Target : Mycoplasma hyorhinis-infected cells

Total records found: 3

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_1441 324711282020Aptamer Cocktail to Detect Multiple Species of Mycoplasma in Cell CultureA15-1GTGGGGTTGAAAACGCCGGAGAGGGTGTGTGGGTGGGGTA40N/AssDNAMycoplasma HyorhinisMycoplasma hyorhinis-infected cellsDevelop an aptamer cocktail for detecting multiple species of mycoplasma in infected cell lines.A15-1 could bind to M. hyorhinis, and mixed mycoplasma-infected cells were detectable within 30 min.N/AFlow CytometryN/ADetectionN/A5'-Biotinylated and Cyanine3 (Cy3) LabeledN/AN/AN/AN/AN/A
ABdb_1442 324711282020Aptamer Cocktail to Detect Multiple Species of Mycoplasma in Cell CultureA16-1YTGGGTGGGGTTGTCGCTAGGGGTTTAAGGGGTCGTCGTGA40N/AssDNAMycoplasma HyorhinisMycoplasma hyorhinis-infected cellsDevelop an aptamer cocktail for detecting multiple species of mycoplasma in infected cell lines.A16-1Y could bind to M. hyorhinis and mixed mycoplasma-infected cells.N/AFlow CytometryN/ADetectionN/A5'-Biotinylated and Cyanine3 (Cy3) LabeledN/AN/AN/AN/AN/A
ABdb_1443 324711282020Aptamer Cocktail to Detect Multiple Species of Mycoplasma in Cell Culture#1JATCCAGAGTGACGCAGCAGCCAACGTGCTTTCTACCTTATTTTCCGTCACTCTCACTCTGGACACGGTGGCTTAGT76N/AssDNAMycoplasma HyorhinisMycoplasma hyorhinis-infected cellsDevelop an aptamer cocktail for detecting multiple species of mycoplasma in infected cell lines.#1J could bind to unclassified mycoplasma-infected cells, but not M. hyorhinis-infected cells.N/AFlow CytometryN/ADetectionN/A5'-Biotinylated and Cyanine3 (Cy3) LabeledN/AN/AN/AN/AN/A