Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 81
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0067 | 19049862 | 2009 | Selection, characterization, and application of DNA aptamers for the capture and detection of Salmonella enterica serovars | Aptamer 33 | TTTGGTCCTTGTCTTATGTCCAGAATGC-TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG-ATTTCTCCTACTGGGATAGGTGGATTAT | 96 | 5'-TTTGGTCCTTGTCTTATGTCCAGAATGC-N40-ATTTCTCCTACTGGGATAGGTGGATTAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) DT104 | Outer membrane protein (OMP) | Identify aptamers that capture and detect Salmonella enterica serovar. Typhimurium. | In a pull-down assay format, detection limits were 10¹–10² CFU S. Typhimurium/9 mL rinsate, while in a recirculation format, detection limits were 10²–10³ CFU/25 mL rinsate. | 7 | Electrophoretic Mobility Shift Assay (EMSA) | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0068 | 19049862 | 2009 | Selection, characterization, and application of DNA aptamers for the capture and detection of Salmonella enterica serovars | Aptamer 23 | TTTGGTCCTTGTCTTATGTCCAGAATGC-CCGCCTTTACTAAATTGACGAACATAGGAATCAATGAAGC-ATTTCTCCTACTGGGATAGGTGGATTAT | 96 | 5'-TTTGGTCCTTGTCTTATGTCCAGAATGC-N40-ATTTCTCCTACTGGGATAGGTGGATTAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) DT104 | Outer membrane protein (OMP) | Identify aptamers that capture and detect Salmonella enterica serovar. Typhimurium. | N/A | 7 | Electrophoretic Mobility Shift Assay (EMSA) | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0069 | 19049862 | 2009 | Selection, characterization, and application of DNA aptamers for the capture and detection of Salmonella enterica serovars | Aptamer 24 | TTTGGTCCTTGTCTTATGTCCAGAATGC-GGGAGTCAGAACGCCTGGGCAAGCATAGTACTCGCCGGAA-ATTTCTCCTACTGGGATAGGTGGATTAT | 96 | 5'-TTTGGTCCTTGTCTTATGTCCAGAATGC-N40-ATTTCTCCTACTGGGATAGGTGGATTAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) DT104 | Outer membrane protein (OMP) | Identify aptamers that capture and detect Salmonella enterica serovar. Typhimurium. | N/A | 7 | Electrophoretic Mobility Shift Assay (EMSA) | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0070 | 19049862 | 2009 | Selection, characterization, and application of DNA aptamers for the capture and detection of Salmonella enterica serovars | Aptamer 25 | TTTGGTCCTTGTCTTATGTCCAGAATGC-TAAAGAGGAATCGACAGGCATCAGAGTCCGTAATGCGGGG-ATTTCTCCTACTGGGATAGGTGGATTAT | 96 | 5'-TTTGGTCCTTGTCTTATGTCCAGAATGC-N40-ATTTCTCCTACTGGGATAGGTGGATTAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) DT104 | Outer membrane protein (OMP) | Identify aptamers that capture and detect Salmonella enterica serovar. Typhimurium. | N/A | 7 | Electrophoretic Mobility Shift Assay (EMSA) | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0071 | 19049862 | 2009 | Selection, characterization, and application of DNA aptamers for the capture and detection of Salmonella enterica serovars | Aptamer 45 | TTTGGTCCTTGTCTTATGTCCAGAATGC-GAGGAAAGTCTATAGCAGAGGAGATGTGTGAACCGAGTAA-ATTTCTCCTACTGGGATAGGTGGATTAT | 96 | 5'-TTTGGTCCTTGTCTTATGTCCAGAATGC-N40-ATTTCTCCTACTGGGATAGGTGGATTAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) DT104 | Outer membrane protein (OMP) | Identify aptamers that capture and detect Salmonella enterica serovar. Typhimurium. | N/A | 7 | Electrophoretic Mobility Shift Assay (EMSA) | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0080 | 20443050 | 2010 | A novel screening method for competitive FRET-aptamers applied to E. coli assay development | EcO 4R | ATCCGTCACACCTGCTCT-ACGGCGCTCCCAACAGGCCTCTCCTTACGGCATATTA-TGGTGTTGGCTCCCGTAT | 73 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) strain 8739 (Crooks strain) | Outer membrane protein (OMP) | Identify highly effective DNA aptamers for detecting E. coli outer membrane proteins. | Detect as few as 30 live, unlabeled E. coli per ml using FRET assay. | 5 | Fluorescence Resonance Energy Transfer Assay (FRET) and Enzyme-Linked Aptamer Assay (ELAA) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated and AlexaFluor 647 Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0081 | 20443050 | 2010 | A novel screening method for competitive FRET-aptamers applied to E. coli assay development | EcO 3R | ATCCGTCACACCTGCTCT-GTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCG-TGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) strain 8739 (Crooks strain) | Outer membrane protein (OMP) | Identify highly effective DNA aptamers for detecting E. coli outer membrane proteins. | N/A | 5 | Fluorescence Resonance Energy Transfer Assay (FRET) and Enzyme-Linked Aptamer Assay (ELAA) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated and AlexaFluor 647 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0082 | 20443050 | 2010 | A novel screening method for competitive FRET-aptamers applied to E. coli assay development | EcO 8F | ATACGGGAGCCAACACCA-CGACTAACACGACCGTTGGGGGGGGCTCGCGCGGGC-AGAGCAGGTGTGACGGAT | 72 | 5'-ATACGGGAGCCAACACCA-N36-AGAGCAGGTGTGACGGAT-3' | ssDNA | Escherichia Coli (E. Coli) strain 8739 (Crooks strain) | Outer membrane protein (OMP) | Identify highly effective DNA aptamers for detecting E. coli outer membrane proteins. | N/A | 5 | Fluorescence Resonance Energy Transfer Assay (FRET) and Enzyme-Linked Aptamer Assay (ELAA) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated and AlexaFluor 647 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0214 | 23473545 | 2013 | Selection and characterization of aptamers against Salmonella typhimurium using whole-bacterium SELEX | ST2P | ATAGGAGTCACGACGACCAGAA-AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (Lipopolysaccharide (LPS) or lipoprotein) of whole cell | Identify an aptamer that binds to and develop a fluorescent bioassay based on aptamer-MNPs conjugate to detect S. typhimurium. | The limit of detection (LOD) was 25 cfu/mL, and the percentage gated fluorescence intensity above library background was 20% when ST9P was incubated with L. monocytogenes cells and 72% when incubated with S. typhimurium. | 9 | Flow Cytometry | 6.33 ± 0.58 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0215 | 23473545 | 2013 | Selection and characterization of aptamers against Salmonella typhimurium using whole-bacterium SELEX | ST2 | AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA | 40 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (Lipopolysaccharide (LPS) or lipoprotein) of whole cell | Identify an aptamer that binds to and develop a fluorescent bioassay based on aptamer-MNPs conjugate to detect S. typhimurium. | Gated fluorescence intensity above background remained at 82 ± 2.34% for ST2. | 9 | Flow Cytometry | 16.34 ± 0.45 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0216 | 23473545 | 2013 | Selection and characterization of aptamers against Salmonella typhimurium using whole-bacterium SELEX | ST3P | ATAGGAGTCACGACGACCAGAA-TTTCGGCTAAGGACGGGTGAAATACATTTAATAGGGTGGA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (Lipopolysaccharide (LPS) or lipoprotein) of whole cell | Identify an aptamer that binds to and develop a fluorescent bioassay based on aptamer-MNPs conjugate to detect S. typhimurium. | N/A | 9 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0217 | 23473545 | 2013 | Selection and characterization of aptamers against Salmonella typhimurium using whole-bacterium SELEX | ST7P | ATAGGAGTCACGACGACCAGAA-TAAGTACAGGACTGGAGTATTAGCGGGGTCCATGCAAGGC-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (Lipopolysaccharide (LPS) or lipoprotein) of whole cell | Identify an aptamer that binds to and develop a fluorescent bioassay based on aptamer-MNPs conjugate to detect S. typhimurium. | N/A | 9 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0218 | 23473545 | 2013 | Selection and characterization of aptamers against Salmonella typhimurium using whole-bacterium SELEX | ST9 | AATCAATAGAAGACAAAGTCCGAAACAGGTGTGACGGTAA | 40 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (Lipopolysaccharide (LPS) or lipoprotein) of whole cell | Identify an aptamer that binds to and develop a fluorescent bioassay based on aptamer-MNPs conjugate to detect S. typhimurium. | Gated fluorescence intensity above background remained at 72 ± 1.57% for ST9. | 9 | Flow Cytometry | 9.45 ± 0.63 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0219 | 23473545 | 2013 | Selection and characterization of aptamers against Salmonella typhimurium using whole-bacterium SELEX | ST9P | ATAGGAGTCACGACGACCAGAA-AATCAATAGAAGACAAAGTCCGAAACAGGTGTGACGGTAA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (Lipopolysaccharide (LPS) or lipoprotein) of whole cell | Identify an aptamer that binds to and develop a fluorescent bioassay based on aptamer-MNPs conjugate to detect S. typhimurium. | Gated fluorescence intensity above background remained at 66 ± 1.45% for ST9P. | 9 | Flow Cytometry | 11.14 ± 0.12 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0341 | https://doi.org/10.1016/j.snb.2013.01.062 | 2013 | A label-free DNA aptamer-based impedance biosensor for the detection of E. coli outer membrane proteins | ECA I | GTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCGC | 37 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC® 8739™) | Outer membrane protein (OMP) | Developed a label-free aptamer-based impedance biosensor for the detection of E. coli outer membrane proteins (OMPs). | Demonstrated in a dynamic detection range of 1 × 10(-7)–2 × 10(-6) M. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0342 | https://doi.org/10.1016/j.snb.2013.01.062 | 2013 | A label-free DNA aptamer-based impedance biosensor for the detection of E. coli outer membrane proteins | ECA II | ACGGCGCTCCCAACAGGCCTCTCCTTACGGCATATTA | 37 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC® 8739™) | Outer membrane protein (OMP) | Developed a label-free aptamer-based impedance biosensor for the detection of E. coli outer membrane proteins (OMPs). | Demonstrated in a dynamic detection range of 1 × 10(-7)–2 × 10(-6) M. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0466 | 24491961 | 2014 | Lateral flow biosensor for DNA extraction-free detection of Salmonella based on aptamer mediated strand displacement amplification | Capture-aptamer (c-aptamer) | TCGGCAACAAGGTCACCCGGAGAAGATCGGTGGTCAAACTGCATAGGTAGTCCAGAAGCCGAACAAGCTGAGGATGAAGAACAACGGCT | 89 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (OMP) | The gold-nanoparticle-based lateral flow biosensor was developed for the rapid detection of S. enteritidis. | As low as 10(1) CFU of S. enteritidis per mL was detected. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0467 | 24491961 | 2014 | Lateral flow biosensor for DNA extraction-free detection of Salmonella based on aptamer mediated strand displacement amplification | Amplify-aptamer (a-aptamer) | TCGGCAACAAGGTCACCCGGAGAAGATCGGTGGTCAAACTGCATAGGTAGTCCAGAAGCCGAACAAGCTGAGGATGAAGAACAACGGCT | 89 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (OMP) | The gold-nanoparticle-based lateral flow biosensor was developed for the rapid detection of S. enteritidis. | As low as 10(1) CFU of S. enteritidis per mL was detected. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0500 | 25016253 | 2014 | Evanescent wave DNA-aptamer biosensor based on long period gratings for the specific recognition of E. coli outer membrane proteins | Aptamer | GTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCG | 36 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC® 8739™) | Outer membrane protein (OMP) | A label-free remote evanescent wave fibre optic sensor using long-period gratings (LPGs) was developed for the detection of EcOMPs. | Displayed linear responses in the range of 0.1 nM to 10 nM EcOMPs and LOD of 10 nM in less than 1 h. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0694 | 25702275 | 2015 | A sensitive lateral flow biosensor for Escherichia coli O157:H7 detection based on aptamer mediated strand displacement amplification | Amplification-aptamer (a-aptamer) | ATCAAATGTGCAGATATCAAGACGATTTGTACAAGATCCATGCTGAGGT | 49 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Outer membrane protein (OMP) | Developed a Lateral Flow Biosensor (LFB) with gold nanoparticle (AuNP) probes for the detection of E.coli. | Can detect as low as 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0695 | 25702275 | 2015 | A sensitive lateral flow biosensor for Escherichia coli O157:H7 detection based on aptamer mediated strand displacement amplification | Capture-aptamer (c-aptamer) | TTTCCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 45 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Outer membrane protein (OMP) | Developed a Lateral Flow Biosensor (LFB) with gold nanoparticle (AuNP) probes for the detection of E.coli. | Can detect as low as 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0808 | 26894987 | 2016 | Diazonium-based impedimetric aptasensor for the rapid label-free detection of Salmonella typhimurium in food sample | Aptamer (N45) | TTTGGTCCTTGTCTTATGTCCAGAATGCGAGGAAAGTCTATAGCAGAGGAGATGTGTGAACCGAGTAAATTTCTCCTACTGGGATAGGTGGATTAT | 96 