Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 1
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0819 | 27209574 | 2016 | A paper based graphene-nanocauliflower hybrid composite for point of care biosensing | RNA Aptamer | GGGUCUUCCUGGACUGUCGAAAAUUCAGUAUCGGGAGGUUACGUAUUUGGUUUAUAGAUAGUAA | 64 | N/A | ssRNA | Escherichia Coli (E. Coli) O157:H7(ATCC 43895) | O-antigen | Develop electrochemical biosensing platform using graphene paper functionalized with fractal platinum nanocauliflower for detection of E. coli O157:H7. | Detection limit (LOD) of ~4 CFU/mL with linear range of 4 to 10(5) CFU/mL and a response time of 12 min. | N/A | N/A | 110 nM | Biosensor | N/A | 3'-Thiolated | N/A | N/A | N/A | N/A | N/A |