AptBacterialDB

Target : Penicillin binding protein 2a (PBP2a)

Total records found: 5

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_1070 302437662018Aptamer-based fluorometric assay for direct identification of methicillin-resistant Staphylococcus aureus from clinical samplesM23CCATCCACACTCCGCAAGGGTGCCCCGGGGGGCTGTTCAGCGTGGTGGTGGGATGCCGTTTTGGTCCTTAGTCTCCGTCGTCGGCTGCCTCTACAT96N/AssDNAMethicillin-resistant Staphylococcus aureus strain N315 (MRSA)Penicillin binding protein 2a (PBP2a)Aptamer-based fluorometric assay for detection of MRSA in clinical samples coupled with immunomagnetic separation.Exhibited a detection limit of 2.63 × 10(3) and 1.38 × 10(3) CFU/mL in PBS and spiked nasal swab, respectively, within 2 h.N/AN/A21.9  nMBiosensorN/A5'-FITC LabeledN/AN/AN/AN/AN/A
ABdb_1382 322893692020Accurate MRSA identification through dual-functional aptamer and CRISPR-Cas12a assisted rolling circle amplificationApt BCACCCCACCTCGCTCCCGTGACACTAATGCTATTTTTT38N/AssDNAMethicillin-resistant Staphylococcus aureus (MRSA) (ATCC 17802)Penicillin binding protein 2a (PBP2a)Dual-functional technology based on aptamer and CRISPR-Cas12a-assisted RCA for detection of MRSA.Fluorescence intensity shows a linear correlation with the logarithm of MRSA concentration, ranging from 10(6) to 10(2) CFU/mL, spanning six orders of magnitude.N/AN/AN/ADetectionN/A3'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_1612 356162772022Targeted inhibition of methicillin-resistant Staphylococcus aureus biofilm formation by a graphene oxide-loaded aptamer/berberine bifunctional complexAptamer 1GGGAGCTCAGAATAAACGCTCAATACTATCGCGGAGACAGCGCGGGAGGCACCGGGGAGATCCGGGCCTCATGTCGAA785'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3'ssDNAMethicillin-resistant Staphylococcus aureus (MRSA)Penicillin binding protein 2a (PBP2a)Identify a PBP2a-targeted aptamer in conjunction with GO for the delivery of berberine to treat chronic infections caused by MRSA biofilms.The linear range was 10^3–10^7 CFU/mL, and the detection limit for the fluorescent assay was 800 CFU/mL. The inhibition rate peaked at 92.8% after treatment with the GO-berberine/aptamer 1 (containing 200 nM aptamer 1) complex.14Fluorescence Spectroscopy82.97 ± 8.86 nMDiagnostic/TherapeuticsSELEXFAM LabeledN/AN/ABest CandidateN/AN/A
ABdb_1613 356162772022Targeted inhibition of methicillin-resistant Staphylococcus aureus biofilm formation by a graphene oxide-loaded aptamer/berberine bifunctional complexAptamer 2GGGAGCTCAGAATAAACGCTCAAGGCACACAGGACTATACAGTGTTGCAGTGTTGCTGGATCCGGGCCTCATGTCGAA785'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3'ssDNAMethicillin-resistant Staphylococcus aureus (MRSA)Penicillin binding protein 2a (PBP2a)Identify a PBP2a-targeted aptamer in conjunction with GO for the delivery of berberine to treat chronic infections caused by MRSA biofilms.N/A14Fluorescence Spectroscopy152.92 ± 29.26 nMDiagnostic/TherapeuticsSELEXFAM LabeledN/AN/AN/AN/AN/A
ABdb_2123 333955712021Aptasensor for the detection of Methicillin resistant Staphylococcus aureus on contaminated surfacesAT0033N/AN/AN/AssDNAMethicillin-resistant Staphylococcus aureus (MRSA) (ATCC 25923)Penicillin binding protein 2a (PBP2a)Developed a colorimetric aptasensor for the detection of MRSA on contaminated surfaces.The visual detection limit was less than 100 CFU/ml and, theoretically, 2 CFU/ml, while the linear range of quantitation was 10(2)–10(5) CFU/ml.N/AN/AN/ABiosensorN/AN/AN/AN/AN/AN/AN/A