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (OMP) | Developed a label-free impedimetric aptamer-based biosensor for S. typhimurium detection. | Rapid (30 min) detection with a concentration range of 1×10(1) to 1×10(8) CFU/mL and limit of detection (LOD) of 6 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0851 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-5 | AGCAGCACAGAGGTCAGATG-TGCGTGAGCGGTAGCCCCGTACGACCCACTGTGGTTGGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | Display a LOD of 10(4) with a linear range from 10(4) to 10(7) cfu/mL. | 12 | Flow Cytometry | 10.69 ± 0.89 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0852 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-2 | AGCAGCACAGAGGTCAGATG-GCCTGGCCAGGTGCCCCGATATAGCGACGCCTTGCCCGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0853 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-4 | AGCAGCACAGAGGTCAGATG-GCCCCGGACGGCGGGAAGCCTCGTACCCCCCGTGAGCGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0854 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-12 | AGCAGCACAGAGGTCAGATG-GTCACACCGGCCGTCTCCGGTGTGGGACGCCCGCTGTGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0855 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-1 | AGCAGCACAGAGGTCAGATG-CGCCCTACACCACTCTCGGAGCGCTGTACGGCATCCCTGG-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0856 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-15 | AGCAGCACAGAGGTCAGATG-GCCCGCACCACACACAGATGTCCATGTGTGCGCTGCCGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0857 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-11 | AGCAGCACAGAGGTCAGATG-GCCTGGCCAGGTGCCCCGATATAGCGACGCCTTGCCCGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0858 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-23 | AGCAGCACAGAGGTCAGATG-GCCTGGCCAGGTGCCCCGATATAGCGACGCCTTGCCCGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0859 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-14 | AGCAGCACAGAGGTCAGATG-GCCTGGCCAGGTGCGCCGATATAGCCTGCCCTTGCCCGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0860 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-18 | AGCAGCACAGAGGTCAGATG-GCCTGGCCACGTGCGCGGATATAGCCTGCCCTTGGCCGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0861 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-9 | AGCAGCACAGAGGTCAGATG-GCCCCGGACGGCGGGAAGCCTCGTACCCCCCGTGAGCGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0862 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-25 | AGCAGCACAGAGGTCAGATG-GCCCCGGACGGCGGGAAGCCTCGTACCCCCCGTGAGCGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0863 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-28 | AGCAGCACAGAGGTCAGATG-GCCCCGGACGGCGGGAAGCCTCGTACCCCCCGTGAGCGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0864 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-7 | AGCAGCACAGAGGTCAGATG-GCCCCGGACGGCGGGAAGCCTCGTACCCCGGGTGAGCGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0865 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-6 | AGCAGCACAGAGGTCAGATG-TGCGTGAGCGGTAGCCCCGTACGACCCACTGTGGTTGGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0866 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-17 | AGCAGCACAGAGGTCAGATG-TGCGTGAGCGGTAGCCCCGTACGACCCACTGTGGTTGGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0867 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-21 | AGCAGCACAGAGGTCAGATG-TGCGTGAGCGGTAGCCCCGTACGACCCACTGTGGTTGGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0868 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-26 | AGCAGCACAGAGGTCAGATG-TGCGTGAGCGGTAGCCCCGTACGACCCACTGTGGTTGGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0869 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-27 | AGCAGCACAGAGGTCAGATG-TGCGTGAGCGGTAGCCCCGTACGACCCACTGTGGTTGGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0870 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-30 | AGCAGCACAGAGGTCAGATG-TGCGTGAGCGGTAGCCCCGTACGACCCACTGTGGTTGGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0871 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-29 | AGCAGCACAGAGGTCAGATG-TGCGTGAGCGGTAGCCCGGTACGACCCACTGTGGTTGGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0872 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-3 | AGCAGCACAGAGGTCAGATG-TGCGTGAGCGGTAGCCGGGTACGACCCACTGTGGTTGGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0873 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-13 | AGCAGCACAGAGGTCAGATG-GTCACACCGGCCGTCTCCGGTGTGGGACGCCCGCTGTGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0874 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-16 | AGCAGCACAGAGGTCAGATG-GTCACACCGGCCGTCTCCGGTGTGGGACGCCCGCTGTGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0875 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-22 | AGCAGCACAGAGGTCAGATG-GTCACACCGGCCGTCTCCGGTGTGGGACGCCCGCTGTGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0876 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-24 | AGCAGCACAGAGGTCAGATG-GTCACACCGGCCGTCTCCGGTGTGGGACGCCCGCTGTGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0877 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-19 | AGCAGCACAGAGGTCAGATG-GTCACACGGCCCGTCTGCGGTGTGGGACGCCCGCTGTGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0878 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-20 | AGCAGCACAGAGGTCAGATG-GTCACACCGGCCGTCTCCGGTCTGGCACGCCGGCTGTGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0879 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-8 | AGCAGCACAGAGGTCAGATG-GCCCGCGCCCCTTCTGCCGTTGGTCGGAACCCCTGTGCGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0880 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-10 | AGCAGCACAGAGGTCAGATG-GCCCGCGCGGGTTCTGCCGTTGGTGGGAACCCCTGTGCGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1048 | 30685034 | 2018 | Selection of highly specific aptamers to Vibrio parahaemolyticus using cell-SELEX powered by functionalized graphene oxide and rolling circle amplification | Apt-2 | TCAGCACGT-ATAAGCATGAATTGACCAACCTAAACTTATTCATTTTCCAGCACCTCTAATATTACTGGC-TCCACTGAGAGATCC | 84 | 5'-TCAGCACGT-N60-TCCACTGAGAGATCC-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell (lipopolysaccharides (LPS) and Outer membrane protein (OMP) on V. parahaemolyticus cell surface) | Identify aptamers against a V. parahaemolyticus. | 75% binding affinity to V. parahaemolyticus than to other foodborne bacteria (less than 18%). | 8 | Flow Cytometry | 10.3 ± 4.5 nM | Detection | Advanced Cell-SELEX (with PC-GO and CRM-RCA) | 5ʹ-Phosphorylation or 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1049 | 30685034 | 2018 | Selection of highly specific aptamers to Vibrio parahaemolyticus using cell-SELEX powered by functionalized graphene oxide and rolling circle amplification | Apt-1 | TCAGCACGT-AGCCCTATTTGTTTTCTCTTGTCTCTGTACTGCTGATGTTGGTCATTCTCTTTTCTCGGT-TCCACTGAGAGATCC | 84 | 5'-TCAGCACGT-N60-TCCACTGAGAGATCC-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell (lipopolysaccharides (LPS) and Outer membrane protein (OMP) on V. parahaemolyticus cell surface) | Identify aptamers against a V. parahaemolyticus. | N/A | 8 | Flow Cytometry | 19.2 ± 2.8 nM | Detection | Advanced Cell-SELEX (with PC-GO and CRM-RCA) | 5ʹ-Phosphorylation or 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1050 | 30685034 | 2018 | Selection of highly specific aptamers to Vibrio parahaemolyticus using cell-SELEX powered by functionalized graphene oxide and rolling circle amplification | Apt-3 | TCAGCACGT-TATCTAGTCAGATATCCAGACAGTCGCGGCTGGAAGCTTCTGTTAAGAATTTGAGATACT-TCCACTGAGAGATCC | 84 | 5'-TCAGCACGT-N60-TCCACTGAGAGATCC-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell (lipopolysaccharides (LPS) and Outer membrane protein (OMP) on V. parahaemolyticus cell surface) | Identify aptamers against a V. parahaemolyticus. | N/A | 8 | Flow Cytometry | 25.2 ± 3.1 nM | Detection | Advanced Cell-SELEX (with PC-GO and CRM-RCA) | 5ʹ-Phosphorylation or 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1051 | 30685034 | 2018 | Selection of highly specific aptamers to Vibrio parahaemolyticus using cell-SELEX powered by functionalized graphene oxide and rolling circle amplification | Apt-4 | TCAGCACGT-GCGGGCATTATTGCACTCCACGGCGAGTAGTGCTCACAGAGTCATTTACACCGGTCGTAT-TCCACTGAGAGATCC | 84 | 5'-TCAGCACGT-N60-TCCACTGAGAGATCC-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell (lipopolysaccharides (LPS) and Outer membrane protein (OMP) on V. parahaemolyticus cell surface) | Identify aptamers against a V. parahaemolyticus. | N/A | 8 | Flow Cytometry | 17.2 ± 5.1 nM | Detection | Advanced Cell-SELEX (with PC-GO and CRM-RCA) | 5ʹ-Phosphorylation or 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1094 | 30413894 | 2018 | An impedimetric aptasensor for Shigella dysenteriae using a gold nanoparticle-modified glassy carbon electrode | Aptamer | ATAGGAGTCACGACGACCAGAACGGAACTAGCGTTTAAATGCCAGGACTGAAGTAGGCAGGGATTAGTCAAGAGGTAGACGCACATA | 87 | N/A | ssDNA | Shigella Dysenteriae (PTCC 1188) | Outer membrane protein (OMP) | Developed an impedimetric aptasensor using GCE modified with AuNPs for the detection of S. dysenteriae. | Display linear dynamic range that extends from 10(1) to 10(6) CFU/mL and a limit of detection of 100 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1225 | 31216306 | 2019 | Aptamer-based fluorometric determination of Salmonella Typhimurium using Fe3O4 magnetic separation and CdTe quantum dots | Aptamer (ssDNA1) | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Outer membrane protein (OMP) | Develop an aptamer-based (Apt-MNPs) fluorescence assay for the determination of Salmonella Typhimurium. | Exhibit a linear range of 10 to 10(10) cfu/mL with LOD of 1 cfu/mL within 2 h, and is successfully applied to the analysis of spiked food samples with good recoveries from 90% to 105%. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1454 | 33241794 | 2020 | Rapid and highly sensitive detection of Salmonella typhimurium in lettuce by using magnetic fluorescent nanoparticles | S. typhimurium aptamer | AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Outer membrane protein (OMP) | Develop a fluorescent sensor (FMNCs-Apt), based on Fe3O4 magnetic nanoparticles and aptamer-modified carbon quantum dots for the detection of S. typhimurium in lettuce. | Detection limit (LOD) of 100 CFU/mL in vegetable washing solution and 138 CFU/mL in lettuce samples with a linear range of 10(3)-10(6) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1455 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C1R1 | TAGGGAAGAGAAGGACATATGAT-GCGCGCGAGATTAACCCCCCAATGCTGCACCGAGCCACGA-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | With 250 cells as the lowest measured cell number by the C1R1. The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | 31 ± 2 nM | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1456 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C2R1 | TAGGGAAGAGAAGGACATATGAT-GCGGCAGGGAAGGACTATGTGGGTGAAAGGAGTGCGCGGG-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | N/A | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1457 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C2R2 | TAGGGAAGAGAAGGACATATGAT-GCAGCGGGATGGGGTAAATGGTGGCGAGAGGCGTCGGGGG-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | N/A | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1458 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C4R2 | TAGGGAAGAGAAGGACATATGAT-GCGGGTTGACTAGTACATGACCACTTGAGTCGCTTGAACT-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | Labelling efficiency by C4R2 of approximately 60 % fluorescence signal relative to R16 values. The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | N/A | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1459 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C6R3 | TAGGGAAGAGAAGGACATATGAT-GCGGGGAGAGGCGAAAGAAGCTGGGATGGAAGGGCGTAGG-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | N/A | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1460 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C10R5 | TAGGGAAGAGAAGGACATATGAT-GCAGCCACAGCAGAGACGGGAAGGGCCAGGGTTGAGCGGG-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | N/A | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1461 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C10R6 | TAGGGAAGAGAAGGACATATGAT-GCGGCGGTGGGGCTTTCGGTGATTTGGGCGGTTTGGCGGG-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | N/A | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1499 | 32200887 | 2020 | DNA aptamer-based non-faradaic impedance biosensor for detecting E. coli | OMP Ag1 aptamer | ATCCGTCACACCTGCTCT-ACGGCGCTCCCAACAGGCCTCTCCTTACGGCATATTA-TGGTGTTGGCTCCCGTAT | 73 | N/A | ssDNA | Escherichia Coli (E. Coli) BL21 strain | Outer membrane protein Ag1 (E. coli OMP Ag1) | Developed an impedance-based biosensor using aptamer-functionalized Interdigitated Electrode (IDE) arrays to detect E. coli. | Detection limit of 9 cfu/mL and linear concentration range of 25–1000 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1769 | 37164985 | 2023 | Selecting antibacterial aptamers against the BamA protein in Pseudomonas aeruginosa by incorporating genetic algorithm to optimise computational screening method | Apt31 | ACCATCTGTGTAAGGGGTAAGGGGTGGGGGTGGGTACGTCT | 41 | N/A | ssDNA | Pseudomonas Aeruginosa | Outer membrane protein BamA (β-barrel assembly machinery A) | Selecting antibacterial aptamers against the BamA protein in Pseudomonas aeruginosa by incorporating a genetic algorithm to optimise the computational screening method. | Treatment of P. aeruginosa with 10 µM Apt31 for 2 h resulted in a significant reduction in CFU/mL and growth percentage. | N/A | N/A | N/A | Therapeutics | In-silico Method | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1789 | 37591900 | 2023 | Aptamer-based assay for rapid detection, surveillance, and screening of pathogenic Leptospira in water samples | LAP1 | GGGCGTTAAAGATACAGGAACCGGTGTCGAGGTCTGAAGAATCCT | 45 | 5'-GAGTATCCAGACGCAGCA-N45-TGGACAGGCTTAGTCGGT-3' | ssDNA | Leptospira Interrogans | Outer membrane protein (OMP) | Development of an aptamer-gold nanoparticle-based colorimetric assay for pathogenic Leptospira detection. | N/A | 10 | Fluorescence Spectroscopy | N/A | Biosensor | Modified Microtiter Plate-based Cell SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | Patent Application No. 202241038353 |
| ABdb_1790 | 37591900 | 2023 | Aptamer-based assay for rapid detection, surveillance, and screening of pathogenic Leptospira in water samples | LAP2 | CGTACGTCTGTCTCTGCATCTTATTGCTATGGAATAATGTTGTTCTGG | 48 | 5'-GAGTATCCAGACGCAGCA-N45-TGGACAGGCTTAGTCGGT-3' | ssDNA | Leptospira Interrogans | Outer membrane protein (OMP) | Development of an aptamer-gold nanoparticle-based colorimetric assay for pathogenic Leptospira detection. | N/A | 10 | Fluorescence Spectroscopy | N/A | Biosensor | Modified Microtiter Plate-based Cell SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | Patent Application No. 202241038353 |
| ABdb_1791 | 37591900 | 2023 | Aptamer-based assay for rapid detection, surveillance, and screening of pathogenic Leptospira in water samples | LAP3 | TGGCGTTAGAGATACCGGAACCGGTGTCGGGCGTCTGAAGAATCC | 45 | 5'-GAGTATCCAGACGCAGCA-N45-TGGACAGGCTTAGTCGGT-3' | ssDNA | Leptospira Interrogans | Outer membrane protein (OMP) | Development of an aptamer-gold nanoparticle-based colorimetric assay for pathogenic Leptospira detection. | Exhibited a detection limit of 57 CFU/mL and a linear response in the concentration range of 6 × 10(5) to 60 CFU/mL. | 10 | Fluorescence Spectroscopy | 133.13 ± 22 nM | Biosensor | Modified Microtiter Plate-based Cell SELEX | 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | Patent Application No. 202241038353 |
| ABdb_1845 | 38006817 | 2024 | Electrocatalytic aptasensor for bacterial detection exploiting ferricyanide reduction by methylene blue on mixed PEG/aptamer monolayers | Aptamer | ATCCGTCACACCTGCTCTACGGCGCTCCCAACAGGCCTCTCCTTACGGCATATTATGGTGTTGGCTCCCGTAT | 73 | N/A | ssDNA | Escherichia Coli (E. Coli) strain 8739 (Crooks strain) | Outer membrane protein (OMP) | Developed a disposable electrocatalytic “off–on” sensor for E. coli on Au SPE. | Exhibited a linear range of 10 to 1000 CFU/mL and LOD of 10 CFU/mL E. coli in 30 min. | N/A | N/A | N/A | Biosensor | N/A | 3'-Thiolated (thiol-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1853 | https://doi.org/10.1016/j.microc.2024.111428 | 2024 | Colorimetric and fluorescent dual-mode detection of Escherichia coli using Fe3O4 nanoparticle coated with fluorescein-labeled aptamer | E. coli aptamer | ATCCGTCACACCTGCTCT-ACGGCGCTCCCAACAGGCCTCTCCTTACGGCATATTA-TGGTGTTGGCTCCCGTAT | 73 | N/A | ssDNA | Escherichia Coli (E. Coli) BL21 strain | Outer membrane protein Ag1 (E. coli OMP Ag1) | Developed a dual-mode colorimetric and fluorescence assay employing Fe3O4 nanoparticles (NPs) coated with FAM-Apt for the identification of E. coli. | Acheived an impressive limit of detection (LOD) of 10 CFU/mL in the colorimetric mode and 6 CFU/mL in the fluorescence mode. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1884 | 40451960 | 2025 | Screening and characterization of nucleic acid aptamers targeting Brucella surface antigens: identification and analysis of their corresponding binding sites | WS-6 | GCTGCAATACTCATGGACAGCACGGCACGGGCTGTCGATCTCGAGGGAAACGGCACATGTGTCTGGAGTACGACCCTGAA | 80 | N/A | ssDNA | Brucella S2 vaccine strain | Outer membrane protein BamA (β-barrel assembly machinery A) | Identify aptamers against Brucella and conjugate them to liposomes for selective recognition and significantly reduced bacterial invasion of host cells. | WS-6 significantly reduced Brucella invasion, as evidenced by a decrease in qPCR Ct from 22.34 to 20.64 (P < 0.05), confirming a reduced intracellular bacterial load. | 13 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | 16.23 ± 5.84 nM | Therapeutics | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | The aptamer demonstrated stable binding to the Brucella S2 vaccine across a temperature range of 16–50°C, with optimal binding observed between 16°C and 50°C and under neutral conditions (pH 7.6) in 2h. | Best Candidate | N/A | N/A |
