Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 16
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0834 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | JN08 | ATGAGAGCGTCGGTGTGGTAACTTAATCCTCTAGTTTTAATTCTAGATACGGCGCATGCACTCTATGTAGGAGGGTGCGGAAGTA | 85 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 54.9 ± 7.8 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0835 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | JN27 | ATGAGAGCGTCGGTGTGGTAACTAGTCTGATTTCTATTTCCTTTAATTAGTCTGCACACATTGCATTGTAGGAGGGTGCGGAAGTA | 86 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 28.5 ± 4.9 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0836 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | JN27.SH | TAATTAGTCTGCACACATTGCATTGTAGGAGGGTGCGGAAGTA | 43 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 26.9 ± 5.6 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0837 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | JN08.SH | ATGCACTCTATGTAGGAGGGTGCGGA | 26 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 52.9 ± 10.4 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0838 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | JN17.SH | ATCCTCCTATCTATCGGTAGTTGTAGGAGGGTGCGG | 36 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 29 ± 7.3 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0839 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | JN21.SH | AGAGCGTCGGTGTGGTAACTGTTCAGGAGGATGACATTGTCGCCT | 45 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 18.1 ± 3.4 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0840 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | St17Lp21 | ATCCTCCTAGGTAACTGTTCAGGATGTAGGAGGGT | 35 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 16.9 ± 3.9 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0841 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | St21Lp17 | AAGCGTCGGTGTTCTATCGGTAGTTGACACCGACGCCT | 38 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 13.5 ± 2 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0842 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | St08Lp17 | ATGCACTCTTCTATCGGTAGTTGAGGGTGCGG | 32 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 12.5 ± 2.4 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_1002 | 29357405 | 2018 | Combat biofilm by bacteriostatic aptamer-functionalized graphene oxide | ST-3 (or ST-33) | CTCCTCTGACTGTAACCACGGTGGGAGAGATGCTATACAATCTTGTAAGGCGATGGACCG | 60 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Biofilm | Aptamer-GO conjugate reduces the cellular membrane potential to inhibit biofilm formation. | 93.3 ± 3.4% inhibition ratio at the initial stage of biofilm formation and 84.6 ± 5.1% degradation ratio on formed biofilms. | 12 | N/A | N/A | Therapeutics | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1376 | 32785202 | 2020 | Spectroscopic Study on Pseudomonas Aeruginosa Biofilm in the Presence of the Aptamer-DNA Scaffolded Silver Nanoclusters | NC1 | TACTTCCGCACCCTCCTACA | 20 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 10145) | Biofilm | DNA aptamer-enclosed silver nanoclusters (Ag-NC) were used to prevent biofilms. | Potency of an aptamer-DNA enclosed Ag-NC with a decrease in the net Ld wrt control follows NC2 > NC1 > NC5 > positive control ≈ NC3 > NC6. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1377 | 32785202 | 2020 | Spectroscopic Study on Pseudomonas Aeruginosa Biofilm in the Presence of the Aptamer-DNA Scaffolded Silver Nanoclusters | NC2 | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 10145) | Biofilm | DNA aptamer-enclosed silver nanoclusters (Ag-NC) were used to prevent biofilms. | Potency of an aptamer-DNA enclosed Ag-NC with a decrease in the net Ld wrt control follows NC2 > NC1 > NC5 > positive control ≈ NC3 > NC6. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1378 | 32785202 | 2020 | Spectroscopic Study on Pseudomonas Aeruginosa Biofilm in the Presence of the Aptamer-DNA Scaffolded Silver Nanoclusters | NC3 | CCCTTTCCCTTTCCCATTCCCGTTCCCTTTCCCTTTCCCATTCCCGTTA | 49 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 10145) | Biofilm | DNA aptamer-enclosed silver nanoclusters (Ag-NC) were used to prevent biofilms. | Potency of an aptamer-DNA enclosed Ag-NC with a decrease in the net Ld wrt control follows NC2 > NC1 > NC5 > positive control ≈ NC3 > NC6. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1379 | 32785202 | 2020 | Spectroscopic Study on Pseudomonas Aeruginosa Biofilm in the Presence of the Aptamer-DNA Scaffolded Silver Nanoclusters | NC5 | ATGAGAGCGTCGGTGTGGTA-CCCTTTCCCTTTCCCATTCCCGTTCCCTTTCCCTTTCCCATTCCCGTTA-TACTTCCGCACCCTCCTACA | 89 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 10145) | Biofilm | DNA aptamer-enclosed silver nanoclusters (Ag-NC) were used to prevent biofilms. | Potency of an aptamer-DNA enclosed Ag-NC with a decrease in the net Ld wrt control follows NC2 > NC1 > NC5 > positive control ≈ NC3 > NC6. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1380 | 32785202 | 2020 | Spectroscopic Study on Pseudomonas Aeruginosa Biofilm in the Presence of the Aptamer-DNA Scaffolded Silver Nanoclusters | NC6 | ATGAGAGCGTCGGTGTGGTA | 20 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 10145) | Biofilm | DNA aptamer-enclosed silver nanoclusters (Ag-NC) were used to prevent biofilms. | Potency of an aptamer-DNA enclosed Ag-NC with a decrease in the net Ld wrt control follows NC2 > NC1 > NC5 > positive control ≈ NC3 > NC6. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1829 | 37429429 | 2024 | Assessment of the growth inhibition and anti-biofilm activity of aptamer (PmA2G02) against Proteus mirabilis 1429T | PmA2G02 | ATTACTTACGCTATCTAAttttGCTGTAGGGGAGGAGGGTGGGTtttTTATCATCTGGTATGTTA | 65 | N/A | ssDNA | Proteus Mirabilis (1429T) | Biofilm | Inhibit biofilm formation, adhesion, and mobility, along with a reduction in biofilm-related genes, namely rsbA, fliC2 & fimD, in P. mirabilis. | Aptamer treatment resulted in a 50% reduction in biofilm thickness and a 2.29-fold and 1.34-fold decrease in mRNA expression of the fliC2 and fimD genes, respectively. | N/A | N/A | N/A | Therapeutics | Whole Cell-SELEX | N/A | Aptamer treatment did not significantly affect cell viability. | N/A | N/A | N/A | N/A |