Target : ESAT-6 (6-kDa early secretory antigenic target)

Total records found: 3

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_1195	30019137	2018	Aptamer based voltammetric biosensor for Mycobacterium tuberculosis antigen ESAT-6 using a nanohybrid material composed of reduced graphene oxide and a metal-organic framework	ESAT-6 binding aptamer (EBA)	GGGAGCTCAGAATAAACGCTCAACCTCCCTGGGTCACCATAGACTCCATCTAAGATGCTTCGACATGAGGCCCGGATC	78	N/A	ssDNA	Mycobacterium Tuberculosis (M.Tb.)	ESAT-6 (6-kDa early secretory antigenic target)	Develop a voltammetric aptasensor employing P-MOF-rGO nanohybrid as the sensitive sensing platform for ultrasensitive detection of ESAT-6.	Linear range: 1.0×10(−4) to 2.0×10(2) ng/mL and Limit of Detection (LOD): 3.3×10(−5) ng/mL.	N/A	N/A	N/A	Biosensor	N/A	5'-Thiolated (HS-(CH2)6)	N/A	Compared with the initial current response, the aptsensor response decreased only about 3.5% after 50 cycles’ continuous CV scans.	N/A	N/A	N/A
ABdb_1566	34731314	2021	An electrochemical aptasensor for Mycobacterium tuberculosis ESAT-6 antigen detection using bimetallic organic framework	EBA	GGGAGCTCAGAATAAACGCTCAACCTCCCTGGGTCACCATAGACTCCATCTAAGATGCTTCGACATGAGGCCCGGATC	78	N/A	ssDNA	Mycobacterium Tuberculosis (M.Tb.)	ESAT-6 (6-kDa early secretory antigenic target)	A label-free electrochemical aptasensor was developed using NG@Zr-MOF-on-Ce-MOF@Tb nanohybrid for sensitive detection of ESAT-6.	Displayed a wide linear range from 100 fg/mL to 10 ng/mL with a limit of detection (LOD) of 12 fg/mL.	N/A	N/A	N/A	Biosensor	N/A	5'-Phosphate (PO4(-3))	N/A	The current remained at 95.77% and 88.72% of the initial current after storing at at 4℃ for 8 days and 16 days, respectively.	N/A	N/A	N/A
ABdb_1903	41339596	2025	Self-reduced Pd nanoparticles on NiMn-LDHs with superior catalytic activity for signal amplification in electrochemical aptasensing of Mycobacterium tuberculosis ESAT-6 antigen	Apt	GGGAGCTCAGAATAAACGCTCAACCTCCCTGGGTCACCATAGACTCCATCTAAGATGCTTCGACATGAGGCCCGGATC	78	N/A	ssDNA	Mycobacterium Tuberculosis (M.Tb.)	ESAT-6 (6-kDa early secretory antigenic target)	Developed an electrochemical aptasensor using NiMn-layered double hydroxides@palladium nanoparticles (NiMn-LDHs@PdNPs) for detecting the ESAT-6 antigen in human serum.	The aptasensor exhibited a wide linear detection range of 75 pg/mL to 10 ng/mL with a low limit of detection (LOD) of 0.629 pg/mL.	N/A	N/A	N/A	Biosensor	N/A	5'-Amidation (NH₂-(CH2)6) and 5'-Biotinylated	N/A	Aptasensor was stored at 4°C for and after 30 days, the current remained approximately 80% of the initial value.	N/A	N/A	N/A