Target : K88 fimbriae protein

Total records found: 5

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_0086	21627466	2011	Aptamer selection for the detection of Escherichia coli K88	Aptamer 19	CGTACGGTCGACGCTAGC-GGCGACCCCCGGGCTACCAGACAATGTACGCAGCAAGAGTGACGGTCGTACCTCGGAGTC-CACGTGGAGCTCGGATCC	96	5'-CGTACGGTCGACGCTAGC-N60-CACGTGGAGCTCGGATCC-3'	ssDNA	Escherichia Coli (E. Coli) ETEC K88 (CVCC 216)	K88 fimbriae protein	Identify aptamers that bind to and detect the K88 fimbriae protein of E.coli K88 surface protein.	N/A	11	Fluorescence Spectroscopy	44 ± 7 nM	Detection	SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0087	21627466	2011	Aptamer selection for the detection of Escherichia coli K88	Aptamer 31	CGTACGGTCGACGCTAGC-ACACTCTTTTGCTCGTGTTTTTGCCTGTTACATAAAATGAATCAGTGGATGTTTCCTTCT-CACGTGGAGCTCGGATCC	96	5'-CGTACGGTCGACGCTAGC-N60-CACGTGGAGCTCGGATCC-3'	ssDNA	Escherichia Coli (E. Coli) ETEC K88 (CVCC 216)	K88 fimbriae protein	Identify aptamers that bind to and detect the K88 fimbriae protein of E.coli K88 surface protein.	N/A	11	Fluorescence Spectroscopy	36 ± 8 nM	Detection	SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0088	21627466	2011	Aptamer selection for the detection of Escherichia coli K88	Aptamer 7	CGTACGGTCGACGCTAGC-GGCGGCCGTGAAATTTGCCAAATGCCGTCTTGGCTTTCGCCCAATGTATCCTGGGTGTTC-CACGTGGAGCTCGGATCC	96	5'-CGTACGGTCGACGCTAGC-N60-CACGTGGAGCTCGGATCC-3'	ssDNA	Escherichia Coli (E. Coli) ETEC K88 (CVCC 216)	K88 fimbriae protein	Identify aptamers that bind to and detect the K88 fimbriae protein of E.coli K88 surface protein.	N/A	11	Fluorescence Spectroscopy	43 ± 6 nM	Detection	SELEX	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0089	21627466	2011	Aptamer selection for the detection of Escherichia coli K88	Aptamer 37	CGTACGGTCGACGCTAGC-GGAGACCGTACCATCTGTTCGTGGAAGCGCTTTGCTCGTCCATTAGCCTTGTGCTCGTGC-CACGTGGAGCTCGGATCC	96	5'-CGTACGGTCGACGCTAGC-N60-CACGTGGAGCTCGGATCC-3'	ssDNA	Escherichia Coli (E. Coli) ETEC K88 (CVCC 216)	K88 fimbriae protein	Identify aptamers that bind to and detect the K88 fimbriae protein of E.coli K88 surface protein.	Fluorescence intensity of other bacteria (ETEC K99, S. aureus, E. coli TOP10) is lower than that of ETEC K88.	11	Fluorescence Spectroscopy	25 ± 4 nM	Detection	SELEX	5'-FAM Labeled	N/A	N/A	Best Candidate	N/A	N/A
ABdb_1891	40855524	2025	Inhibition of Enterotoxigenic Escherichia coli adhesion via aptamers prevents infection in IPEC-J2 cells	K88-Apt A04	GGGAGCTCAGAATAAACGCTCAACCCTGCGGGGCTGCCCGATATGTGTCCAAGTGGTGTTCGACATGAGGCCCGGATC	78	N/A	ssDNA	Escherichia Coli (E. Coli) ETEC K88 (CVCC 216)	K88 fimbriae protein	An aptamer was identified to effectively inhibit the adhesion of ETEC K88 to intestinal epithelial cell IPEC-J2 and reduce ETEC K88-induced cytotoxicity in IPEC-J2 cells in vitro.	K88-Apt A04 may more effectively displace ETEC K88 and induce less cytotoxicity than K88-Apt 37, as it resulted in lower TNF-α expression.	N/A	N/A	34.51 ± 9.15 nM	Therapeutics	N/A	5'-FAM Labeled	K88-Apt A04 indicated the lowest cytotoxicity (5.18%) at 100 nM	N/A	Best Candidate	N/A	N/A