Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 1
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0085 | 21381755 | 2011 | Aptamer-mediated inhibition of Mycobacterium tuberculosis polyphosphate kinase 2 | PPK2 G9 | CCGTAATACGACTCACTATAGGGGAGCTCGGTACCGAATTC-AACACATAGGTTTGGTTAGGTTGGTTGGTTGAATTA-AAGCTTTGCAGAGAGGATCCTT | 99 | 5'-CCGTAATACGACTCACTATAGGGGAGCTCGGTACCGAATTC-N35-AAGCTTTGCAGAGAGGATCCTT-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | PPK2 Enzyme | Identify aptamers that bind to and inhibit the catalytic activities of enzyme PPK2. | Inhibited PPK2 protein with an IC50 of 39.3 ± 10 nM and inhibited the NDK activities of both the LHK and VC PPK2 proteins with IC50 values of >1 μM and 105 ± 5 nM, respectively. | 20 | Isothermal Titration Calorimetry (ITC) | 870 ± 220 nM | Therapeutics | SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |