Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 1
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0964 | 28987879 | 2017 | Thioaptamer targeted discoidal microparticles increase self immunity and reduce Mycobacterium tuberculosis burden in mice | CD44 Thioaptamer (CD44TA) | GAGATTCATCACGCGCATAGTCTTGGGA*CGGTGTTA*A*A*CGA*A*A*GGGGA*CGA*CCCGA*CTA*TGCGA*TGA*TGTCTTC | 74 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | CD44 receptor (Mtb-infected murine macrophages) | Develop a targeting system using CD44 thioaptamers (TA)-conjugated discoidal silicon mesoporous microparticles (SMP) to enhance accumulation of these agents/carriers in the infected macrophages in the lungs. | CD44TA-SMP treatment increased IP-10 (CXCL-10), MCP-1, MCP-2, and RANTES, with no change in IL-6 release compared to the control. | N/A | N/A | N/A | Therapeutics | N/A | *= 5'-monothio-dA and 5'-Cyanine5 (Cy5) Labeled | In uninfected murine and human macrophages, SMP and CD44TA-SMP did not affect the cell viability. | N/A | N/A | N/A | N/A |