AptBacterialDB

Target : Iron-regulated Surface Determinant Protein A (IsdA)

Total records found: 7

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_1778 373272072023FRET-Based Single-Molecule Detection of Pathogen Protein IsdA Using Computationally Selected AptamersT1-280ACTGTCrGrCrGrCrArCrGrCrGrUrGrUrGrUrArGrUrArCrArCrArCrGrArUrCrGrCrGrCrGrCrArCrArArUrArU46N/AssRNAStaphylococcus aureus (S. aureus)Iron-regulated Surface Determinant Protein A (IsdA)Develop a FRET-based aptasensor for single-molecule detection of IsdA.LOD value of T1-280 RNA was 113 pM.N/AFluorescence Resonance Energy Transfer Assay (FRET)2.2 ± 0.5 nMDetectionIn-silico Method5'-Cyanine3 (Cy3) Labeled or 5'-Biotinylated and 5′ end by six nucleotides (ACT GTC), rX = RNA nucleotideN/AN/AN/AN/AN/A
ABdb_1779 373272072023FRET-Based Single-Molecule Detection of Pathogen Protein IsdA Using Computationally Selected AptamersT2-139040ACTGTCrArArUrUrUrGrArArUrArUrArUrUrArGrUrGrCrGrCrGrCrCrGrUrArGrUrGrUrGrUrArArArArArUrU46N/AssRNAStaphylococcus aureus (S. aureus)Iron-regulated Surface Determinant Protein A (IsdA)Develop a FRET-based aptasensor for single-molecule detection of IsdA.LOD value of T2-139040 RNA was 17 pM.N/AFluorescence Resonance Energy Transfer Assay (FRET)1.0 ± 0.3 nMDetectionIn-silico Method5'-Cyanine3 (Cy3) Labeled or 5'-Biotinylated and 5′ end by six nucleotides (ACT GTC), rX = RNA nucleotideN/AN/AN/AN/AN/A
ABdb_1780 373272072023FRET-Based Single-Molecule Detection of Pathogen Protein IsdA Using Computationally Selected AptamersT3-117558ACTGTCrArArUrUrUrGrArGrUrGrUrGrUrGrArUrCrArUrArUrArUrCrGrUrArGrCrGrCrGrCrUrArCrArArCrC46N/AssRNAStaphylococcus aureus (S. aureus)Iron-regulated Surface Determinant Protein A (IsdA)Develop a FRET-based aptasensor for single-molecule detection of IsdA.LOD value of T3-117558 RNA was 11 pM.N/AFluorescence Resonance Energy Transfer Assay (FRET)0.7 ± 0.4 nMDetectionIn-silico Method5'-Cyanine3 (Cy3) Labeled or 5'-Biotinylated and 5′ end by six nucleotides (ACT GTC), rX = RNA nucleotideN/AN/AN/AN/AN/A
ABdb_1781 373272072023FRET-Based Single-Molecule Detection of Pathogen Protein IsdA Using Computationally Selected AptamersA14ACTGTCCACACCGCAGCAGTGGGAACGTTTCAGCCATGCAAGCATCACGCCCGT54N/AssDNAStaphylococcus aureus (S. aureus)Iron-regulated Surface Determinant Protein A (IsdA)Develop a FRET-based aptasensor for single-molecule detection of IsdA.LOD value of A14 DNA was 485 pM.N/AFluorescence Resonance Energy Transfer Assay (FRET)4 ± 2 nMDetectionN/A5'-Cyanine3 (Cy3) Labeled or 5'-Biotinylated and 5′ end by six nucleotides (ACT GTC)N/AN/AN/AN/AN/A
ABdb_1905 411236782025Portable AI-driven electrochemical aptasensor for real-time Staphylococcus aureus detection in food and beveragesIsdA-specific aptamerGCGCACGCGUGUGUAGUACACACGAUCGCGCGCACAAUAU40N/AssRNAStaphylococcus aureus (S. aureus) (ATCC 25923)Iron-regulated Surface Determinant Protein A (IsdA)Developed a portable electrochemical aptasensor integrated with machine learning using SPCE/AuNPs for the detection of S. aureus in food and beverage samples.The lowest detection limit for S. aureus was 1 CFU/mL.N/AN/AN/ABiosensorN/AN/AN/AN/AN/AN/AN/A
ABdb_2000 249357142014Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components4727–62N/AN/AN/AssDNAStaphylococcus aureus (S. aureus) NRS384 (USA300)Iron-regulated Surface Determinant Protein A (IsdA)Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX.N/A8Radiolabel Filter Binding Assay0·73 nMDetectionSELEXNapdU (5-naphthylmethyl-aminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A
ABdb_2001 249357142014Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components4746–3N/AN/AN/AssDNAStaphylococcus aureus (S. aureus) NRS384 (USA300)Iron-regulated Surface Determinant Protein A (IsdA)Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX.N/A8Radiolabel Filter Binding Assay0·16 nMDetectionSELEXTrpdU (5-tryptaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT)N/AN/AN/AN/AN/A