Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 8
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_1085 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-1 | GTCTTGACTAGTTACGCC-TAGGAAGGGAAGGAAGATAGAGAGTAGGTCGTCGGAGGCAGGGG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | Displayed the highest binding to HupB (≥5 fold relative to RDL). | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Patent application no. 20171100124 |
| ABdb_1086 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-2 | GTCTTGACTAGTTACGCC-TAGTAAAGGGGGTAAGAATCAATTGCGAGGTGGAGTGGGAGTGG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | Displayed the highest binding to HupB (≥5 fold relative to RDL). | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Patent application no. 20171100124 |
| ABdb_1087 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-4 | GTCTTGACTAGTTACGCC-TAGGTGATTGCTGGAGTGGGTAGCAGATGGGGGGGGGGTTCTTGG-TCATTCAGTTGGCGCCTC | 81 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | Displayed the highest binding to HupB (≥5 fold relative to RDL). | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Patent application no. 20171100124 |
| ABdb_1088 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-13 | GTCTTGACTAGTTACGCC-TTTGGGAAGGGGGGGGAGGAAGTTCGATGGTGTTGTGGACCGGG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | Displayed the highest binding to HupB (≥5 fold relative to RDL). | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Patent application no. 20171100124 |
| ABdb_1089 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-1T | TAGGAAGGGAAGGAAGATAGAGAGTAGGTCGTCGGAGGCAGGGG | 44 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | N/A | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Patent application no. 20171100124 |
| ABdb_1090 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-2T | TAGTAAAGGGGGTAAGAATCAATTGCGAGGTGGAGTGGGAGTGG | 44 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | N/A | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Patent application no. 20171100124 |
| ABdb_1091 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-4T | TAGGTGATTGCTGGAGTGGGTAGCAGATGGGGGGGGGGTTCTTGG | 45 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | HupB-4T treated bacteria yielded reduced intracellular CFU by ∼57.8%. | 8 | Isothermal Titration Calorimetry (ITC) | 1.72 ± 0.00002 μM, | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | No loss in the viability of THP-1 cells was observed on exposure to aptamers. | In fetal bovine serum (FBS) for 3 hr at 37°C, no change was observed in the integrity of aptamer bands. | Best Candidate | N/A | Patent application no. 20171100124 |
| ABdb_1092 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-13T | TTTGGGAAGGGGGGGGAGGAAGTTCGATGGTGTTGTGGACCGGG | 44 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | HupB-13T treated bacteria yielded reduced intracellular CFU by ∼45.5%. | 8 | Isothermal Titration Calorimetry (ITC) | 0.17 ± 0.00000005 μM | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | No loss in the viability of THP-1 cells was observed on exposure to aptamers. | In fetal bovine serum (FBS) for 3 hr at 37°C, no change was observed in the integrity of aptamer bands. | Best Candidate | N/A | Patent application no. 20171100124 |