AptBacterialDB

Target : Surface-associated Malate synthase

Total records found: 6

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_1214 317045872019Theranostic Application of a Novel G-Quadruplex-Forming DNA Aptamer Targeting Malate Synthase of Mycobacterium tuberculosisMS10-TruncGGTGGTGGTGG115'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3'ssDNAMycobacterium Tuberculosis (H37Rv)Surface-associated Malate synthase (MS -Whole cells)Identify aptamers that bind to and inhibit the MS enzyme activity, thereby blocking bacterial entry into host cells.Inhibited MS activity with an IC₅₀ of 251.1 nM; Ki of 230 nM; inhibited M. tb invasion into human THP-1 monocytic cells.10Surface Plasmon Resonance (SPR)1.9 × 10−11 MTherapeuticsSELEX5'-Biotinylated and 5'-FAM LabeledN/AN/ABest CandidateN/AIndian Patent application no. 201611021901
ABdb_1215 317045872019Theranostic Application of a Novel G-Quadruplex-Forming DNA Aptamer Targeting Malate Synthase of Mycobacterium tuberculosisMS4GGACCAGGTGAGTGGATGCGGGTGCGGGTGGGGGTGAGGGGGGG445'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3'ssDNAMycobacterium Tuberculosis (H37Rv)Surface-associated Malate synthase (MS -Whole cells)Identify aptamers that bind to and inhibit the MS enzyme activity, thereby blocking bacterial entry into host cells.Inhibition of MS activity, the aptamers were ranked as MS10 (IC50 of 275.6 nM, Ki of 270 nM) > MS5 > MS20 > MS4 > MS6.10Surface Plasmon Resonance (SPR)9.9 × 10−9 MTherapeuticsSELEX5'-Biotinylated and 5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1216 317045872019Theranostic Application of a Novel G-Quadruplex-Forming DNA Aptamer Targeting Malate Synthase of Mycobacterium tuberculosisMS5GCAGAGAGAGAGAAAGTGAGAAGGGCGGGGGGGAGAGGGTGGGG445'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3'ssDNAMycobacterium Tuberculosis (H37Rv)Surface-associated Malate synthase (MS -Whole cells)Identify aptamers that bind to and inhibit the MS enzyme activity, thereby blocking bacterial entry into host cells.Inhibition of MS activity, the aptamers were ranked as MS10 (IC50 of 275.6 nM, Ki of 270 nM) > MS5 > MS20 > MS4 > MS6.10Surface Plasmon Resonance (SPR)2.7 × 10−6 MTherapeuticsSELEX5'-Biotinylated and 5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1217 317045872019Theranostic Application of a Novel G-Quadruplex-Forming DNA Aptamer Targeting Malate Synthase of Mycobacterium tuberculosisMS6GGTGGGATGGGGGGGGGAGGGTAGGGTGTGCAAGTAGAGGGTC435'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3'ssDNAMycobacterium Tuberculosis (H37Rv)Surface-associated Malate synthase (MS -Whole cells)Identify aptamers that bind to and inhibit the MS enzyme activity, thereby blocking bacterial entry into host cells.Inhibition of MS activity, the aptamers were ranked as MS10 (IC50 of 275.6 nM, Ki of 270 nM) > MS5 > MS20 > MS4 > MS6.10Surface Plasmon Resonance (SPR)2.8 × 10−10 MTherapeuticsSELEX5'-Biotinylated and 5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1218 317045872019Theranostic Application of a Novel G-Quadruplex-Forming DNA Aptamer Targeting Malate Synthase of Mycobacterium tuberculosisMS10GGTGTGTTGACTGAGGGGGTGGGGTGGGTGGTGGTGGATATAGC445'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3'ssDNAMycobacterium Tuberculosis (H37Rv)Surface-associated Malate synthase (MS -Whole cells)Identify aptamers that bind to and inhibit the MS enzyme activity, thereby blocking bacterial entry into host cells.Inhibition of MS activity, the aptamers were ranked as MS10 (IC50 of 275.6 nM, Ki of 270 nM) > MS5 > MS20 > MS4 > MS6.10Surface Plasmon Resonance (SPR)1.2 × 10−8 MTherapeuticsSELEX5'-Biotinylated and 5'-FAM LabeledN/AN/ABest CandidateN/AN/A
ABdb_1219 317045872019Theranostic Application of a Novel G-Quadruplex-Forming DNA Aptamer Targeting Malate Synthase of Mycobacterium tuberculosisMS20GGGTTGTAAGAGGGAGCTGGGAGGGGTCGGGGGGGGGGGTGGC435'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3'ssDNAMycobacterium Tuberculosis (H37Rv)Surface-associated Malate synthase (MS -Whole cells)Identify aptamers that bind to and inhibit the MS enzyme activity, thereby blocking bacterial entry into host cells.Inhibition of MS activity, the aptamers were ranked as MS10 (IC50 of 275.6 nM, Ki of 270 nM) > MS5 > MS20 > MS4 > MS6.10Surface Plasmon Resonance (SPR)9.1 × 10−7 MTherapeuticsSELEX5'-Biotinylated and 5'-FAM LabeledN/AN/AN/AN/AN/A