AptBacterialDB

Target : EsxG protein

Total records found: 4

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_0405 248139972014Selection of RNA aptamers against the M. tuberculosis EsxG protein using surface plasmon resonance-based SELEXG43UAAUACGACUCACUAUAGGGAGACAAGACUAGACGCUCAA-AAUAGGAACUUAGAACAACCCUCUCCCUCAUGUAGCGAACCCGAACCAGG-UUCGACAUGAGACUCACAACAGUUCCCUUUAGUGAGGGUUAAUU134N/AssRNAMycobacterium Tuberculosis (H37Rv)EsxG proteinIdentify aptamers against EsxG over its homologue EsxA.The affinity of aptamer G43 to EsxG was about ten times higher than the affinity of aptamer G78 and also showed no significant binding to EsxA.5Surface Plasmon Resonance (SPR)8.04 ± 1.9 nMDetectionSPR based SELEXN/AN/AN/ABest CandidateN/AN/A
ABdb_0406 248139972014Selection of RNA aptamers against the M. tuberculosis EsxG protein using surface plasmon resonance-based SELEXG78UAAUACGACUCACUAUAGGGAGACAAGACUAGACGCUCAA-GCGUUUAAACGUUGCACCGUCGUUGACGGGACCGCUUGAGACAUUCGCUC-UUCGACAUGAGACUCACAACAGUUCCCUUUAGUGAGGGUUAAUU134N/AssRNAMycobacterium Tuberculosis (H37Rv)EsxG proteinIdentify aptamers against EsxG over its homologue EsxA.G78 showed some binding to EsxA, though a significantly lower binding signal was observed (p < 0.01) when compared to that of EsxG.5Surface Plasmon Resonance (SPR)78.85 ± 9.4 nMDetectionSPR based SELEXN/AN/AN/AN/AN/AN/A
ABdb_0407 248139972014Selection of RNA aptamers against the M. tuberculosis EsxG protein using surface plasmon resonance-based SELEXG31UAAUACGACUCACUAUAGGGAGACAAGACUAGACGCUCAA-UAACGACUCACCAACACAUCGACUAAUUUCCCUAAAUGACUUAACUGAAU-UUCGACAUGAGACUCACAACAGUUCCCUUUAGUGAGGGUUAAUU134N/AssRNAMycobacterium Tuberculosis (H37Rv)EsxG proteinIdentify aptamers against EsxG over its homologue EsxA.N/A5Surface Plasmon Resonance (SPR)N/ADetectionSPR based SELEXN/AN/AN/AN/AN/AN/A
ABdb_0408 248139972014Selection of RNA aptamers against the M. tuberculosis EsxG protein using surface plasmon resonance-based SELEXG70UAAUACGACUCACUAUAGGGAGACAAGACUAGACGCUCAA-ACUCGUGACACUUACGAACGACCUAUGGCGGGAGAAUCCUAGCCGCUACG-UUCGACAUGAGACUCACAACAGUUCCCUUUAGUGAGGGUUAAUU134N/AssRNAMycobacterium Tuberculosis (H37Rv)EsxG proteinIdentify aptamers against EsxG over its homologue EsxA.N/A5Surface Plasmon Resonance (SPR)N/ADetectionSPR based SELEXN/AN/AN/AN/AN/AN/A