Target : MRSA surface components

Total records found: 1

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_1773	37921634	2023	Aptamer and DNAzyme-Functionalized Cu-MOF Hybrid Nanozymes for the Monitoring and Management of Bacteria-Infected Wounds	Aptamer	GGGAAAGGGAAAGGGAAAGGG-TTTTTT-ATCCAGACGTGACGCAGCATGCGGTTGGTTGCGGTTGGGCATGATGTATTTCTGTGTGGACACGGTGGCTTAGTA	102	N/A	ssDNA	Methicillin-resistant Staphylococcus aureus (MRSA)	MRSA surface components	G-quadruplex/hemin DNAzyme-aptamer probes and tannic acid-chelated Au nanoparticle (Au-TA)-decorated Cu-based MOF nanosheets (termed GATC) with triple-enzyme activities were developed for visual detection and efficient antibacterial therapy.	~99.7% MRSA inactivation at 3 μg/mL, with simultaneous colorimetric monitoring of infection.	N/A	N/A	N/A	Therapeutics	N/A	5'-Thiolated	At 50 μg/mL GATC, the cells showed high viability (>90%), indicating negligible cytotoxicity and good cytocompatibility. The hemolysis rate of the GATC nanozyme was low (<5%).	N/A	N/A	N/A	N/A