Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 1
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_1275 | 30637507 | 2019 | Colorimetric detection and typing of E. coli lipopolysaccharides based on a dual aptamer-functionalized gold nanoparticle probe | General aptamer (G-probe) | AGCAATTGGTCCTCGCTTAGCTTCTACGGTGGGCTATCT | 39 | N/A | ssDNA | Escherichia Coli (E. Coli) O111:B4 and O111:B5 | Ethanolamine | Develop a dual aptamer-based colorimetric method for the identification of E.coli LPS. | Can detect LPS in concentrations between 2.5 and 20 μg/mL and with a 1 μg/mL detection limit. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |