Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 1
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0954 | 29051620 | 2017 | Antimicrobial peptide-loaded gold nanoparticle-DNA aptamer conjugates as highly effective antibacterial therapeutics against Vibrio vulnificus | Apt(His) | GCTATGGGTGGTCTGGTTGGGATTGGCCCCGGGAGCTGGC | 40 | N/A | ssDNA | Vibrio Vulnificus (MO6-24/O) | V. vulnificus-infected HeLa cells | The AuNP-AptHis conjugate delivers the HPA3P(His) peptide into host cells, inducing bacterial cell death by disrupting membrane integrity. | Compared with that of buffer- or AuNP-AptHis-incubated cells, the number of viable V. vulnificus cells in the AuNP-AptHis-HPA3PHis-treated cells decreased by 90% in 10 min. All infected mice injected with AuNP-AptHis-HPA3PHis survived until 120 h. | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 3'-Thiolated (A10-Thiol) | HPA3PHis and AuNP-Apt(His)-HPA3P(His) did not exhibit cytotoxicity against HeLa cells and mouse erythrocytes up to 10 µM. | N/A | N/A | N/A | N/A |