Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 1
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_1775 | 37449120 | 2023 | Colorimetric aptasensor for detection of Bacillus cytotoxicus spores in milk and ready-to-use food | BAS-6R | ATCCGTCACACCTGCTCTGCACGGGCTCAGTTTGGCTTTGTATCCTAAGAGGATGGTGTTGGCTCCCGTAT | 71 | N/A | ssDNA | Bacillus Cereus ssp. cytotoxicus (NVH 391-98A) | B. cytotoxicus spores | Develop a colorimetric assay employing AuNPs and magnetic particles (MPs) for the detection of Bacillus cytotoxicus spores in food. | Achieving the naked-eye limit of detection as low as 10(2) cfu/mL in water and milk, and 10(4) cfu/mL in mashed potatoes. | N/A | N/A | N/A | Biosensor | N/A | 5′-Thiolated and 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |