AptBacterialDB

Target : ESAT6/CFP10 fusion proteins (EC proteins)

Total records found: 11

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_1553 345787622021Aptasensor for the Detection of Mycobacterium tuberculosis in Sputum Utilising CFP10-ESAT6 Protein as a Selective BiomarkerAptamerGCCTGTTGTGAGCCTCCTAACCCCATCTTATACGTATATGGACTCATCTCGACCCCCGATAGGCTTGGTACATGCTTATTCTTGTCTCCC90N/AssDNAMycobacterium Tuberculosis (M.Tb.)ESAT6/CFP10 fusion proteins (EC proteins)Developed a portable electrochemical aptamer-antibody-based sandwich biosensor via CapApt/GP/PANI-modified SPGE surface for M. tb. detection in clinical sputum samples.Detection of the CFP10-ESAT6 antigen ranged from 5 to 500 ng/mL, with a detection limit of 1.5 ng/mL.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1873 403598082025Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT)Aptamer 3 (Ap3)NNNNNNNNNNNNNNNNNNNNNGGGGGCTTTCAAGGGCGCGACGAAGCTGTTTTATTCTC59N/AssDNAMycobacterium Tuberculosis (H37Rv)ESAT6/CFP10 fusion proteins (EC proteins)Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood.Achieved a detection limit of 0.1 ag/mL EC proteins (equivalent to 3 protein particles per mL) within 120 min from the plasma sample.15Isothermal Titration Calorimetry (ITC)8.30 x 10-7 MBiosensorMagnetic Bead (MB)-based SELEXN/AN/AN/ABest CandidateN/AN/A
ABdb_1874 403598082025Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT)Aptamer 1 (Ap1)GACGTTTTGCAAGTGCGGCTACTACAAGCGAAGTTCCATCATTTTAGAGTCATAAACGC59N/AssDNAMycobacterium Tuberculosis (H37Rv)ESAT6/CFP10 fusion proteins (EC proteins)Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood.N/A15Isothermal Titration Calorimetry (ITC)N/ABiosensorMagnetic Bead (MB)-based SELEXN/AN/AN/AN/AN/AN/A
ABdb_1875 403598082025Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT)Aptamer 6 (Ap6)CCGCCTGGAAGGCATTTCGCCGGGAAGACCCACGTCACTCCTCCCCTGAACTTCGGTTC59N/AssDNAMycobacterium Tuberculosis (H37Rv)ESAT6/CFP10 fusion proteins (EC proteins)Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood.N/A15Isothermal Titration Calorimetry (ITC)N/ABiosensorMagnetic Bead (MB)-based SELEXN/AN/AN/AN/AN/AN/A
ABdb_1876 403598082025Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT)Aptamer 2 (Ap2)TATACATTGATTTATCGGACCACTGCAGTACCACGCAGGATGGACGGCCATCGTTAATA59N/AssDNAMycobacterium Tuberculosis (H37Rv)ESAT6/CFP10 fusion proteins (EC proteins)Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood.N/A15Isothermal Titration Calorimetry (ITC)N/ABiosensorMagnetic Bead (MB)-based SELEXN/AN/AN/AN/AN/AN/A
ABdb_1877 403598082025Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT)Aptamer 4 (Ap4)TAGGATTCGTTTATTCGTGGGGCTGTAGTTCCGATAAAACCGCCAAGGGATCGTTGCCT59N/AssDNAMycobacterium Tuberculosis (H37Rv)ESAT6/CFP10 fusion proteins (EC proteins)Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood.N/A15Isothermal Titration Calorimetry (ITC)N/ABiosensorMagnetic Bead (MB)-based SELEXN/AN/AN/AN/AN/AN/A
ABdb_1878 403598082025Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT)Aptamer 5 (Ap5)ATTAGATGTAAAACGCCACGGGTAGCAGTTAAAGTCGTATTTATAGGCACAACGAAGAT59N/AssDNAMycobacterium Tuberculosis (H37Rv)ESAT6/CFP10 fusion proteins (EC proteins)Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood.N/A15Isothermal Titration Calorimetry (ITC)N/ABiosensorMagnetic Bead (MB)-based SELEXN/AN/AN/AN/AN/AN/A
ABdb_1879 403598082025Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT)Aptamer 7 (Ap7)CAATTAGACAGGCTCTAAGCTTTGGACCCAGCGTAGAAAGTTTGTTATTTCTTCGGGCT59N/AssDNAMycobacterium Tuberculosis (H37Rv)ESAT6/CFP10 fusion proteins (EC proteins)Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood.N/A15Isothermal Titration Calorimetry (ITC)N/ABiosensorMagnetic Bead (MB)-based SELEXN/AN/AN/AN/AN/AN/A
ABdb_1880 403598082025Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT)Aptamer 8 (Ap8)ATAAGCTTTTTAAGGCAAGGACGCGGCCCGGTACTTGCGTTGGAGGAATCTTAAGTTAT59N/AssDNAMycobacterium Tuberculosis (H37Rv)ESAT6/CFP10 fusion proteins (EC proteins)Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood.N/A15Isothermal Titration Calorimetry (ITC)N/ABiosensorMagnetic Bead (MB)-based SELEXN/AN/AN/AN/AN/AN/A
ABdb_1881 403598082025Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT)Aptamer 9 (Ap9)CATTTATAACTACGATTGTGGTCACATTCCGTGGATGGAATCACTTCTCAGGTGCCGAG59N/AssDNAMycobacterium Tuberculosis (H37Rv)ESAT6/CFP10 fusion proteins (EC proteins)Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood.N/A15Isothermal Titration Calorimetry (ITC)N/ABiosensorMagnetic Bead (MB)-based SELEXN/AN/AN/AN/AN/AN/A
ABdb_1882 403598082025Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT)Aptamer 10 (Ap10)TGTTTACACATATTCTTGCGCATTACTTGCTTTGGCATTATCTGTATCCCCCTCAGCGG59N/AssDNAMycobacterium Tuberculosis (H37Rv)ESAT6/CFP10 fusion proteins (EC proteins)Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood.N/A15Isothermal Titration Calorimetry (ITC)N/ABiosensorMagnetic Bead (MB)-based SELEXN/AN/AN/AN/AN/AN/A