Butzerli (ATCC 49616) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | N/A | 12 | Fluorescence Binding Assay | 19.33 ± 9.76 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1864 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | C00 | GTCCTGAGACTCATGTCTGCTGTCAATCGCAAGGTCCATGTCCTGAGACTCATGTCTGCTGTCAATCGCAAGGTCCA | 77 | N/A | ssDNA | Campylobacter Jejuni (ATCC 33560) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | N/A | 12 | Fluorescence Binding Assay | 48.12 ± 6.15 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1865 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | C01 | CGCGTGTCTGCTGTCAATCGCAAGGTCCATGTCCCGCG | 38 | N/A | ssDNA | Campylobacter Jejuni (ATCC 33560) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | Exhibited a wide detection range of up to 1 × 10(7) CFU/mL and the lowest limit of detection (LOD) of 1 CFU/mL, for each bacterium. | 12 | Fluorescence Binding Assay | 27.69 ± 5.66 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1866 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | C02 | CGCGAGTCTGCTGTCAATCGCAAGGCGCG | 29 | N/A | ssDNA | Campylobacter Jejuni (ATCC 33560) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | N/A | 12 | Fluorescence Binding Assay | 61.58 ± 19.805 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1867 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | C03 | CGCTGTCAATCGCG | 14 | N/A | ssDNA | Campylobacter Jejuni (ATCC 33560) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | N/A | 12 | Fluorescence Binding Assay | 240.2 ± 106.85 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1868 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | C04 | GCGTCCATGTCGC | 13 | N/A | ssDNA | Campylobacter Jejuni (ATCC 33560) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | N/A | 12 | Fluorescence Binding Assay | 259.8 ± 55.1 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1869 | 37639893 | 2024 | Nano-biosensor based on manganese dioxide nanosheets and carbon dots for dual-mode determination of Staphylococcus aureus | Aptamer1 | TCGGCACGTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTC | 43 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed a fluorescence and colorimetry dual-mode sensor to detect S. aureus by MnO2 NSs and CDs. | Had a broad linear range of 37 ∼ 3.7 × 10(6) CFU/mL and low detection limits of 9 CFU/mL (ratiometric fluorescence) and 22 CFU/mL (colorimetry). | N/A | N/A | N/A | Biosensor | N/A | 5'-COOH (Carboxylated) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1870 | 37639893 | 2024 | Nano-biosensor based on manganese dioxide nanosheets and carbon dots for dual-mode determination of Staphylococcus aureus | Aptamer2 | GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT | 45 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed a fluorescence and colorimetry dual-mode sensor to detect S. aureus by MnO2 NSs and CDs. | Had a broad linear range of 37 ∼ 3.7 × 10(6) CFU/mL and low detection limits of 9 CFU/mL (ratiometric fluorescence) and 22 CFU/mL (colorimetry). | N/A | N/A | N/A | Biosensor | N/A | 5'-COOH (Carboxylated) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1871 | 38669846 | 2024 | Ultra-sensitive and rapid detection of Salmonella enterica and Staphylococcus aureus to single-cell level by aptamer-functionalized carbon nanotube field-effect transistor biosensors | S. enterica aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed an aptamer-functionalized CNT-FET biosensor for the detection of these foodborne pathogens. | Could detect S. enterica at a limit of detection (LOD) as low as 1 CFU in PBS buffer with a linear range from 62.5–6.4 × 10(4) CFU/mL. | N/A | Flow Cytometry | 8.9 ± 2.0 nM | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6), 5'-FAM Labeled and 3'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1872 | 38669846 | 2024 | Ultra-sensitive and rapid detection of Salmonella enterica and Staphylococcus aureus to single-cell level by aptamer-functionalized carbon nanotube field-effect transistor biosensors | S. aureus aptamer | AACGAGGCGCAGGGGGAGGGGGTGGTACAGATAAGATGGGG | 41 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CMCC(B) 26003) | Whole cell | Developed an aptamer-functionalized CNT-FET biosensor for the detection of these foodborne pathogens. | Could detect S. aureus at a limit of detection (LOD) as low as 1.2 CFU in PBS buffer with a linear range from 10(2)-1.28 × 10(4) CFU/mL. | N/A | Flow Cytometry | 0.65 ± 0.2 μM | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6), 5'-FAM Labeled and 3'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1883 | 41431270 | 2025 | Bioimaging with fluorescent nucleic-acid aptamers for the specific detection and quantification of Pseudomonas aeruginosa alone and in heterogeneous bacterial populations | F23 | ATACCAGCTTATTCAATT-CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG-AGATAGTAAGTGCAATCT | 96 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 15692) | Whole cell | Develop a fluorescent aptamer for detecting Pseudomonas aeruginosa. | 73.79% of live P. aeruginosa cells (3102/4204) were labeled by the Cy5‐F23 aptamer, compared to only 0.06% of live S. aureus (4/6767). | 15 | Flow Cytometry | 17.27 ± 5.00 nM | Imaging | Whole Cell-SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | The aptamer remains highly stable for 72 hours. | N/A | N/A | N/A |
| ABdb_1885 | 40451960 | 2025 | Screening and characterization of nucleic acid aptamers targeting Brucella surface antigens: identification and analysis of their corresponding binding sites | WS-26 | GCTGCAATACTCATGGACAGCGGAACGCTGTCTCCTCATTCAATCTAGGAGTCTGCGTGAGTCTGGAGTACGACCCTGAA | 80 | N/A | ssDNA | Brucella S2 vaccine strain | Whole cell | Binds BamA β-barrel assembly protein → blocks/inhibits bacterial invasion into host cells. | N/A | 13 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | 20.33 ± 8.12 nM | Therapeutics | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1886 | 40451960 | 2025 | Screening and characterization of nucleic acid aptamers targeting Brucella surface antigens: identification and analysis of their corresponding binding sites | WS-17 | GCTGCAATACTCATGGACAGGACAACGTCCTGTACCAGCGCTACGCCAGATCAGTTTTAGGTCTGGAGTACGACCCTGAA | 80 | N/A | ssDNA | Brucella S2 vaccine strain | Whole cell | Binds BamA β-barrel assembly protein → blocks/inhibits bacterial invasion into host cells. | N/A | 13 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | 17.11 ± 6.35 nM | Therapeutics | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1887 | 40451960 | 2025 | Screening and characterization of nucleic acid aptamers targeting Brucella surface antigens: identification and analysis of their corresponding binding sites | WS-32 | GCTGCAATACTCATGGACAGGGGACTCAGGTCCCCGGGAGCGCAATGGTGGGGTTTTAATGTCTGGAGTACGACCCTGAA | 80 | N/A | ssDNA | Brucella S2 vaccine strain | Whole cell | Binds BamA β-barrel assembly protein → blocks/inhibits bacterial invasion into host cells. | N/A | 13 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | 13.08 ± 2.97 nM | Therapeutics | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1888 | 40451960 | 2025 | Screening and characterization of nucleic acid aptamers targeting Brucella surface antigens: identification and analysis of their corresponding binding sites | WS-44 | GCTGCAATACTCATGGACAGGGACCTGTCCCTGGCCTCTTAGGGTAAAATTTTGCCACAAGTCTGGAGTACGACCCTGAA | 80 | N/A | ssDNA | Brucella S2 vaccine strain | Whole cell | Binds BamA β-barrel assembly protein → blocks/inhibits bacterial invasion into host cells. | N/A | 13 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | 15.03 ± 4.2 nM | Therapeutics | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1890 | 40308970 | 2025 | Aptamer-functionalized graphene quantum dots combined with artificial intelligence detect bacteria for urinary tract infections | Aptamer | CCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCG | 45 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Develop an aptamer-functionalized graphene quantum dots integrated with an artificial intelligence detection system (AG-AI detection system) for the detection of E. coli. | Exhibits a wide linearity (10(3)-10(9) CFU/mL) and a low detection limit (3.38×10(2) CFU/mL). | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1892 | 40855524 | 2025 | Inhibition of Enterotoxigenic Escherichia coli adhesion via aptamers prevents infection in IPEC-J2 cells | K88-Apt 37 | GGAGACCGTACCATCTGTTCGTGGAAGCGCTTTGCTCGTCCATTAGCCTTGTGCTCGTGC | 60 | N/A | ssDNA | Escherichia Coli (E. Coli) ETEC K88 (CVCC 216) | Whole cell | An aptamer was identified to effectively inhibit the adhesion of ETEC K88 to intestinal epithelial cell IPEC-J2 and reduce ETEC K88-induced cytotoxicity in IPEC-J2 cells in vitro. | K88-Apt A04 may more effectively displace ETEC K88 and induce less cytotoxicity than K88-Apt 37, as it resulted in lower TNF-α expression. | N/A | N/A | 21.68 ± 4.65 nM | Therapeutics | N/A | 5'-FAM Labeled | K88-Apt 37 revealed the lowest cytotoxicity (8.77%) at 50 nM. | N/A | N/A | N/A | N/A |
| ABdb_1895 | 39793372 | 2025 | Aptamer-molecularly imprinted polymer sensors for the detection of bacteria in water | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) strain SH1000 | Whole cell | Developed an electrochemical sensor based on aptamer-molecularly imprinted polymer (Apta-MIP) for the multiplexed detection of Staphylococcus aureus and Escherichia coli. | Can detect S. aureus with a limit of detection of 4 CFU/mL and exhibited a broad dynamic range from 1 CFU/mL to 10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1896 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S8 | CGTACGGTCGACGCTAGC-ACACCCCCCAGGATCATAAATTCTCTCGCTGTAGC-CACGTGGAGCTCGGATGC | 71 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | N/A | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | N/A | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1897 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S10 | CGTACGGTCGACGCTAGC-ACCAGCCATAGTCACATCAAAACTAACTCACATTC-CACGTGGAGCTCGGATGC | 71 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | N/A | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | N/A | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1898 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S12 | CGTACGGTCGACGCTAGC-CCCATACTCATCACCATTCACATCACTCACCTAGC-CACGTGGAGCTCGGATGC | 71 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | N/A | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | N/A | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1899 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S1 | GGATCCGAGCTCCACGTG-GCTAGGTGAGTGATGTGAATGGTGATGAGTATGGG-GCTAGCGTCGACCGTACG | 71 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | S1, the Ru-modified oligonucleotide, bound S. pneumoniae R6 with slightly lower affinity than S9. | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | 125 ± 91 nM | Detection | SELEX and Mod-SELEX | T=dURu(bpy)TP1, 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1900 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S9 | ACACCCCCCAGGATCATAAATTCTCTCGCTGTAGC | 35 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | S9 bound better to the bacterial target than the modified sequence S1. | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | 118 ± 1 nM | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1901 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S11 | ACCAGCCATAGTCACATCAAAACTAACTCACATTC | 35 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | S11 exhibited a lower propensity at binding to the bacterial target. | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | 541 ± 1 nM | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1902 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S13 | CCCATACTCATCACCATTCACATCACTCACCTAGC | 35 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | N/A | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | N/A | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1904 | 40517569 | 2025 | Ultrasensitive electrochemical aptasensor for Pseudomonas aeruginosa detection using N-doped MWCNTs/AgNPs nanocomposite | F23 | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa | Whole cell | Developed an electrochemical P.A. biosensor based on N-MWCNTs/AgNPs-10/Apt for the detection of P. aeruginosa. | Exhibited a wide linear detection range from 10(-1) to 10(6) CFU/mL, and the limit of detection is 0.0798 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1906 | 40947925 | 2025 | Smartphone-Based Fluorescence/Colorimetric Dual-Mode Aptasensor for the Detection of Salmonella Using Multivalent Aptamer and CHA Amplification | Aptamer | GTGAGAGTGGGTCATCGAAAAAACTCCTCTGACTGTAACCACGGTGGTTTGATCACTATTGGGCCTTTCTGATGTCGGTAGT | 82 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a dual-mode portable fluorescent/colorimetric aptasensor, leveraging multivalent aptamer competitive assays and catalytic hairpin assembly (CHA) for the detection of Salmonella. | Enables the quantitative detection of Salmonella within a linear range of 10 to 10(7) CFU/mL, with detection limits of 28 CFU/mL for colorimetric detection and 10 CFU/mL for fluorescent detection. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1907 | 41149287 | 2025 | Real-Time and Selective Detection of Pseudomonas aeruginosa in Beef Samples Using a g-C3N4-Doped Multimetallic Perovskite-Based Electrochemical Aptasensor | P. aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa | Whole cell | Developed an electrochemical aptasensor based on aptamer functionalized FeCoCuNiO-g-C3N4 nanocomposite for the detection of P. aeruginosa in food samples. | Exhibited a low detection limit of 3.03 CFU/mL and over a range of 1 × 10(1)–1 × 10(7) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1909 | 40801776 | 2025 | Ultrasensitive Aptamer-Based Metal-Organic Framework-on-Metal-Organic Framework Platform for Clinical Detection of KPC-2 Klebsiella pneumoniae and Multidrug-Resistant Acinetobacter baumannii | MDR-AB aptamer | CAGGGGACGCACCAAGGTTTTGTTTTTTCTTTGCTTCTTTTTGCTTTTTTTTCCATGACCCGCGTGCTGCGTGA | 74 | N/A | ssDNA | Multidrug-resistant (MDR) Acinetobacter Baumannii | Whole cell | Developed a dual nanozyme-powered colorimetric aptasensor leveraging a cascade amplification mechanism, a metal-organic framework (MOF)-on-MOF nanostructure with peroxidase-like activity for detection of KPC-2 K. pneumoniae and MDR-AB. | The system achieves selective bacterial capture within 40 min, quantifying 10–10(8) CFU/mL with a detection limit of 6 CFU/mL for MDR-AB. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1910 | 40931301 | 2025 | A novel fluorescent aptasensor using magnetic silica nanospheres and Ag@MOF nanocomposites for extraction and detection of Salmonella Typhimurium in eggs | Aptamer | TATGGCGGCGTCACCCGACGGGGACTTGCATTATGACAG | 39 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (PTCC 1709) | Whole cell | Developed a fluorescent platform based on an aptamer-Ag@MOF and Fe3O4@KCC‐1 probes for the detection of S. Typhimurium in eggs. | Achieved a linear detection range of 7.5 to 7.5 × 10⁶ CFU/mL, a detection limit of 4.61 CFU/mL, and a total detection time of 90 min. | N/A | N/A | N/A | Biosensor | N/A | 3'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1911 | 40839054 | 2025 | SERS-based aptasensor for culture-free detection of Escherichia coli in urinary tract infection diagnosis | Aptamer | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Developed a SERS-based aptasensor for the detection of E. coli. | Demonstrated a detection limit of 5.9 × 10(3) CFU/mL, which is well below the UTI cutoff value. | N/A | N/A | N/A | Biosensor | N/A | 3'-BHQ2 | N/A | N/A | N/A | N/A | N/A |
| ABdb_1912 | 40437283 | 2025 | Target-triggered hybrid chain amplified fluorescence aptasensor based on label-free dye and MnO2 nanosheets system for Escherichia coli detection | AwI | ATCAAATGTGCAGATATCAAGACGATTTGTACAAGATCCATGCTGAGGTGGTCATAGCTGATCCTACCTGTACAAATCGTCTTGAT | 86 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Developed a label-free fluorescent detection system leveraging target-triggered hybridization chain reaction (HCR) amplification for E. coli detection. | Exhibited a detection limit of 17 CFU/mL and a broad dynamic range from 5.0 × 10(1) ~ 5.0 × 10(7) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1913 | 40187870 | 2025 | 3D DNA walkers integrated with self-reporting MOFs: Pioneering ratiometric electrochemical sensing for Staphylococcus aureus | S. aureus aptamer (Apt) | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed a ratiometric electrochemical aptasensor utilizing a magnetic 3D DNA walking machine and self-assembly of MOF for the sensitive detection of S. aureus. | Demonstrates a detection range from 10 to 2 × 10(5) CFU/mL and achieves a low LOD of 2.3 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | After a duration of seven days, the ratio value maintained 91.89% of its initial intensity. | N/A | N/A | N/A |
| ABdb_1914 | 40335784 | 2025 | A novel strategy for ultrasensitive detection and effective inactivation of Staphylococcus aureus based on Fe3O4-QCS-PEI-Cu-aptamer and ladder-branch HCR | Aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed an integrated strategy based on Fe3O4-quaternary ammonium chitosan-polyetherimide-Cu-aptamer (Fe3O4-QCS-PEI-Cu-aptamer) and ladder-branch hybridization chain reaction (HCR) for the detection and inactivation of S. aureus. | The sensor demonstrated a limit of detection (LOD) of 3 CFU/mL for S. aureus and, under near-infrared (NIR) irradiation, achieved an antimicrobial efficiency of 99.946%. | N/A | N/A | N/A | Diagnostic/Therapeutics | N/A | 3'-COOH (Carboxylated) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1915 | 40016920 | 2025 | Cascaded Strand Displacement Amplification and CRISPR/Cas12a Aptasensor Utilizing MoS2 Nanoflowers for Colorectal Cancer Biomarker Porphyromonas gingivalis Detection | Apt-Pg1 | TGACTGACGACGACTC-AGTGGAGTATCGCCTTGCCGACCCGGGTGTCTACGATCAGTGAGTGGTAGT-GACTGCTCGAGCTG | 81 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Identify specific aptamers targeting P. gingivalis and develop an aptasensor based on MoS2 nanoflowers that integrates strand displacement amplification and CRISPR/Cas12a double-amplification for detection. | N/A | 15 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1916 | 40016920 | 2025 | Cascaded Strand Displacement Amplification and CRISPR/Cas12a Aptasensor Utilizing MoS2 Nanoflowers for Colorectal Cancer Biomarker Porphyromonas gingivalis Detection | Apt-Pg2 | TGACTGACGACGACTC-TGGAGCTCGGGTATTCTCGTCAGACCCTCCTGAGTTGATTTTAGCAACCG-GACTGCTCGAGCTG | 80 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Identify specific aptamers targeting P. gingivalis and develop an aptasensor based on MoS2 nanoflowers that integrates strand displacement amplification and CRISPR/Cas12a double-amplification for detection. | N/A | 15 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1917 | 40016920 | 2025 | Cascaded Strand Displacement Amplification and CRISPR/Cas12a Aptasensor Utilizing MoS2 Nanoflowers for Colorectal Cancer Biomarker Porphyromonas gingivalis Detection | Apt-Pg3 | TGACTGACGACGACTC-CGGCGAGTAACGACTATGTCGCACGGGTGTCTTACGAGACGGTTGGGGTC-GACTGCTCGAGCTG | 80 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Identify specific aptamers targeting P. gingivalis and develop an aptasensor based on MoS2 nanoflowers that integrates strand displacement amplification and CRISPR/Cas12a double-amplification for detection. | N/A | 15 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1918 | 40016920 | 2025 | Cascaded Strand Displacement Amplification and CRISPR/Cas12a Aptasensor Utilizing MoS2 Nanoflowers for Colorectal Cancer Biomarker Porphyromonas gingivalis Detection | Apt-Pg4 | TGACTGACGACGACTC-CTTGTCCATGGCTTGTCCACTCGGGTGTCTGGACAATGAAACCGAACTGC-GACTGCTCGAGCTG | 80 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Identify specific aptamers targeting P. gingivalis and develop an aptasensor based on MoS2 nanoflowers that integrates strand displacement amplification and CRISPR/Cas12a double-amplification for detection. | N/A | 15 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1919 | 40016920 | 2025 | Cascaded Strand Displacement Amplification and CRISPR/Cas12a Aptasensor Utilizing MoS2 Nanoflowers for Colorectal Cancer Biomarker Porphyromonas gingivalis Detection | Apt-Pg8 | TGACTGACGACGACTC-AGAACGCTTTATGCGCACGGGGGACTTCGGAGTCGTCGAGTACGGGTACC-GACTGCTCGAGCTG | 80 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Identify specific aptamers targeting P. gingivalis and develop an aptasensor based on MoS2 nanoflowers that integrates strand displacement amplification and CRISPR/Cas12a double-amplification for detection. | N/A | 15 | Fluorescence Binding Assay | 183.79 ± 3.27 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1920 | 40016920 | 2025 | Cascaded Strand Displacement Amplification and CRISPR/Cas12a Aptasensor Utilizing MoS2 Nanoflowers for Colorectal Cancer Biomarker Porphyromonas gingivalis Detection | Apt-Pg8A | TGACTGACGACGACTCAGAACGCTTTATGCGCACGGGGGACTTCGGAGTCGTCGAGT | 57 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Identify specific aptamers targeting P. gingivalis and develop an aptasensor based on MoS2 nanoflowers that integrates strand displacement amplification and CRISPR/Cas12a double-amplification for detection. | Achieving a limit of detection of 10 CFU/mL. | 15 | Fluorescence Binding Assay | 133.15 ± 48.56 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1921 | 40053147 | 2025 | Fluorescent aptasensor for detection of Salmonella typhimurium using boric acid-functionalized terbium metal-organic framework and magnetic nanoparticles | Aptamer | TAGGGAAGAGAAGGACATATGATCAGGAGTCATGCTACCACTGGTGATTACGCCTCGCTCAGCTTGACTAGTACATGACCACTTGA | 86 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (MTCC 3232) | Whole cell | A fluorescent detection platform was developed using boric acid-functionalized terbium metal–organic framework (BA-Tb-MOF) and carboxyl-modified magnetic nanoparticles (MNPs) to identify S. typhimurium. | Showed an inverse linear relationship within the range of 10(1)–10(9) CFU/mL, and the detection limit was 4 CFU/mL. | N/A | N/A | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled and 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1922 | 39905704 | 2025 | Au@Fe3O4 Nanoparticle-Based Colorimetric Aptasensor for Noninvasive Screening of Colorectal Cancer via Detection of Parvimonas micra | Apt-ss1 | TGACTGACGACGACTC-CCCGCAGGGGATCCGGATGCCGCGTTGGAGGAGATATGTATTATTCCATC-GACTGCTCGAGCTG | 80 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Parvimonas Micra (ATCC 33270) | Whole cell | Isolate aptamers against P. micra and develop colorimetric aptsensor using Au@Fe3O4 nanoparticles. | Demonstrated a linear response across a range of 10–10(8) CFU/mL for P. micra with a limit of detection of 11 CFU/mL. | 17 | Fluorescence Binding Assay | 33.84 ± 0.92 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1923 | 39905704 | 2025 | Au@Fe3O4 Nanoparticle-Based Colorimetric Aptasensor for Noninvasive Screening of Colorectal Cancer via Detection of Parvimonas micra | Apt-ss2 | TGACTGACGACGACTC-GGAGAACTACCGCACCAACAATTCACCGTCTGGACGTTCTGCCCTCTCCC-GACTGCTCGAGCTG | 80 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Parvimonas Micra (ATCC 33270) | Whole cell | Isolate aptamers against P. micra and develop colorimetric aptsensor using Au@Fe3O4 nanoparticles. | N/A | 17 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1924 | 39905704 | 2025 | Au@Fe3O4 Nanoparticle-Based Colorimetric Aptasensor for Noninvasive Screening of Colorectal Cancer via Detection of Parvimonas micra | Apt-ss8 | TGACTGACGACGACTC-GGGAGGTCAGACTATCTTGTTCCTCCTGGAGGTCGGGAAGAGAGTTGACG-GACTGCTCGAGCTG | 80 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Parvimonas Micra (ATCC 33270) | Whole cell | Isolate aptamers against P. micra and develop colorimetric aptsensor using Au@Fe3O4 nanoparticles. | N/A | 17 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1925 | 39905704 | 2025 | Au@Fe3O4 Nanoparticle-Based Colorimetric Aptasensor for Noninvasive Screening of Colorectal Cancer via Detection of Parvimonas micra | Apt-ss9 | TGACTGACGACGACTC-GGGGGCTGTCAAAAATTACTCTTGGGCCCAGCAATGGTAATTTTCTGACC-GACTGCTCGAGCTG | 80 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Parvimonas Micra (ATCC 33270) | Whole cell | Isolate aptamers against P. micra and develop colorimetric aptsensor using Au@Fe3O4 nanoparticles. | N/A | 17 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1926 | 40136943 | 2025 | Nanoparticle-Enhanced Acoustic Wave Biosensor Detection of Pseudomonas aeruginosa in Food | P. aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa PAO1 | Whole cell | Developed a biosensor for detecting P. aeruginosa in whole milk samples using an aptamer functionalized antifouling linking molecule 3-(2-mercaptoethanoxy)propanoic acid (HS-MEG-COOH), and another one with the addition of AuNPs. | Exhibited a linear range 10(2)-10(5) CFU/mL and limit of detection (LOD) of 86 CFU/mL in PBS and 157 CFU/mL in milk, and with AuNPs, reducing the extrapolated LOD to 68 CFU/mL in PBS and 46 CFU/mL in milk. | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1927 | 39406088 | 2025 | Laser-induced graphene-based aptasensor for the selective detection of Escherichia coli in urine samples | P12-55 | CATACGATTTAGGTGACACTATAGCCGGAGGGGGGTGAGGTCTGCGGCAGGCTGTGTGGGTGGAATTTCTCCTACTGGGATAGGTGGA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Developed an impedance biosensor using a Laser-Induced Graphene-based (LIG) electrode for the detection of E. coli in urine samples. | The aptasensor showed a linear response to E. coli over the range 10(0)-10(3) CFU/mL and LOD of 9 CFU/mL in PBS. | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1928 | 40916637 | 2025 | Study of Bacteriostasis of Kaempferide on Foodborne Pathogenic Bacteria by Indirect Determination of Capillary Electrophoresis | AP1 | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed an aptamer-based capillary sieving electrophoresis (CE)-Laser-induced fluorescence (LIF) detection of three bacteria, Vibrio parahaemolyticus, Escherichia coli, and Staphylococcus aureus. | The measured limit of detection (LOD) for V. parahaemolyticus was 3.70 × 10(6) CFU/mL and a linear range of 0.80-124 × 10(7) CFU/mL. | N/A | N/A | N/A | Detection | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1929 | 40916637 | 2025 | Study of Bacteriostasis of Kaempferide on Foodborne Pathogenic