Target : OmpC protein

Total records found: 2

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_0273	23676911	2013	In vitro selection of RNA aptamer specific to Salmonella typhimurium	Clone I-2	GGGAGAGCGGAAGCGUGCUGGG-UAGUGUGAGAGCCGUGAGUGAAAGGCCGCGACAAAGAUCGGA-CAUAACCCAGAGGUCGAUGGUCCCC	89	5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3'	ssRNA	Salmonella Typhimurium (S. Typhimurium) (ATCC 15277)	OmpC protein	Identify an RNase-resistant RNA aptamer that binds to the OmpC protein of S. Typhimurium.	Bound only to Sal.Typhimurium, but not to S. aureus, E. coli O157:H7 and to that does not express the OmpC protein.	5	Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)	20.27 ± 4.372 nM	Detection	SELEX	2'-Fluoro pyrimidines (2'-F-RNA) and 5'-Biotinylated	N/A	N/A	Best Candidate	N/A	N/A
ABdb_0274	23676911	2013	In vitro selection of RNA aptamer specific to Salmonella typhimurium	Clone I-2 Truncated 43-mer	GUGAGAGCCGUGAGUGAAAGGCCGCGACAAAGAUCGGAC	39	5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3'	ssRNA	Salmonella Typhimurium (S. Typhimurium) (ATCC 15277)	OmpC protein	Identify an RNase-resistant RNA aptamer that binds to the OmpC protein of S. Typhimurium.	Bound only to Sal.Typhimurium, but not to S. aureus, E. coli O157:H7 and to that does not express the OmpC protein.	5	Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)	27.64 ± 4.784 nM	Detection	SELEX	2'-Fluoro pyrimidines (2'-F-RNA) and 5'-Biotinylated	N/A	N/A	Best Candidate	N/A	N/A