Target : Outer membrane protein BamA (β-barrel assembly machinery A)

Total records found: 2

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_1769	37164985	2023	Selecting antibacterial aptamers against the BamA protein in Pseudomonas aeruginosa by incorporating genetic algorithm to optimise computational screening method	Apt31	ACCATCTGTGTAAGGGGTAAGGGGTGGGGGTGGGTACGTCT	41	N/A	ssDNA	Pseudomonas Aeruginosa	Outer membrane protein BamA (β-barrel assembly machinery A)	Selecting antibacterial aptamers against the BamA protein in Pseudomonas aeruginosa by incorporating a genetic algorithm to optimise the computational screening method.	Treatment of P. aeruginosa with 10 µM Apt31 for 2 h resulted in a significant reduction in CFU/mL and growth percentage.	N/A	N/A	N/A	Therapeutics	In-silico Method	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1884	40451960	2025	Screening and characterization of nucleic acid aptamers targeting Brucella surface antigens: identification and analysis of their corresponding binding sites	WS-6	GCTGCAATACTCATGGACAGCACGGCACGGGCTGTCGATCTCGAGGGAAACGGCACATGTGTCTGGAGTACGACCCTGAA	80	N/A	ssDNA	Brucella S2 vaccine strain	Outer membrane protein BamA (β-barrel assembly machinery A)	Identify aptamers against Brucella and conjugate them to liposomes for selective recognition and significantly reduced bacterial invasion of host cells.	WS-6 significantly reduced Brucella invasion, as evidenced by a decrease in qPCR Ct from 22.34 to 20.64 (P < 0.05), confirming a reduced intracellular bacterial load.	13	Indirect Enzyme-Linked Aptamer Assay (i-ELAA)	16.23 ± 5.84 nM	Therapeutics	Whole Cell-SELEX	5'-Biotinylated and 5'-FAM Labeled	N/A	The aptamer demonstrated stable binding to the Brucella S2 vaccine across a temperature range of 16–50°C, with optimal binding observed between 16°C and 50°C and under neutral conditions (pH 7.6) in 2h.	Best Candidate	N/A	N/A