AptBacterialDB

Target : Peptidoglycan

Total records found: 6

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_0356 251855032014Selection of peptidoglycan-specific aptamers for bacterial cells identificationAntibac1TCGCGCGAGTCGTCTG-GGGACAGGGAGTGCGCTGCTCCCC-CCGCATCGTCCTCCC555'-TCGCGCGAGTCGTCTG-N24-CCGCATCGTCCTCCC-3'ssDNAStaphylococcus aureus (S. aureus) (ATCC 25923) and Escherichia Coli (E. Coli) TOP10PeptidoglycanIdentify aptamers that bind to the peptidoglycan of bacterial cells.High binding affinity for S. aureus, as the radioactivity of Antibac1 was 28 times higher than the negative control.5Saturation Binding Assay0.415 + 0.047 μMDetectionSELEX5'-Radiolabelled (32P-labeled)N/AN/AN/AN/AN/A
ABdb_0357 251855032014Selection of peptidoglycan-specific aptamers for bacterial cells identificationAntibac2TCGCGCGAGTCGTCTG-GGGGACTAGAGGACTTGTGCGGCC-CCGCATCGTCCTCCC555'-TCGCGCGAGTCGTCTG-N24-CCGCATCGTCCTCCC-3'ssDNAStaphylococcus aureus (S. aureus) (ATCC 25923) and Escherichia Coli (E. Coli) TOP10PeptidoglycanIdentify aptamers that bind to the peptidoglycan of bacterial cells.High binding affinity for S. aureus, as the radioactivity of Antibac2 was 22 times higher than the negative control.5Saturation Binding Assay1.261 + 0.280 μMDetectionSELEX5'-Radiolabelled (32P-labeled)N/AN/AN/AN/AN/A
ABdb_0918 281195142017High Efficiency Binding Aptamers for a Wide Range of Bacterial Sepsis AgentsAntibac1TCGCGCGAGTCGTCTG-GGGACAGGGAGTGCGCTGCTCCCC-CCGCATCGTCCTCCC55N/AssDNAEscherichia Coli (E. Coli) (ATCC 25922), Klebsiella Pneumoniae (ATCC 27853), Proteus Mirabilis (ATCC 00557), Pseudomonas Aeruginosa (ATCC 700603), Staphylococcus aureus (S. aureus) (ATCC 29213), Streptococcus Pneumoniae (ATCC 23855), and Enterococcus Faecium (ATCC 29212), and Proteus Vulgaris, Morganella Morganii, Citrobacter Freundii, and Acinetobacter BaumanniiPeptidoglycanDevelop generic probes as biological recognition elements in biosensors for sepsis diagnosis in the clinical setting.Antibac1 bound with higher efficiency to both gram-positive (S. aureus, S. penumoniae, L. monocytogenes) and gram-negative (A. baumannii, C. freudii, K. pneumoniae, P. aeruginosa, P. mirabilis).N/AReal-Time Quantitative Polymerase Chain Reaction (RT-qPCR)268.50 ± 54.34 nM (for A. baumannii); 51.74 ± 11.75 nM (for L. monocytogenes); 31.82 ± 4.38 nM (for E.coli); 170.10 ± 32.13 nM (for S.aureus) and 256.10 ± 47.89 nM (for K. pneumoniae)DiagnosticN/AN/AN/AN/AN/AN/AN/A
ABdb_0919 281195142017High Efficiency Binding Aptamers for a Wide Range of Bacterial Sepsis AgentsAntibac2TCGCGCGAGTCGTCTG-GGGGACTAGAGGACTTGTGCGGCC-CCGCATCGTCCTCCC55N/AssDNAEscherichia Coli (E. Coli) (ATCC 25922), Klebsiella Pneumoniae (ATCC 27853), Proteus Mirabilis (ATCC 00557), Pseudomonas Aeruginosa (ATCC 700603), Staphylococcus aureus (S. aureus) (ATCC 29213), Streptococcus Pneumoniae (ATCC 23855), and Enterococcus Faecium (ATCC 29212), and Proteus Vulgaris, Morganella Morganii, Citrobacter Freundii, and Acinetobacter BaumanniiPeptidoglycanDevelop generic probes as biological recognition elements in biosensors for sepsis diagnosis in the clinical setting.Antibac2 bound with higher efficiency to the gram-positive species S. aureus and E. faecium and to the gram-negative species (A. baumannii, C. freudii, K. pneumoniae, M. moraganii, P. aeruginosa, P. mirabilis, and E. coli).N/AReal-Time Quantitative Polymerase Chain Reaction (RT-qPCR)71.92 ± 9.74 nM (for A. baumannii); 54.19 ± 12.09 nM (for L. monocytogenes); 62.43 ± 11.97 nM (for E.coli); 194.90 ± 38.55 nM (for S.aureus) and 195.90 ± 42.91 nM (for K. pneumoniae)DiagnosticN/AN/AN/AN/AN/AN/AN/A
ABdb_0975 287158742017Detection of bacterial infection by a technetium-99m-labeled peptidoglycan aptamerAntibac1TCGCGCGAGTCGTCTGGGGACAGGGAGTGCGCTGCTCCCCCCGCACGTCCTCCC54N/AssDNAStaphylococcus aureus (S. aureus) (ATCC 25923)PeptidoglycanRadiolabeled aptamers were evaluated for biodistribution studies and scintigraphic imaging in infection‐bearing mice.Achieved a high target-to-non-target (T/NT) ratio of 4.7 ± 0.9 at 1.5 h and 4.6 ± 0.1 at 3.0 h in bacterial-infected models.N/ABinding Assay0.170 ± 0.032 μMImagingN/A5'-Inverted Thymidine (5'-idT), 3'-Amidation (NH₂-(CH2)6) and 5'-Radiolabelled (99mTc labeled)N/ARadiolabeling yields were superior to 90% and 99mTc‐Antibac1 was highly stable in the presence of saline, plasma, and cysteine up to 6 h.N/ADistribution half-life: 6.7 min and Elimination half-life: 41.3 min.N/A
ABdb_1798 371870622023A universal bacterial sensor created by integrating a light modulating aptamer complex with photoelectrochemical signal readoutPeptidoglycan aptamerGCAGTTGCGGGACAGGGAGTGCGCTGCTCCCC32N/AssDNAEscherichia Coli (E. Coli)PeptidoglycanDeveloped a signal-on photoelectrochemical biosensor for detecting peptidoglycan.Demonstrate a limit-of-detection of 82 pg/mL (13 pM) in buffer and 239 pg/mL (37 pM) in urine for peptidoglycan and 1913 CFU/mL for Escherichia coli in urine.N/AN/A0.415 ± 0.047 μMBiosensorN/AN/AN/AN/AN/AN/AN/A