Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 36
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0552 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmA12 | UGUAAUUCUGCCAUUCUUUUUGGGGCGGAAUACAGGAUGU | 40 | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | fmA12-functionalized AgNPs resulted in specific S. aureus antimicrobial activity with only a 1.6 ± 1.0% survival of 12598 cells and 51.9 ± 2.0% survival of 10832 cells. | 8 | Surface Plasmon Resonance (SPR) and Bio-Layer Interferometry (BLI) | 95 nM (by SPR) and 67.1 ± 6.1 nM (by BLI) | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | 76% fmA12 survives in 10% mouse serum at 37°C over 24 h, and in 50% serum, 85.0% fmA12 survives after 5 h. | N/A | ~52 h for fmA12. | N/A |
| ABdb_0553 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmF07 | AUACGCUGCUCACUAAAGUCGGGAGUACUCCAAUGUUUUC | 40 | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | N/A | 8 | Bio-Layer Interferometry (BLI) | 38.9 ± 4.1 nM (by BLI) | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0554 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmE09 | AUCUAGCAAGCACUUGCAAACAUUCGAUAACGGGGAUUC | 39 | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | N/A | 8 | Bio-Layer Interferometry (BLI) | 418 ± 112 nM (by BLI) | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0555 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmG12 | UGCCAAUGUAACUCAACACUCUUCAUUGAGCUGUCGGGCA | 40 | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | N/A | 8 | Surface Plasmon Resonance (SPR) and Bio-Layer Interferometry (BLI) | 475 nM (by SPR) and 220 ± 24 nM (by BLI) | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0556 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmA12Δ3 | N/A | N/A | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | N/A | 8 | Bio-Layer Interferometry (BLI) | 69.7 ± 3.5 nM | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0557 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmA12Δ6 | N/A | N/A | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | N/A | 8 | Bio-Layer Interferometry (BLI) | 63.1 ± 7.3 μM | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0558 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmA12Δ9 | N/A | N/A | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | N/A | 8 | Bio-Layer Interferometry (BLI) | 69.1 ± 16.7 nM | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0574 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#2/8 | ATACCAGCTTATTCAATT-AGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCT-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | PA#2/8 competes with IgG or IgG-Fc for binding to Protein A. | 11 | Bead-based Binding Assay | 1.06 ±0.2 μM | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0575 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#4/22 | ATACCAGCTTATTCAATT-GCAGTACTGATGAGTGTAGCCGTATGATTATCGTTTGTGG-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0576 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#4/34 | ATACCAGCTTATTCAATT-CCCCAACGAGTCGATATGTAGCCCACACTCTGATTCGTCC-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0577 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#2/11 | ATACCAGCTTATTCAATT-GGAGACGACAAACTATTACGTACTACGGCATGCACTTGGT-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0578 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#2/3 | ATACCAGCTTATTCAATT-CGACAAGTGGGCATTACGATTCTAGCCCTGATTATGTTCC-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0579 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#2/6 | ATACCAGCTTATTCAATT-ACCGATCACTAGCCGACTAATTGGTTTCCGATCGCAGTCC-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0580 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#14/82 | ATACCAGCTTATTCAATT-CCACAACCGAACTCGTAAGACGTATGTAGCCGCCAACTGT-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0581 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#6/52 | ATACCAGCTTATTCAATT-ACGCATTGGAGCCCGAAACTGATTCATTGAGCCTACCTGT-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0582 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#2/14 | ATACCAGCTTATTCAATT-ACGACCGTAGACGACTTACACTGATGTTGCGCATTTCTGT-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0583 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#4/31 | ATACCAGCTTATTCAATT-CGATGACGACTGTAGCCGCAATACGCCCCTGTTACGTTGT-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0584 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#6/41 | ATACCAGCTTATTCAATT-GGACGCCGACTAACTTTACGTGGTTCTCCTACCGCCTAACC-ACAATCGTAATCAGTTAG | 77 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0585 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#6/43 | ATACCAGCTTATTCAATT-ACGAAATGTAGCCGATCCTGATTACTCTCTGTCAGCTTGG-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0784 | 27650576 | 2016 | G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA | PA#2/8 | ATACCAGCTTATTCAATT-AGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCT-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838, P6031) | Staphylococcus aureus Protein A (SpA) | Develop ELONA to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. | PA#2/8 and its truncated variant PA#2/8[S1-58] were able to differentiate between the highly Protein A-producing S. aureus Cowan strain. | N/A | Enzyme-Linked Oligonucleotide Assay (ELONA) | 101.4 ± 5.9 nM (of 3′-biotinylated) and 189.9 ± 13.0 nM (of 5′-biotinylated) | Detection | N/A | 5'-and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0785 | 27650576 | 2016 | G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA | PA#2/8[S1-58] | ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCT | 58 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838, P6031) | Staphylococcus aureus Protein A (SpA) | Develop ELONA to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. | PA#2/8 and its truncated variant PA#2/8[S1-58] were able to differentiate between the highly Protein A-producing S. aureus Cowan strain. | N/A | Enzyme-Linked Oligonucleotide Assay (ELONA) | 11.3 ± 1.4 nM (of 3′-biotinylated) and 23.7 ± 2.0 nM (of 5′-biotinylated) | Detection | N/A | 5'-and 3'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0786 | 27650576 | 2016 | G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA | PA#2/8[S1-50] | ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTC | 50 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838, P6031) | Staphylococcus aureus Protein A (SpA) | Develop ELONA to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. | N/A | N/A | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Detection | N/A | 5'-and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0787 | 27650576 | 2016 | G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA | PA#2/8[S1-43] | ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGG | 43 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838, P6031) | Staphylococcus aureus Protein A (SpA) | Develop ELONA to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. | N/A | N/A | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Detection | N/A | 5'-and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0788 | 27650576 | 2016 | G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA | PA#2/8[S28-50] | AGGGGGATAGAGGGGGTGGGTTC | 23 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838, P6031) | Staphylococcus aureus Protein A (SpA) | Develop ELONA to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. | N/A | N/A | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Detection | N/A | 5'-and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0953 | 29160851 | 2017 | Development of An Impedimetric Aptasensor for the Detection of Staphylococcus aureus | PA#2/8[S1-58] | ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCT | 58 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (DSM 20231) | Staphylococcus aureus Protein A (SpA) | Developed an impedimetric aptasensor for the detection of S. aureus. | Showed a limit of detection of 10 CFU/mL within 10 minutes. | N/A | Electrochemical impedance spectroscopy (EIS) | 18.5 ± 1.8 | Biosensor | N/A | 3'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1381 | 32289369 | 2020 | Accurate MRSA identification through dual-functional aptamer and CRISPR-Cas12a assisted rolling circle amplification | Apt A | ATATACACCCCACCTCGCTCCCGTGACACTAATGCTATTTTTT | 43 | N/A | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) (ATCC 17802) | Staphylococcus aureus Protein A (SpA) | Dual-functional technology based on aptamer and CRISPR-Cas12a-assisted RCA for detection of MRSA. | Fluorescence intensity shows a linear correlation with the logarithm of MRSA concentration, ranging from 10(6) to 10(2) CFU/mL, spanning six orders of magnitude. | N/A | N/A | N/A | Detection | N/A | 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1590 | 33894956 | 2021 | A universal SERS-label immunoassay for pathogen bacteria detection based on Fe3O4@Au-aptamer separation and antibody-protein A orientation recognition | E. coli-aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 35150) | Staphylococcus aureus Protein A (SpA) | Developed a SERS aptasensor using aptamer-conjugated Fe3O4@Au magnetic nanoparticles (MNPs) and PA modified-SERS tags (Au@DTNB@PA) for the detection of bacteria. | The limit of detection (LOD) was 10 cells/mL for E. coli. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1591 | 33894956 | 2021 | A universal SERS-label immunoassay for pathogen bacteria detection based on Fe3O4@Au-aptamer separation and antibody-protein A orientation recognition | L. mono-aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Listeria Monocytogenes | Staphylococcus aureus Protein A (SpA) | Developed a SERS aptasensor using aptamer-conjugated Fe3O4@Au magnetic nanoparticles (MNPs) and PA modified-SERS tags (Au@DTNB@PA) for the detection of bacteria. | The limit of detection (LOD) was 10 cells/mL for L. mono. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1592 | 33894956 | 2021 | A universal SERS-label immunoassay for pathogen bacteria detection based on Fe3O4@Au-aptamer separation and antibody-protein A orientation recognition | S. typhi-aptamer | ATAGGAGTCACGACGACCAGAAAGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGATATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Staphylococcus aureus Protein A (SpA) | Developed a SERS aptasensor using aptamer-conjugated Fe3O4@Au magnetic nanoparticles (MNPs) and PA modified-SERS tags (Au@DTNB@PA) for the detection of bacteria. | The limit of detection (LOD) for S. typhi was 25 cells/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1639 | https:doi.org10.1016j.arabjc.2022.104274 | 2022 | Application of G-quadruplex aptamer conjugated MSNs to deliver ampicillin for suppressing S. aureus biofilm on mice bone | PA76 | 3’-ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCTACAATCGTAATCAGTTAG-5’ | 76 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | MSNs-APT-AMP nanosystem for antibiofilm activity against S. aureus biofilm. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1640 | https:doi.org10.1016j.arabjc.2022.104274 | 2022 | Application of G-quadruplex aptamer conjugated MSNs to deliver ampicillin for suppressing S. aureus biofilm on mice bone | PA63 | 3’-ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCTACAAT-5’ | 63 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | MSNs-APT-AMP nanosystem for antibiofilm activity against S. aureus biofilm. | No significant biofilm on the surface of the bone after 48 h treatment with 100 µg/mL of the three-component system. | N/A | N/A | N/A | Therapeutics | N/A | N/A | No significant toxicity at 100 µg/mL for MCF-7 cells in 48 h. | N/A | Best Candidate | N/A | N/A |
| ABdb_1641 | https:doi.org10.1016j.snb.2022.132752 | 2022 | Novel nanozyme-catalyzed and magnetically assisted colorimetric biosensor for Staphylococcus aureus detection with a low matrix effect from complex environments | SA31 | GCAATGGTACGGTACTTCCTCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGACAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Staphylococcus aureus Protein A (SpA) | Vancomycin-modified magnetic nanoparticles (Fe3O4 @Au-Van MNPs) combined with an aptamer were prepared for S. aureus detection. | The biosensor can distinguish more than 100 CFU/mL of pathogens by the naked eye and LOD of 2 CFU/mL for S. aureus. | N/A | N/A | N/A | Biosensor | N/A | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1841 | 39727901 | 2024 | Competitive Electrochemical Apta-Assay Based on cDNA-Ferrocene and MXenes for Staphylococcus aureus Surface Protein A Detection | APT | ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCT | 58 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Staphylococcus aureus Protein A (SpA) | Developed a competitive aptasensor based on a ferrocene (Fc)-labeled cDNA hybridized (cDNA-Fc S13) on a specific aptamer (APT) for PrA in the presence of MXene nanosheets for the indirect detection of S. aureus. | Displayed a linear range of 10–125 nM, an LOD of 3.33 nM, and a response time under 40 min. | N/A | N/A | N/A | Biosensor | N/A | 3'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1849 | https://doi.org/10.1016/j.biosx.2023.100436 | 2024 | DNA origami-enhanced binding of aptamers to Staphylococcus aureus cells | PA#2/8 [1–58] | ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCT | 58 | N/A | ssDNA | Staphylococcus aureus (S. aureus) SA5 | Staphylococcus aureus Protein A (SpA) | Developed a DNA origami-based biosensor for the detection of SA. | Five-times higher affinity of the aptamer-functionalized DNA origami compared to pure aptamers. | N/A | Enzyme-Linked Oligonucleotide Assay (ELONA) | 160 ± 9 nM | Biosensor | N/A | 5'-PolyA (21A) or PolyT (21 T) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1988 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4520–8 | PCGGCPPCGGGPACCPAPPAPCGGPPPAGCCCAGPCAGAA | 40 | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Staphylococcus aureus Protein A (SpA) | Developed slow off-rate modified aptamer (SOMAmer) reagents against S. aureus cell surface-associated proteins, used to capture and detect S. aureus. | Efficient capture of Staph. aureus over a wide range of cell densities from 5 × 10(2) CFU/ml to 5 × 10(9) CFU/ml. | 8 | Radiolabel Filter Binding Assay | 0·22 nM | Detection | SELEX | P=NapdU (5-naphthylmethyl-aminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1990 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4531–56 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Staphylococcus aureus Protein A (SpA) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | Able to bind whole cells of all Staph. aureus strains tested, with a detection limit of approx. 10(4) cells per well (10(5)-10(6) cells/ml). | 8 | Radiolabel Filter Binding Assay | 0·03 nM | Detection | SELEX | TrpdU (5-tryptaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |