Target : Biofilm

Total records found: 16

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_0834 289379982017Selection of DNA aptamers specific for live Pseudomonas aeruginosaJN08ATGAGAGCGTCGGTGTGGTAACTTAATCCTCTAGTTTTAATTCTAGATACGGCGCATGCACTCTATGTAGGAGGGTGCGGAAGTA855'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3'ssDNAPseudomonas Aeruginosa 692 (PA692) (ATCC 14502)Whole live and biofilm derived PA692 P. aeruginosa cellsIdentify aptamers to P. aeruginosa grown as biofilms in microfluidic cells.All aptamers were selective for P. aeruginosa with minimal cross-reactivity.7Flow Cytometry54.9 ± 7.8 nMDetectionWhole Cell-SELEXN/AAptamers had no intrinsic bacteriostatic and/or bactericidal activity.N/AN/AN/AN/A
ABdb_0835 289379982017Selection of DNA aptamers specific for live Pseudomonas aeruginosaJN27ATGAGAGCGTCGGTGTGGTAACTAGTCTGATTTCTATTTCCTTTAATTAGTCTGCACACATTGCATTGTAGGAGGGTGCGGAAGTA865'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3'ssDNAPseudomonas Aeruginosa 692 (PA692) (ATCC 14502)Whole live and biofilm derived PA692 P. aeruginosa cellsIdentify aptamers to P. aeruginosa grown as biofilms in microfluidic cells.All aptamers were selective for P. aeruginosa with minimal cross-reactivity.7Flow Cytometry28.5 ± 4.9 nMDetectionWhole Cell-SELEXN/AAptamers had no intrinsic bacteriostatic and/or bactericidal activity.N/AN/AN/AN/A
ABdb_0836 289379982017Selection of DNA aptamers specific for live Pseudomonas aeruginosaJN27.SHTAATTAGTCTGCACACATTGCATTGTAGGAGGGTGCGGAAGTA435'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3'ssDNAPseudomonas Aeruginosa 692 (PA692) (ATCC 14502)Whole live and biofilm derived PA692 P. aeruginosa cellsIdentify aptamers to P. aeruginosa grown as biofilms in microfluidic cells.All aptamers were selective for P. aeruginosa with minimal cross-reactivity.7Flow Cytometry26.9 ± 5.6 nMDetectionWhole Cell-SELEXN/AAptamers had no intrinsic bacteriostatic and/or bactericidal activity.N/AN/AN/AN/A
ABdb_0837 289379982017Selection of DNA aptamers specific for live Pseudomonas aeruginosaJN08.SHATGCACTCTATGTAGGAGGGTGCGGA265'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3'ssDNAPseudomonas Aeruginosa 692 (PA692) (ATCC 14502)Whole live and biofilm derived PA692 P. aeruginosa cellsIdentify aptamers to P. aeruginosa grown as biofilms in microfluidic cells.All aptamers were selective for P. aeruginosa with minimal cross-reactivity.7Flow Cytometry52.9 ± 10.4 nMDetectionWhole Cell-SELEXN/AAptamers had no intrinsic bacteriostatic and/or bactericidal activity.N/AN/AN/AN/A
ABdb_0838 289379982017Selection of DNA aptamers specific for live Pseudomonas aeruginosaJN17.SHATCCTCCTATCTATCGGTAGTTGTAGGAGGGTGCGG365'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3'ssDNAPseudomonas Aeruginosa 692 (PA692) (ATCC 14502)Whole live and biofilm derived PA692 P. aeruginosa cellsIdentify aptamers to P. aeruginosa grown as biofilms in microfluidic cells.All aptamers were selective for P. aeruginosa with minimal cross-reactivity.7Flow Cytometry29 ± 7.3 nMDetectionWhole Cell-SELEXN/AAptamers had no intrinsic bacteriostatic and/or bactericidal activity.N/AN/AN/AN/A
ABdb_0839 289379982017Selection of DNA aptamers specific for live Pseudomonas aeruginosaJN21.SHAGAGCGTCGGTGTGGTAACTGTTCAGGAGGATGACATTGTCGCCT455'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3'ssDNAPseudomonas Aeruginosa 692 (PA692) (ATCC 14502)Whole live and biofilm derived PA692 P. aeruginosa cellsIdentify aptamers to P. aeruginosa grown as biofilms in microfluidic cells.All aptamers were selective for P. aeruginosa with minimal cross-reactivity.7Flow Cytometry18.1 ± 3.4 nMDetectionWhole Cell-SELEXN/AAptamers had no intrinsic bacteriostatic and/or bactericidal activity.N/AN/AN/AN/A
ABdb_0840 289379982017Selection of DNA aptamers specific for live Pseudomonas aeruginosaSt17Lp21ATCCTCCTAGGTAACTGTTCAGGATGTAGGAGGGT355'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3'ssDNAPseudomonas Aeruginosa 692 (PA692) (ATCC 14502)Whole live and biofilm derived PA692 P. aeruginosa cellsIdentify aptamers to P. aeruginosa grown as biofilms in microfluidic cells.All aptamers were selective for P. aeruginosa with minimal cross-reactivity.7Flow Cytometry16.9 ± 3.9 nMDetectionWhole Cell-SELEXN/AAptamers had no intrinsic bacteriostatic and/or bactericidal activity.N/AN/AN/AN/A
ABdb_0841 289379982017Selection of DNA aptamers specific for live Pseudomonas aeruginosaSt21Lp17AAGCGTCGGTGTTCTATCGGTAGTTGACACCGACGCCT385'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3'ssDNAPseudomonas Aeruginosa 692 (PA692) (ATCC 14502)Whole live and biofilm derived PA692 P. aeruginosa cellsIdentify aptamers to P. aeruginosa grown as biofilms in microfluidic cells.All aptamers were selective for P. aeruginosa with minimal cross-reactivity.7Flow Cytometry13.5 ± 2 nMDetectionWhole Cell-SELEXN/AAptamers had no intrinsic bacteriostatic and/or bactericidal activity.N/AN/AN/AN/A
ABdb_0842 289379982017Selection of DNA aptamers specific for live Pseudomonas aeruginosaSt08Lp17ATGCACTCTTCTATCGGTAGTTGAGGGTGCGG325'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3'ssDNAPseudomonas Aeruginosa 692 (PA692) (ATCC 14502)Whole live and biofilm derived PA692 P. aeruginosa cellsIdentify aptamers to P. aeruginosa grown as biofilms in microfluidic cells.All aptamers were selective for P. aeruginosa with minimal cross-reactivity.7Flow Cytometry12.5 ± 2.4 nMDetectionWhole Cell-SELEXN/AAptamers had no intrinsic bacteriostatic and/or bactericidal activity.N/AN/AN/AN/A
ABdb_1002 293574052018Combat biofilm by bacteriostatic aptamer-functionalized graphene oxideST-3 (or ST-33)CTCCTCTGACTGTAACCACGGTGGGAGAGATGCTATACAATCTTGTAAGGCGATGGACCG60N/AssDNASalmonella Typhimurium (S. Typhimurium)BiofilmAptamer-GO conjugate reduces the cellular membrane potential to inhibit biofilm formation.93.3 ± 3.4% inhibition ratio at the initial stage of biofilm formation and 84.6 ± 5.1% degradation ratio on formed biofilms.12N/AN/ATherapeuticsN/A5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1376 327852022020Spectroscopic Study on Pseudomonas Aeruginosa Biofilm in the Presence of the Aptamer-DNA Scaffolded Silver NanoclustersNC1TACTTCCGCACCCTCCTACA20N/AssDNAPseudomonas Aeruginosa (ATCC 10145)BiofilmDNA aptamer-enclosed silver nanoclusters (Ag-NC) were used to prevent biofilms.Potency of an aptamer-DNA enclosed Ag-NC with a decrease in the net Ld wrt control follows NC2 > NC1 > NC5 > positive control ≈ NC3 > NC6.N/AN/AN/ATherapeuticsN/AN/AN/AN/AN/AN/AN/A
ABdb_1377 327852022020Spectroscopic Study on Pseudomonas Aeruginosa Biofilm in the Presence of the Aptamer-DNA Scaffolded Silver NanoclustersNC2CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG60N/AssDNAPseudomonas Aeruginosa (ATCC 10145)BiofilmDNA aptamer-enclosed silver nanoclusters (Ag-NC) were used to prevent biofilms.Potency of an aptamer-DNA enclosed Ag-NC with a decrease in the net Ld wrt control follows NC2 > NC1 > NC5 > positive control ≈ NC3 > NC6.N/AN/AN/ATherapeuticsN/AN/AN/AN/AN/AN/AN/A
ABdb_1378 327852022020Spectroscopic Study on Pseudomonas Aeruginosa Biofilm in the Presence of the Aptamer-DNA Scaffolded Silver NanoclustersNC3CCCTTTCCCTTTCCCATTCCCGTTCCCTTTCCCTTTCCCATTCCCGTTA49N/AssDNAPseudomonas Aeruginosa (ATCC 10145)BiofilmDNA aptamer-enclosed silver nanoclusters (Ag-NC) were used to prevent biofilms.Potency of an aptamer-DNA enclosed Ag-NC with a decrease in the net Ld wrt control follows NC2 > NC1 > NC5 > positive control ≈ NC3 > NC6.N/AN/AN/ATherapeuticsN/AN/AN/AN/AN/AN/AN/A
ABdb_1379 327852022020Spectroscopic Study on Pseudomonas Aeruginosa Biofilm in the Presence of the Aptamer-DNA Scaffolded Silver NanoclustersNC5ATGAGAGCGTCGGTGTGGTA-CCCTTTCCCTTTCCCATTCCCGTTCCCTTTCCCTTTCCCATTCCCGTTA-TACTTCCGCACCCTCCTACA89N/AssDNAPseudomonas Aeruginosa (ATCC 10145)BiofilmDNA aptamer-enclosed silver nanoclusters (Ag-NC) were used to prevent biofilms.Potency of an aptamer-DNA enclosed Ag-NC with a decrease in the net Ld wrt control follows NC2 > NC1 > NC5 > positive control ≈ NC3 > NC6.N/AN/AN/ATherapeuticsN/AN/AN/AN/AN/AN/AN/A
ABdb_1380 327852022020Spectroscopic Study on Pseudomonas Aeruginosa Biofilm in the Presence of the Aptamer-DNA Scaffolded Silver NanoclustersNC6ATGAGAGCGTCGGTGTGGTA20N/AssDNAPseudomonas Aeruginosa (ATCC 10145)BiofilmDNA aptamer-enclosed silver nanoclusters (Ag-NC) were used to prevent biofilms.Potency of an aptamer-DNA enclosed Ag-NC with a decrease in the net Ld wrt control follows NC2 > NC1 > NC5 > positive control ≈ NC3 > NC6.N/AN/AN/ATherapeuticsN/AN/AN/AN/AN/AN/AN/A
ABdb_1829 374294292024Assessment of the growth inhibition and anti-biofilm activity of aptamer (PmA2G02) against Proteus mirabilis 1429TPmA2G02ATTACTTACGCTATCTAAttttGCTGTAGGGGAGGAGGGTGGGTtttTTATCATCTGGTATGTTA65N/AssDNAProteus Mirabilis (1429T)BiofilmInhibit biofilm formation, adhesion, and mobility, along with a reduction in biofilm-related genes, namely rsbA, fliC2 & fimD, in P. mirabilis.Aptamer treatment resulted in a 50% reduction in biofilm thickness and a 2.29-fold and 1.34-fold decrease in mRNA expression of the fliC2 and fimD genes, respectively.N/AN/AN/ATherapeuticsWhole Cell-SELEXN/AAptamer treatment did not significantly affect cell viability.N/AN/AN/AN/A