Bacteria by Indirect Determination of Capillary Electrophoresis | AP2 | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Developed an aptamer-based capillary sieving electrophoresis (CE)-Laser-induced fluorescence (LIF) detection of three bacteria, Vibrio parahaemolyticus, Escherichia coli, and Staphylococcus aureus. | The measured limit of detection (LOD) for E. coli was 1.28 × 10(7) CFU/mL and a linear range of 6.50 - 153 × 10(7) CFU/mL. | N/A | N/A | N/A | Detection | N/A | Extension chain for AP2 (T2) , 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1930 | 40916637 | 2025 | Study of Bacteriostasis of Kaempferide on Foodborne Pathogenic Bacteria by Indirect Determination of Capillary Electrophoresis | AP3 | TCCCTACGGCGCTAACCTCCCAACCGCTCCACCCTGCCTCCGCCTCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 6538) | Whole cell | Developed an aptamer-based capillary sieving electrophoresis (CE)-Laser-induced fluorescence (LIF) detection of three bacteria, Vibrio parahaemolyticus, Escherichia coli, and Staphylococcus aureus. | The measured limit of detection (LOD) for S. aureus was 1.67 × 10(7) CFU/mL and a linear range of 3.00-150 × 10(7) CFU/mL. | N/A | N/A | N/A | Detection | N/A | Extension chain for AP3 (T3), 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1931 | 39961826 | 2025 | Self-protective DNAzyme-based dual-responsive three-way Y-probe for simultaneous determination of multiple pathogenic bacteria | APT(S) | CTCCTCTGACTGTAACCACGGTGGTTTGATCACTATTGGGCCTTTGTGATGTCGGTAGT | 59 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (KCTC 1925) | Whole cell | Developed a DNAzyme-based self-protecting dual-response three-way Y nanoprobe (SD-DTY) for the simultaneous detection of two foodborne pathogens. | The limit of detection was 3.2 cfu/mL, and the linear range was 10-10(5) cfu/mL, with a 2-hour response time. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1932 | 39961826 | 2025 | Self-protective DNAzyme-based dual-responsive three-way Y-probe for simultaneous determination of multiple pathogenic bacteria | APT(E) | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACACCTACCCATCGGA | 54 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (KCTC 2571) | Whole cell | Developed a DNAzyme-based self-protecting dual-response three-way Y nanoprobe (SD-DTY) for the simultaneous detection of two foodborne pathogens. | The limit of detection was 3.7 cfu/mL, and the linear range was 10-10(5) cfu/mL, with a 2-hour response time. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1933 | https://doi.org/10.1016/j.snb.2024.136609 | 2025 | Ultrasensitive electrochemical biosensor for bacteria detection based on Fe3O4@COF-AuNPs and trigging isothermal circular amplification | Aptamer | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Developed an ultrasensitive electrochemical biosensor based on magnetic nanocomposite material Fe3O4@COF-AuNPs and triggering isothermal circular amplification (TICA) for E. coli detection. | The detection limit (LOD) was 10 CFU/mL, with a linear range of 10(2)−10(9) CFU/mL, and the detection time was 1 h. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | The sensor was stored at 4°C, and the signal value decreased by only 6.28 % over 30 days. | N/A | N/A | N/A |
| ABdb_1945 | 41344010 | 2026 | SERS-based Aptasensor using Au NSs@Ag NPs/magnetic graphene oxide assemblies for simultaneous detection of Escherichia coli and Staphylococcus aureus | Apt1 & Apt3 | ATCCGTCACACCTGCTCTACTGGCCGGCTCAGCATGACTAAGAAGGAAGTTATGTGGTGTTGGCTCCCGTATTTTTTTTTT | 81 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Developed a SERS aptasensor based on aptamer-magnetic graphene oxide (MGO) and dual-functional Au NSs@Ag NPs probes for simultaneous detection of E. coli and S. aureus. | The SERS intensity shows a good linear relationship over a range of 50 to 10(6) CFU/mL, with a detection limit of 16 CFU/mL for E. coli. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (for apt1 & apt2) and 5'-Amidation (NH₂) (for apt3 & apt4) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1946 | 41344010 | 2026 | SERS-based Aptasensor using Au NSs@Ag NPs/magnetic graphene oxide assemblies for simultaneous detection of Escherichia coli and Staphylococcus aureus | Apt2 & Apt4 | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAACTTTTTTTTT | 71 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed a SERS aptasensor based on aptamer-magnetic graphene oxide (MGO) and dual-functional Au NSs@Ag NPs probes for simultaneous detection of E. coli and S. aureus. | The SERS intensity shows a good linear relationship over a range of 50 to 10(6) CFU/mL, with a detection limit of 20 CFU/mL for S. aureus. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (for apt1 & apt2) and 5'-Amidation (NH₂) (for apt3 & apt4) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1950 | 41135162 | 2026 | Silver-decorated nanobeads for high-performance and flexible analysis of Shigella dysenteriae utilizing a paper-based aptasensor | Aptamer | ATAGGAGTCACGACGACCAGAACGGAACTAGCGTTTAAATGCCAGGACTGAAGTAGCAGGGATTAGTCAAGAGGTAGACGCACATA | 86 | N/A | ssDNA | Shigella Dysenteriae | Whole cell | Developed an Ag/MBs-modified paper-based aptasensor to detect S. dysenteriae. | MB-based assays achieve broad linearity (DPV = 10(2)–10(8) CFU/mL, EIS = 10(1)–10(9) CFU/mL) and high sensitivity (DPV = 90 CFU/mL, EIS = 8.09 CFU/mL). | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | Long stability of up to 28 days at 4°C. | N/A | N/A | N/A |
| ABdb_1958 | 20582587 | 2010 | Selection and characterization of DNA aptamers with binding selectivity to Campylobacter jejuni using whole-cell SELEX | ONS-23 | N/A | N/A | 5'-GTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Campylobacter Jejuni (A9a) | Whole cell (bind via proteinaceous nature for cell surface target) | Identify aptamers against C. jejuni and detect them in a mixed cell population. | ONS-23 showed high binding affinity (25–36%) for all other C. jejuni strains screened (inclusivity) and low apparent binding affinity (1–5%) with non-C. jejuni strains (exclusivity). | 10 | Flow Cytometry | 292.8 ± 53.1 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | WO Patent WO/2011/097420 |
| ABdb_1970 | 23381690 | 2013 | Selection of aptamers against inactive Vibrio alginolyticus and application in a qualitative detection assay | Pool of enriched aptamers | N/A | N/A | 5'-TCAGTCGCTTCGCCGTCTCCTTC-N35-GCACAAGAGGGAGACCCCAGAGGG-3' | ssDNA | Vibrio Alginolyticus | Whole cell (Inactivated) | Identify aptamers against and qualitatively detect inactive Vibrio alginolyticus using PCR. | V. alginolyticus could be detected at 100 cells/ml. | 15 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | 27.5 ± 9.2 nM | Detection | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_2009 | https://doi.org/10.1016/j.lwt.2013.12.012 | 2014 | Development and evaluation of aptamer magnetic capture assay in conjunction with real-time PCR for detection of Campylobacter jejuni | Aptamer 229 | N/A | N/A | N/A | ssDNA | Campylobacter Jejuni (A9a) | Whole cell | Develop an aptamer-based magnetic capture-qPCR (AMC-qPCR) assay for the detection of Campylobacter jejuni. | Capture efficiency was 10–13% at the detection limit of 1.1 log10/300 μl C. jejuni cells and a range of 1.0–2.0 log10 CFU per sample (0.3-10 ml). | N/A | N/A | N/A | Detection | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | WO Patent WO/2011/097420 |
| ABdb_2017 | 27151293 | 2016 | Identification of ssDNA aptamers specific to clinical isolates of Streptococcus mutans strains with different cariogenicity | H19 | N/A | N/A | 5'-GCAATGGTACGGTACTTCC-45N-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Streptococcus Mutans | Whole cell | Identify a high-affinity aptamer against cariogenic S. mutans strains. | Aptamer H19 showed strong binding, as indicated by higher fluorescence intensity, with Strains 12 and 17 compared with other strains. | 9 | Flow Cytometry | 69.45 ± 38.53 nM | Detection | Subtractive SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_2112 | 28728009 | 2017 | Bridged Rebar Graphene functionalized aptasensor for pathogenic E. coli O78:K80:H11 detection | Anti-E.coli aptamer | N/A | N/A | 5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3' | ssDNA | Escherichia Coli (E. Coli) O78:K80:H11 (MTCC 726) | Whole cell | A novel fabrication method of functionalised Bridged Rebar Graphene (BRG) onto EIS-based nanostructured aptasensor for label-free detection of E. coli O78:K80:H11. | LOD ~ 10(1) cfu/mL with a dynamic response range from 10(1) to 10(6) cfu/mL. | 12 | Bio-Layer Interferometry (BLI) | 14 nM | Biosensor | Phenylboronic acid (PBA) mediated SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_2117 | 28342148 | 2017 | Further characterization and independent validation of a DNA aptamer-quantum dot-based magnetic sandwich assay for Campylobacter | Aptamer | N/A | N/A | N/A | ssDNA | Campylobacter Jejuni (ATCC 29428) | Whole cell | Developed an aptamer-MB and aptamer-QD sandwich assay for the detection of C.jejuni. | Establishes a LOD between 5 and 10 C. jejuni cells/mL in sterile buffer (PBS) and chicken rinsate. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | U.S. Patent No. 9562900 |
| ABdb_2118 | 30382404 | 2018 | A bimodal (SERS and colorimetric) aptasensor for the detection of Pseudomonas aeruginosa | P. aeruginosa aptamer | N/A | N/A | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | The dual-mode aptasensor based on SERS and colorimetry assay for the determination of P. aeruginosa. | LOD of the aptasensor was 20 cfu/mL for SERS mode and 50 cfu·mL−1 for color mode with a linear range from 10^2 cfu/mL to 10^6 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_2120 | https://doi.org/10.1016/j.jelechem.2018.07.002 | 2018 | Target-induced aptamer displacement on gold nanoparticles and rolling circle amplification for ultrasensitive live Salmonella typhimurium electrochemical biosensing | S. typhimurium (STM)-binding aptamer. | N/A | N/A | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Develop an aptasensor for ultrasensitive detection of live S. typhimurium by combining target-induced aptamer displacement on gold nanoparticles (AuNPs) deposited electrode with rolling circle amplification (RCA). | Showed a LOD of 16 CFU/mL with a wide linear detection range of 20 to 2 × 10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | When the sensor was stored at 4°C for 10 days, the electrical signal response was 90% of that obtained at the time of preparation. | N/A | N/A | N/A |
| ABdb_2122 | 33367418 | 2021 | Photo-responsive functional gold nanocapsules for inactivation of community-acquired, highly virulent, multidrug-resistant MRSA | Aptamer | N/A | N/A | 5'-ATCCAGAGTGACGCAGCA-N40-TGGACACGGTGGCTTAGT-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) “superbug” (USA300) | Whole cell | Aptamers functionalization of Cur@mPEG-SH@GNRs for PTT and ROS. | Blocked biofilm formation and killed all of the trapped bacteria in 30 min during NIR stimulation. | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_2124 | 34399193 | 2021 | Aptamer-superparamagnetic nanoparticles capture coupling siderophore-Fe3+ scavenging actuated with carbon dots to confer an "off-on" mechanism for the ultrasensitive detection of Helicobacter pylori | Hp-1 | N/A | N/A | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Helicobacter Pylori (ATCC 700392) | Whole cell | Aptamer-modified superparamagnetic nanoparticles (SPMNPs) are used to develop a triple-module biosensor to capture H. pylori. | Exhibited a wide detection range of 10-10(7) CFU/mL and a limit of detection (LOD) as low as 1 CFU/mL. | 10 | Fluorescence Spectroscopy | 36.91 ± 11.1 nM | Biosensor | SELEX | 5'-FAM Labeled and 5'-Amidation (NH₂) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_2125 | 34399193 | 2021 | Aptamer-superparamagnetic nanoparticles capture coupling siderophore-Fe3+ scavenging actuated with carbon dots to confer an "off-on" mechanism for the ultrasensitive detection of Helicobacter pylori | Hp-2 | N/A | N/A | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Helicobacter Pylori (ATCC 700392) | Whole cell | Aptamer-modified superparamagnetic nanoparticles (SPMNPs) capture H. pylori. | N/A | 10 | Fluorescence Spectroscopy | 46.31 ± 11.31 nM | Biosensor | SELEX | 5'-FAM Labeled and 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2126 | 34399193 | 2021 | Aptamer-superparamagnetic nanoparticles capture coupling siderophore-Fe3+ scavenging actuated with carbon dots to confer an "off-on" mechanism for the ultrasensitive detection of Helicobacter pylori | Hp-3 | N/A | N/A | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Helicobacter Pylori (ATCC 700392) | Whole cell | Aptamer-modified superparamagnetic nanoparticles (SPMNPs) capture H. pylori. | N/A | 10 | Fluorescence Spectroscopy | 60.76 ± 11.69 nM | Biosensor | SELEX | 5'-FAM Labeled and 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2127 | 34399193 | 2021 | Aptamer-superparamagnetic nanoparticles capture coupling siderophore-Fe3+ scavenging actuated with carbon dots to confer an "off-on" mechanism for the ultrasensitive detection of Helicobacter pylori | Hp-4 | N/A | N/A | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Helicobacter Pylori (ATCC 700392) | Whole cell | Aptamer-modified superparamagnetic nanoparticles (SPMNPs) capture H. pylori. | N/A | 10 | Fluorescence Spectroscopy | 41.57 ± 16.18 nM | Biosensor | SELEX | 5'-FAM Labeled and 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2128 | 34399193 | 2021 | Aptamer-superparamagnetic nanoparticles capture coupling siderophore-Fe3+ scavenging actuated with carbon dots to confer an "off-on" mechanism for the ultrasensitive detection of Helicobacter pylori | Hp-5 | N/A | N/A | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Helicobacter Pylori (ATCC 700392) | Whole cell | Aptamer-modified superparamagnetic nanoparticles (SPMNPs) capture H. pylori. | N/A | 10 | Fluorescence Spectroscopy | 67.74 ± 10.24 nM | Biosensor | SELEX | 5'-FAM Labeled and 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2129 | 35765498 | 2022 | Single-stranded DNA aptamer-based rolling circle amplification as anti-chicken Salmonella bacteriostatic | Anti-Salmonella DNA aptamer | N/A | N/A | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) and Salmonella Enteritidis (S. Enteritidis) | Whole cell | Identify an aptamer targeting Salmonella in the form of RCA-p that could inhibit bacterial growth, multiplication, and viability. | Significant reduction in bacterial viability. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_2130 | 37773421 | 2023 | Sensitive detection of Escherichia coli in diverse foodstuffs by electrochemical aptasensor based on 2D porphyrin-based COF | Aptamer | N/A | N/A | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Developed an electrochemical aptasensor using two-dimensional porphyrin-based covalent organic framework (Tph-TDC-COF) for the detection of E.coli. | Demonstrated an extremely low detection limit of 0.17 CFU/mL for E.coli detection within a linear range of 10 to 1 × 10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | The aptasensor recovered to 104.3% after 15 days of storage at 4°C in 0.01 M phosphate buffer, indicating excellent stability. | N/A | N/A | N/A |
| ABdb_2131 | https://doi.org/10.1016/j.bioana.2024.05.004 | 2024 | Aptamer-carbon quantum dots and silver nanoparticles construct a FRET sensor for sensitive detection of E. coli | E. coli aptamer | N/A | N/A | N/A | ssDNA | Escherichia Coli (E. Coli) BL21 strain | Whole cell | Developed a FRET-based fluorescent biosensor by combining CQDs with Ag NPs for the rapid detection of E. coli (BL21). | The sensor has a linear range of 2×10(3) ∼ to 2×10(8) CFU/mL and a low detection limit of 77 CFU/mL for E. coli. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |