AptBacterialDB

Target : Internalin A (InlA)

Total records found: 3

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_0078 203377672010Antibody-aptamer functionalized fibre-optic biosensor for specific detection of Listeria monocytogenes from foodA8ATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT47N/AssDNAListeria Monocytogenes (F4244)Internalin A (InlA)Antibody-aptamer functionalized fibre‐optic biosensor for specific detection of Listeria monocytogenes from food products.The detection limit of this sensor was 1 × 10(3) CFU/ml, and it could successfully detect a lower inoculum size of 10(2) CFU/25g.N/AN/AN/ABiosensorN/AAlexaFluor 647 Labeled or BiotinylatedN/AN/AN/AN/AN/A
ABdb_0445 252201632014Potentiometric Aptasensing of Listeria monocytogenes Using Protamine as an IndicatorLM aptamerATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT47N/AssDNAListeria MonocytogenesInternalin A (InlA)Develop a label-free potentiometric aptasensor for selective detection of L. monocytogenes.LM can be detected down to 10 CFU/mL.N/AN/AN/ABiosensorN/AN/AN/AN/AN/AN/AN/A
ABdb_1554 349402682021One-Step Fabrication of Stimuli-Responsive Chitosan-Platinum Brushes for Listeria monocytogenes DetectionAptamerATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT47N/AssDNAListeria Monocytogenes (ATCC 15313)Internalin A (InlA)Developed a label-free electrochemical biosensor using a new one-step simultaneous sonoelectrodeposition of platinum and chitosan (CHI/Pt) to create a biomimetic nanostructure for Listeria monocytogenes detection.LOD of the CHI/Pt-aptamer brushes in PBS was 2.5 ± 0.3 CFU/mL, 3.3 ± 0.9 CFU/mL in chicken broth.N/AN/AN/ABiosensorN/A5'-ThiolatedN/AN/AN/AN/AN/A