| ABdb_1955 | 17442275 | 2007 | Aptamer from whole-bacterium SELEX as new therapeutic reagent against virulent Mycobacterium tuberculosis | NK2 | N/A | N/A | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Membrane protein | Identify an aptamer that binds to and improves CD4+T cells & produces IFN-γ by blocking some membrane proteins of H37Rv, decreases the bacterial number, and prolongs the survival rate in the mouse model by inhibiting the invasion of M. tuberculosis into phagocytes and CD8+T cells. | Intracellular IFN-γ levels in CD3+CD4+ T cells increased from approximately 35% (without aptamer) to approximately 55% (with the NK2). The half-life of survival in mice was prolonged by 3 days with a single injection of NK2 aptamer treatment. | 10 | Isothermal Titration Calorimetry (ITC) | N/A | Therapeutics | Whole Cell-SELEX | FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1964 | 21643749 | 2012 | Aptamer inhibits Mycobacterium tuberculosis (H37Rv) invasion of macrophage | NK2 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Outer membrane protein (OMP) | Inhibits the H37Rv invasion of macrophages in vitro and activates the infection of macrophages. | Significantly decreased macrophage invasion from 64.58% (without aptamers) to 33.02% (with 10th aptamer pool), and 26.01% (with NK2). | 10 | Flow Cytometry | 31 ± 4 nM | Therapeutics | Whole Cell-SELEX | FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1965 | 21643749 | 2012 | Aptamer inhibits Mycobacterium tuberculosis (H37Rv) invasion of macrophage | NK1 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Outer membrane protein (OMP) | Inhibits the H37Rv invasion of macrophages in vitro and activates the infection of macrophages. | Binding affinities are as follows: NK2 > NK7 > NK1 > NK20 > NK10 > NK8. | 10 | Flow Cytometry | 48 ± 13 nM | Therapeutics | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1966 | 21643749 | 2012 | Aptamer inhibits Mycobacterium tuberculosis (H37Rv) invasion of macrophage | NK7 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Outer membrane protein (OMP) | Inhibits the H37Rv invasion of macrophages in vitro and activates the infection of macrophages. | Binding affinities are as follows: NK2 > NK7 > NK1 > NK20 > NK10 > NK8. | 10 | Flow Cytometry | 35 ± 9 nM | Therapeutics | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1967 | 21643749 | 2012 | Aptamer inhibits Mycobacterium tuberculosis (H37Rv) invasion of macrophage | NK8 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Outer membrane protein (OMP) | Inhibits the H37Rv invasion of macrophages in vitro and activates the infection of macrophages. | Binding affinities are as follows: NK2 > NK7 > NK1 > NK20 > NK10 > NK8. | 10 | Flow Cytometry | 107 ± 44 nM | Therapeutics | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1968 | 21643749 | 2012 | Aptamer inhibits Mycobacterium tuberculosis (H37Rv) invasion of macrophage | NK10 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Outer membrane protein (OMP) | Inhibits the H37Rv invasion of macrophages in vitro and activates the infection of macrophages. | Binding affinities are as follows: NK2 > NK7 > NK1 > NK20 > NK10 > NK8. | 10 | Flow Cytometry | 95 ± 28 nM | Therapeutics | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1969 | 21643749 | 2012 | Aptamer inhibits Mycobacterium tuberculosis (H37Rv) invasion of macrophage | NK20 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Outer membrane protein (OMP) | Inhibits the H37Rv invasion of macrophages in vitro and activates the infection of macrophages. | Binding affinities are as follows: NK2 > NK7 > NK1 > NK20 > NK10 > NK8. | 10 | Flow Cytometry | 55 ± 16 nM | Therapeutics | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |