Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 1
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0138 | 22520654 | 2012 | Evaluation of the clinical value of ELISA based on MPT64 antibody aptamer for serological diagnosis of pulmonary tuberculosis | MPT64-A1 | GGGAGCTCAGAATAAACGCTCAAA-GGGAGCTCAGAATAAACGCTCAAAAACGCTCAAGAGGCCCGGATCTTCGACATGAGGCCCGGATC-CGACATGAGGCCCGGATC | 107 | 5'-GGGAGCTCAGAATAAACGCTCAAA-N35-CGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) | MPT64 antibody | Identify aptamers against MPT64 antibody and develop a sandwich ELISA for the serological diagnosis of pulmonary TB (PTB). | LOD was 2.5 mg/L, with a linear range varying from 10 mg/L to 800 mg/L. | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |