Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 4
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_1022 | 29580944 | 2018 | Inhibition of anthrax lethal factor by ssDNA aptamers | ML12 (30mer) | CGAGGGAGACGCGAACCTTCTCGCCTTGGG | 30 | 5'-GCGCGGATCCCGCGC-N30-CGCGCGAAGCTTGCG-3' | ssDNA | Bacillus Anthracis (BA) | Lethal factor (LF) | Identify aptamers against LF and interfere with the interaction with its substrate MEK1 by blocking the active site of LF to prevent protease activity. | Effective inhibitor of LF with an IC₅₀ of 15 ± 1.5 µM and ~85% cell viability. | 8 | Fluorescence Spectroscopy | 11.0 ± 2.7 nM | Therapeutics | SELEX | 3'-Cyanine3 (Cy3) Labeled | In RAW 264.7 cells, the cell viability remained unchanged from 0.08 to 10 µM of ML12, indicating that it appears to be non-toxic. | N/A | Best Candidate | N/A | N/A |
| ABdb_1023 | 29580944 | 2018 | Inhibition of anthrax lethal factor by ssDNA aptamers | ML6 | GGACCAGCCGCCGCGCCTTGACCGGGGGTA | 30 | 5'-GCGCGGATCCCGCGC-N30-CGCGCGAAGCTTGCG-3' | ssDNA | Bacillus Anthracis (BA) | Lethal factor (LF) | Identify aptamers against LF and interfere with the interaction with its substrate MEK1 by blocking the active site of LF to prevent protease activity. | N/A | 8 | Fluorescence Spectroscopy | N/A | Therapeutics | SELEX | 3'-Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1024 | 29580944 | 2018 | Inhibition of anthrax lethal factor by ssDNA aptamers | ML7 | GGAGAGAGGGAGACGCGCAACCTCGACCCGT | 31 | 5'-GCGCGGATCCCGCGC-N30-CGCGCGAAGCTTGCG-3' | ssDNA | Bacillus Anthracis (BA) | Lethal factor (LF) | Identify aptamers against LF and interfere with the interaction with its substrate MEK1 by blocking the active site of LF to prevent protease activity. | N/A | 8 | Fluorescence Spectroscopy | N/A | Therapeutics | SELEX | 3'-Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1025 | 29580944 | 2018 | Inhibition of anthrax lethal factor by ssDNA aptamers | ML12 (60mer) | GCGCGGATCCCGCGC-CGAGGGAGACGCGAACCTTCTCGCCTTGGG-CGCGCGAAGCTTGCG | 60 | 5'-GCGCGGATCCCGCGC-N30-CGCGCGAAGCTTGCG-3' | ssDNA | Bacillus Anthracis (BA) | Lethal factor (LF) | Identify aptamers against LF and interfere with the interaction with its substrate MEK1 by blocking the active site of LF to prevent protease activity. | N/A | 8 | Fluorescence Spectroscopy | 17.5 ± 4.8 nM | Therapeutics | SELEX | 3'-Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |